CN114774396A

CN114774396A - Keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additive

Info

Publication number: CN114774396A
Application number: CN202210694111.1A
Authority: CN
Inventors: 娄倩倩; 张西雷; 曹爱智
Original assignee: Shandong Longchang Animal Health Product Co ltd
Current assignee: Shandong Longchang Animal Health Products Co ltd
Priority date: 2022-06-20
Filing date: 2022-06-20
Publication date: 2022-07-22
Anticipated expiration: 2042-06-20
Also published as: CN114774396B

Abstract

The invention provides a keratinase mutant, a compound preparation of the keratinase mutant and bile acid and application of the compound preparation in additives. The invention makesUsing error-prone PCR methodBacillus licheniformisThe keratinase gene is mutated, keratinase mutants KM1, KM2 and KM3 are obtained through screening, and the enzyme activities of the mutants are respectively 1.5, 2.05 and 2.9 times of the original keratinase under the reaction condition of 30 ℃. The invention also utilizes the engineering bacteria containing the keratinase mutant KM to prepare an enzyme preparation through fermentation, filtration and drying, and the enzyme preparation is compounded with bile acid, so that the soybean meal antigen protein enzymolysis effect is good, and the soybean meal antigen protein enzymolysis agent can obviously play a role in diarrhea prevention and protect intestines and stomach of animals when being used for livestock breeding, and has good industrial value and market application prospect.

Description

Keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additive

Technical Field

The invention belongs to the field of enzyme engineering, and particularly relates to a keratinase mutant, a compound preparation of the keratinase mutant and bile acid, and application of the compound preparation in additives.

Background

Keratinase is a specific keratinase which degrades keratin substrates (e.g., cutin, dandruff, feather, etc.) and is produced by various microorganisms such as fungi, actinomycetes and bacteria when growing on keratin as a single carbon source. Keratinase is a protease with wider substrate specificity and strong hydrolysis catalytic capability, is widely applied to the daily chemical industry, the animal husbandry industry, the feed industry, the leather industry and the medicine industry, and has great research and application values. The keratin has crude protein content over 80%, total amino acid content over 70%, complete animal essential amino acid variety, great amount of macro elements, trace elements and unknown growth factors, and is one excellent feed protein and fertilizer source capable of replacing or partially replacing fish meal. At present, most of wild keratinase belongs to high-temperature alkaline protease, the optimal reaction temperature is about 60 ℃, and the enzyme activity or catalytic activity under the condition of 20-40 ℃ is not high.

The error-prone PCR technology is that DNA polymerase is adopted to carry out PCR reaction to amplify target fragments, and simultaneously, the reaction conditions are adjusted to increase gene mutation frequency, so that mutation is randomly introduced into target genes at a certain frequency to construct a mutant library, and then required forward mutants are screened in a high-throughput manner. Error-prone PCR technology is an important approach in the engineering of protein molecules.

Disclosure of Invention

The invention provides a keratinase mutant, a compound preparation of the keratinase mutant and bile acid and application of the compound preparation in additives. The invention obtains the mutants KM1, KM2 and KM3 with improved enzyme activity under the condition of low temperature through screening, and can be mixed with bile acid to prepare a new feed additive, thereby effectively reducing the diarrhea condition of livestock and poultry and improving the intestinal function of the livestock and poultry.

In order to realize the purpose of the invention, the invention adopts the following technical scheme to realize:

the invention provides a keratinase mutant, which is a keratinase mutant KM, and the amino acid sequence of the keratinase mutant is shown in SEQ ID NO: 3 or as shown in SEQ ID NO: 5 or as shown in SEQ ID NO: shown at 7.

Further, the keratinase mutant KM is prepared by the following steps of specifically preparing a protein with an amino acid sequence of SEQ ID NO: 1 into aspartic acid at the 191 th asparagine of the keratinase to obtain a keratinase mutant KM 1; consisting of an amino acid sequence of SEQ ID NO: 1, a keratinase mutant KM2 obtained by changing asparagine at position 191 to aspartic acid and valine at position 149 to alanine; consisting of a polypeptide with the amino acid sequence of SEQ ID NO: 1 from the group consisting of the keratinase mutant KM3 wherein the 191 th asparagine of the keratinase is changed to aspartic acid and the 232 th glycine is changed to glutamic acid.

The invention also provides a coding gene, wherein the coding gene is the coding gene of the keratinase mutant KM, and the nucleotide sequence of the coding gene is shown as SEQ ID NO: 4, or as shown in SEQ ID NO: 6 or as shown in SEQ ID NO: shown in fig. 8.

The invention also provides a recombinant expression vector which comprises the coding gene of the keratinase mutant KM.

The invention also provides a recombinant engineering bacterium, which comprises the encoding gene of the keratinase mutant KM.

Furthermore, the recombinant engineering bacteria are bacillus subtilis, bacillus amyloliquefaciens, bacillus pumilus and bacillus licheniformis.

The invention also provides a compound preparation containing bile acid, and the compound preparation simultaneously contains the keratinase mutant KM and the bile acid.

Furthermore, the compound preparation is prepared by mixing a powder preparation prepared by fermenting, filtering and drying recombinant engineering bacteria containing keratinase mutant KM and bile acid in a mass-volume ratio of 1: 1-5.

Further, the keratinase mutant KM is a keratinase mutant KM 3.

The invention also provides application of the keratinase mutant KM or the compound preparation in enzymolysis of animal keratin.

Further, the animal keratin is keratin in chicken, duck, goose, wool, cattle, pig hair, horn and nail.

The invention also provides application of the keratinase mutant KM or the compound preparation in preparation of animal feed additives for reducing animal diarrhea.

Furthermore, the dosage of the keratinase mutant KM or the compound preparation is 100-500 g/t of animal feed.

Compared with the prior art, the invention has the advantages and the technical effects that:

the invention is provided withBacillus licheniformisBased on the gene of the source keratinase, a single-point mutant KM1 containing N191D, and double-point mutants KM2 and KM3 containing N191D/V149A and N191D/G232E are obtained through screening. Compared with the original keratinase, the modified mutant KM1, KM2 and KM3 has the enzyme activities 1.5, 2.05 and 2.9 times of the original keratinase under the reaction condition of 30 ℃. The invention also utilizes the engineering bacteria containing the mutant KM3 to prepare an enzyme preparation through fermentation, filtration and drying, and the enzyme preparation is compounded with bile acid, so that the soybean meal antigen protein enzymolysis effect is good, and the soybean meal antigen protein enzymolysis agent can obviously play a role in diarrhea prevention and protect intestines and stomach of animals when being used in livestock breeding.

Drawings

FIG. 1 is a diagram showing the results of the amplification electrophoresis of the keratinase gene.

FIG. 2 is a diagram of the screening of the keratinase mutants.

FIG. 3 is an enzyme activity assay of the keratinase mutants at 30 ℃.

FIG. 4 shows the fermentation data of the keratinase mutant KM3 in a 15L fermenter.

FIG. 5 is a gel diagram of the bean pulp antigenic protein obtained by in vitro enzymolysis of the keratinase mutant, wherein the number 1 indicates that the bean pulp is not treated, and the numbers 2-5 respectively indicate that 200U/mL of keratinase is added for post-treatment for 2h, 4h, 8h and 16 h.

Detailed Description

In order to facilitate understanding of the invention, the invention will be described in more complete detail with reference to the drawings and examples, but the scope of the invention is not limited to the following examples.

The molecular biology experiments, which are not specifically described in the following examples, can be performed according to the specific methods listed in molecular cloning, a laboratory manual (third edition) j. sambrook, or according to the kit and product instructions. Reagents and biomaterials used in specific examples are commercially available without specific recitation.

1. Strains and vectors

Bacillus subtilis WB600, plasmid pWB980, Escherichia coli BL21, plasmid pET-21a (+) from Invitrogen.

2. Reagents and culture media

A plasmid extraction kit, a fragment purification recovery kit, restriction enzymes, a protein Marker: blue Plus II Protein Marker (14-120 kDa) and the like available from Zanzein, Inc. of Nanjing; ampicillin was purchased from Biotechnology engineering (Shanghai) Inc.; GeneMorph II random mutation PCR kit was purchased from Stratagene.

LB medium formula: 1% tryptone, 0.5% yeast extract, 1% NaCl.

The fermentation medium formula comprises: 3.5-10% of soybean meal, 5-10% of cottonseed meal, 2-6% of corn flour, 0.5-1.0% of PPG-200000.5, 0.5-1.0% of protease, 0.5-1.0% of amylase and 0.2-0.5% of disodium hydrogen phosphate by mass ratio.

3. And (3) enzyme activity determination: refer to the determination method of protease in GBT 23527-2009 protease preparation.

Example 1: construction of recombinant strain of keratinase gene and construction of mutant library thereof

Reference toBacillus licheniformisFrom the source keratinase, the amino acid sequence (SEQ ID NO: 1) and the DNA sequence (SEQ ID NO: 2) were designed as primers, a Kpn I restriction site was designed at the 5 'end, and a BamH I restriction site was designed at the 3' end, and a band of interest was amplified by PCR using the following primers:

KF: CGGGGTACCATGATGAGGAAAAAGAGTTT（SEQ ID NO：9）；

KR: CGCCCATCCTTATTGAGCGGCAGCTTCGA（SEQ ID NO：10）。

the reaction system is as follows:

PCR upstream primer (25 pmol/. mu.L)	1µL
		PCR downstream primer (25 pmol/. mu.L)	1µL
dNTP mixture	4µL
		PCR Buffer	5µL
Template DNA	1µL
		DNA polymerase	0.5µL
Adding double distilled water to the total volume	50µL

The reaction conditions are as follows: pre-denaturation at 95 deg.C for 3min, denaturation at 94 deg.C for 10 sec, annealing at 58 deg.C for 30 sec, extension at 72 deg.C for 1min, circulation for 30 times, extension at 72 deg.C for 10min, and storage at 15 deg.C.

And (3) performing electrophoresis on the PCR product, wherein the electrophoresis result is shown in figure 1, purifying the PCR product with a single band, performing double enzyme digestion, connecting the PCR product with a pWB980 vector (according to the steps of the kit specification), transforming the Bacillus subtilis WB600, coating a plate containing antibiotics, and screening recombinant bacteria.

Mutant library construction, using GeneMorph II random mutation PCR kit, with SEQ ID NO: 2 as template, and carrying out random mutation by using the following primer sequences:

KF: CGGGGTACCATGATGAGGAAAAAGAGTTT（SEQ ID NO：9）；

KR: CGCCCATCCTTATTGAGCGGCAGCTTCGA（SEQ ID NO：10）。

and (3) carrying out double enzyme digestion on the amplified random mutation PCR product by using Kpn I and BamH I, connecting the product to a pWB980 vector, transforming the Bacillus subtilis WB600, and screening positive clones by using a kanamycin-resistant LB plate.

Single colonies of the selected transformants were inoculated into a 96-well deep-well plate. Each plate was inoculated with 3 single colonies K0 expressing the original keratinase as controls. 500 mu L of LB liquid medium containing kanamycin resistance is filled into each well, after shaking culture is carried out at 37 ℃ and 200rpm for 24 hours, the fermentation liquor is centrifuged, the supernatant is taken, and then the enzymatic activity of keratinase is detected. The results are shown in FIG. 2, and the mutant gene with the enzyme activity obviously higher than that of the control K0 under the low temperature condition (20 ℃ -40 ℃) is subjected to repeated verification and sequencing analysis.

The mutant N191D with original keratinase as an initial template and improved enzyme activity under the low temperature condition is screened and named as KM1, and the amino acid sequence is shown as SEQ ID NO: 3, and the coded nucleotide sequence is shown as SEQ ID NO: 4, respectively.

Example 2: construction of mutant library of keratinase KM1 in error-prone PCR manner

Performing a second round of random mutation by using the keratinase gene KM1 screened in example 1 as a template, wherein the construction process of a mutation library, the used material reagents, the operation conditions and the like are the same as those in example 1; and during mutant culture and screening, KM1 is used as a control, the enzyme activity of the keratinase mutant is detected, and the mutant gene with the enzyme activity higher than KM1 under the low-temperature condition is sequenced.

The following mutants were finally screened:

the KM2 mutation mode is N191D/V149A, and the amino acid sequence of the KM2 mutation mode is shown as SEQ ID No: 5, the nucleotide sequence is shown as SEQ ID No: 6 is shown in the specification;

the KM3 mutation mode is N191D/G232E, and the amino acid sequence is shown as SEQ ID No: 7, and the nucleotide sequence is shown as SEQ ID No: shown in fig. 8.

Example 3: shaking flask fermentation expression verification of recombinant strain of keratinase mutant

Respectively inoculating the recombinant bacteria containing the mutants KM1, KM2 and KM3 into a fermentation medium, performing shake flask fermentation for 78h, centrifuging the culture solution to obtain a supernatant, and measuring the average enzyme activity of the supernatant of each mutant fermentation solution at 30 ℃.

The results are shown in fig. 3, the enzyme activities of the keratinase KM1, KM2 and KM3 obtained after mutation at 30 ℃ are respectively 1.5, 2.05 and 2.9 times of the original keratinase K0, wherein the KM3 mutant can better exert the enzymolysis catalysis function at low temperature.

Example 4: keratinase mutant fermentation and preparation in 15L fermentation tank

The genetically engineered bacteria expressing the keratinase mutant KM3 were streaked on LB plates containing kanamycin resistance (final concentration: 20. mu.g/mL), cultured at 37 ℃ until single colonies grew out, and the single colonies with good growth were selected for fermentation. The fermentation production process comprises the following steps:

(1) recombining, inoculating into an LB liquid culture medium, culturing at 37 ℃ and 200rpm overnight with shaking;

(2) inoculating the seed liquid cultured overnight into a 15L fermentation tank, wherein the liquid filling amount is 8L;

(3) controlling conditions: at 37 ℃, 300 ℃ and 600 rpm; 20% -60% of dissolved oxygen; the pot pressure is 0.05 Mpa; the ventilation capacity is 0-8h 0.6 m³H; 8 hours till the tank is stopped for 0.8-0.9 m³/h。

(4) Fermenting until the generation rate of microscopic spores is more than 90%.

(5) Stopping the tank, and centrifuging the fermentation liquor at 5000 rpm for 5 min to obtain supernatant enzyme solution.

(6) The pH value is natural in the fermentation process, the enzyme activity is measured after fermentation is carried out for 24 hours, after the fermentation is finished (generally for 48 hours), the fermentation liquor is processed by a plate and frame filter to obtain crude enzyme liquid, and then the crude enzyme liquid is sprayed to dry the keratinase powder preparation by a spray tower for application test.

The fermentation process curve is shown in FIG. 4: sampling every 4h, determining the enzyme production level, and fermenting the keratinase mutant KM3 for 48h until the bacteriostatic activity reaches the highest point.

Example 5: experiment for in vitro enzymolysis of soybean meal antigen protein by keratinase

The soybean meal is the most common feed raw material, is an important protein nutrition source for livestock and poultry, and always accounts for more than 70% of the protein feed raw material in China for many years. The keratinase can effectively eliminate the function of trypsin inhibitor, degrade plant keratin and antigen protein (allergen), improve the utilization efficiency of protein raw materials, obviously reduce the nitrogen discharge amount in feces and urine, prevent food-borne diarrhea and promote growth. 32 kinds of soybean antigenic proteins are confirmed, wherein glycinin and beta-conglycinin are the most immunogenic soybean antigenic proteins, account for 65-80% of the total protein of soybean seeds, and are the main antigenic proteins in soybeans.

In this example, the soybean meal was ground into fine powder, and then prepared into a suspension of 0.1g/mL soybean meal using a phosphate buffer (pH 7.5-9.0). The keratinase fermentation enzyme solution prepared in example 4 was sterilized by a 0.22 μm sterile filtration membrane and then diluted to 200U/mL for use. 5mL of the suspension is taken as a control group, and 1mL of sterile water is added; experimental group 5mL of the above suspension was added to 1mL of an enzyme solution containing 200U/mL of keratinase. Placing the test group and the control group into a water bath shaker at 40 ℃ and 100 r for enzymolysis digestion, and taking 2h, 4h, 8h and 16h enzymolysis samples respectively. The conditions of enzymatic digestion and removal of antigen protein were analyzed by SDS-PAGE.

As can be seen from figure 5, after enzymolysis is carried out for 8 hours, the keratinase mutant can remove most of antigen protein, so that the allergen is remarkably reduced, meanwhile, macromolecular protein which is difficult to digest is subjected to enzymolysis to form small peptide, and the growth promotion effect on animals such as livestock and poultry can be well achieved.

Example 6: preparation of compound preparation and animal breeding test

The keratinase powder preparation prepared in example 4 was uniformly mixed with bile acid at a mass volume ratio of 1:1 to prepare a compounded preparation. The active ingredients of the bile acid comprise hyocholic acid, hyodeoxycholic acid and chenodeoxycholic acid, wherein the weight percentage of the sum of the hyocholic acid and the hyodeoxycholic acid is 78.0%, the weight percentage of the chenodeoxycholic acid is 20.0%, and the balance of water and ash (the total weight percentage is calculated by 100%).

Selecting weaned piglets in a certain farm, wherein the weight of the weaned piglets is 10 +/-0.60 kg/head, selecting 30 piglets in a control group, repeating for 3 times, and selecting 10 piglets in each repetition; the experimental group had 30 replicates, with 10 replicates each. The control group and the test group are fed with low-protein daily ration, the content of crude protein is 20 percent, but the test group is added with 200 g/t of compound preparation in the feed at the same time; the animals are fed respectively for 30 days. And (4) periodically counting the feed intake of the weaned piglets, weighing, and calculating the feed-weight ratio and the diarrhea index.

The results are shown in table 1, the daily gain and the feed-to-weight ratio of the two groups are not substantially different, while the diarrhea index of the test group is reduced by 40% from the diarrhea index. The formula shows that the compound preparation containing the keratinase and the bile acid is added into the feed, so that the crude protein in the feed for the piglets can be effectively reduced, the protein utilization rate is promoted, and meanwhile, the obvious diarrhea prevention effect can be achieved, and the intestines and stomach of the piglets are protected.

TABLE 1 animal breeding test data

	Daily gain/g	Material to weight ratio	Index of diarrhea
				Control group	444±3.11	1.44±0.056	2.51±0.22
Test group	448±0.75	1.42±0.028	1.50±0.24

The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; such modifications and substitutions do not depart from the spirit and scope of the corresponding claims.

Sequence listing

<110> Shandong Longchang animal health products Limited

<120> keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additives

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met

1 5 10 15

Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro

20 25 30

Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val

35 40 45

Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys

50 55 60

Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp

65 70 75 80

Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val

85 90 95

Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly

100 105 110

Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly

115 120 125

Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His

130 135 140

Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala

145 150 155 160

Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val

165 170 175

Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val

180 185 190

Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr

195 200 205

Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp

210 215 220

Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys

225 230 235 240

Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala

245 250 255

Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro

260 265 270

Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser

275 280 285

Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala

290 295 300

Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr

305 310 315 320

Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala

325 330 335

Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn

340 345 350

Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly

355 360 365

Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln

370 375

<210> 2

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60

atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120

attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240

aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300

gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360

gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420

caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480

tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540

aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600

aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660

aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720

caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780

ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840

gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900

gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgtca 1020

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080

ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140

<210> 3

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met

1 5 10 15

Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro

20 25 30

Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val

35 40 45

Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys

50 55 60

Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp

65 70 75 80

Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val

85 90 95

Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly

100 105 110

Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly

115 120 125

Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His

130 135 140

Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala

145 150 155 160

Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val

165 170 175

Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asp Val

180 185 190

Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr

195 200 205

Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp

210 215 220

Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys

225 230 235 240

Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala

245 250 255

Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro

260 265 270

Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser

275 280 285

Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala

290 295 300

Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr

305 310 315 320

Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala

325 330 335

Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn

340 345 350

Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly

355 360 365

Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln

370 375

<210> 4

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60

atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120

attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240

aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300

gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360

gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420

caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480

tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540

aatacaacgg gtgtattagg cgttgcgccg gacgtatcct tgtacgcggt taaagtgctg 600

aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660

aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720

caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780

ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840

gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900

gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgtca 1020

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080

ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140

<210> 5

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met

1 5 10 15

Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro

20 25 30

Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val

35 40 45

Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys

50 55 60

Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp

65 70 75 80

Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val

85 90 95

Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly

100 105 110

Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly

115 120 125

Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His

130 135 140

Pro Asp Leu Asn Ala Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala

145 150 155 160

Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val

165 170 175

Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asp Val

180 185 190

Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr

195 200 205

Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp

210 215 220

Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys

225 230 235 240

Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala

245 250 255

Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro

260 265 270

Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser

275 280 285

Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala

290 295 300

Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr

305 310 315 320

Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala

325 330 335

Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn

340 345 350

Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly

355 360 365

Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln

370 375

<210> 6

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60

atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120

attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240

aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300

gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360

gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420

caagcttctc atccggactt gaacgcagtc ggcggagcaa gcttcgtagc tggcgaagct 480

tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540

aatacaacgg gtgtattagg cgttgcgccg gacgtatcct tgtacgcggt taaagtgctg 600

aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660

aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720

caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780

ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840

gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900

gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgtca 1020

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080

ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140

<210> 7

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met

1 5 10 15

Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro

20 25 30

Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val

35 40 45

Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys

50 55 60

Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp

65 70 75 80

Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val

85 90 95

Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly

100 105 110

Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly

115 120 125

Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His

130 135 140

Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala

145 150 155 160

Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val

165 170 175

Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asp Val

180 185 190

Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr

195 200 205

Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp

210 215 220

Val Ile Asn Met Ser Leu Gly Glu Pro Ser Gly Ser Thr Ala Met Lys

225 230 235 240

Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala

245 250 255

Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro

260 265 270

Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser

275 280 285

Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala

290 295 300

Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr

305 310 315 320

Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala

325 330 335

Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn

340 345 350

Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly

355 360 365

Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln

370 375

<210> 8

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60

atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120

attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240

aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300

gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360

gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420

caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480

tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540

aatacaacgg gtgtattagg cgttgcgccg gacgtatcct tgtacgcggt taaagtgctg 600

aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660

aacggcatgg atgttatcaa catgagcctt ggagaaccat caggctcaac agcgatgaaa 720

caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780

ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840

gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900

gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgtca 1020

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080

ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140

<210> 9

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cggggtacca tgatgaggaa aaagagttt 29

<210> 10

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgcccatcct tattgagcgg cagcttcga 29

Claims

1. The keratinase mutant is characterized in that the keratinase mutant is a keratinase mutant KM, and the amino acid sequence of the keratinase mutant is shown in SEQ ID NO: 3 or as shown in SEQ ID NO: 5 or as shown in SEQ ID NO: shown in fig. 7.

2. The keratinase mutant according to claim 1, wherein the keratinase mutant KM is a nucleic acid sequence consisting of the amino acid sequence SEQ ID NO: 1 into aspartic acid at the 191 th asparagine of the keratinase to obtain a keratinase mutant KM 1; consisting of an amino acid sequence of SEQ ID NO: 1, a keratinase mutant KM2 obtained by converting asparagine at position 191 to aspartic acid and valine at position 149 to alanine; consisting of an amino acid sequence of SEQ ID NO: 1 from the residue of the keratinase, asparagine at position 191 was changed to aspartic acid and glycine at position 232 was changed to glutamic acid to obtain a keratinase mutant KM 3.

3. A coding gene, which is the coding gene of the keratinase mutant KM of claim 1, and the nucleotide sequence of which is as shown in SEQ ID NO: 4, or as shown in SEQ ID NO: 6 or as shown in SEQ ID NO: shown in fig. 8.

4. A recombinant expression vector comprising the coding gene of claim 3.

5. A recombinant engineered bacterium comprising the coding gene of claim 3.

6. A compound preparation containing bile acid, which is characterized in that the compound preparation simultaneously contains the keratinase mutant KM and the bile acid, wherein the keratinase mutant KM comprises a structural unit as described in claim 1.

7. The compound preparation as claimed in claim 6, wherein the compound preparation is prepared by mixing a powder preparation prepared by fermenting, filtering and drying recombinant engineering bacteria containing keratinase mutant KM and bile acid in a mass-to-volume ratio of 1: 1-5.

8. The application of the keratinase mutant or the compound preparation in enzymolysis of animal keratins is characterized in that the keratinase mutant is the keratinase mutant KM of claim 1; the built preparation is the built preparation containing bile acid as described in claim 6.

9. The use of a keratinase mutant or a combination preparation for the preparation of an animal feed additive for reducing diarrhea in animals, wherein the keratinase mutant is the keratinase mutant KM as claimed in claim 1; the built preparation is the built preparation containing bile acid in claim 6.

10. The use according to claim 9, wherein the amount of the keratinase mutant KM or the compounded preparation is 100 g/t to 500 g/t of animal feed.