CN115074347A

CN115074347A - Feed additive containing keratinase mutant and bile acid and application thereof

Info

Publication number: CN115074347A
Application number: CN202210745703.1A
Authority: CN
Inventors: 娄倩倩; 曹爱智; 张西雷; 徐志敏
Original assignee: Shandong Longchang Animal Health Product Co ltd
Current assignee: Shandong Longchang Animal Health Product Co ltd
Priority date: 2022-06-29
Filing date: 2022-06-29
Publication date: 2022-09-20

Abstract

The inventionA feed additive containing keratinase mutant and bile acid and its application are provided. The invention uses a pair of saturation mutagenesis methodsBacillus licheniformisThe keratinase genes from sources are mutated to obtain keratinase mutants KS01, KS02, KS03 and KS04, compared with the original keratinase, the optimum reaction temperature of the mutants is reduced from 55 ℃ to 38 ℃, 45 ℃, 46 ℃ and 50 ℃, and the residual enzyme activity of the mutants KS01 is over 65 percent under the reaction condition of 25 ℃ to 35 ℃. The invention also utilizes the enzyme preparation prepared by fermenting, filtering and drying the engineering bacteria containing the mutant to be compounded with bile acid, not only has good effect of carrying out enzymolysis on the soybean meal antigen protein, but also can obviously play a role in preventing diarrhea when being used in livestock breeding, protects the intestines and stomach of animals, and has good industrial value and market application prospect.

Description

Feed additive containing keratinase mutant and bile acid and application thereof

Technical Field

The invention belongs to the field of feed additives, and particularly relates to a feed additive containing a keratinase mutant and bile acid and application thereof.

Background

Keratinase is a specific keratinase which is capable of degrading keratin substrates (e.g., cutin, dandruff, feather, etc.) and is produced by various microorganisms such as fungi, actinomycetes, and bacteria when growing on keratin as a single carbon source. Keratinase is a protease with wider substrate specificity and strong hydrolysis catalytic capability, is widely applied to the daily chemical industry, the animal husbandry industry, the feed industry, the leather industry and the medicine industry, and has great research and application values. The keratin has crude protein content of over 80 percent, total amount of various amino acids of over 70 percent, complete types of essential amino acids for animals, and simultaneously contains more macroelements, microelements and unknown growth factors, is a good feed protein capable of replacing or partially replacing fish meal and a fertilizer source, and has important application prospect for development and utilization of the keratin. At present, wild keratinase mostly belongs to high-temperature alkaline protease, the optimal reaction temperature is about 60 ℃ generally, and the enzyme activity or catalytic activity under the condition of 20-40 ℃ is not high generally.

The error-prone PCR technology is that DNA polymerase is adopted to carry out PCR reaction to amplify target fragments, and simultaneously, the reaction conditions are adjusted to increase the gene mutation frequency, so that mutation is randomly introduced into target genes at a certain frequency to construct a mutant library, and then the required forward mutant is screened in a high-throughput manner. Error-prone PCR technology is an important approach in protein molecular engineering.

Disclosure of Invention

The invention provides a feed additive containing a keratinase mutant and bile acid and application thereof. The invention obtains several mutants with improved enzyme activity under low temperature condition by random mutation screening: KS01, KS02, KS03 and KS04 are mixed with bile acid to prepare the feed additive, so that the diarrhea of livestock and poultry is effectively reduced, and the intestinal function of the livestock and poultry is improved.

In order to achieve the purpose of the invention, the invention is realized by adopting the following technical scheme:

the invention provides a keratinase mutant, and an amino acid sequence of the keratinase mutant has an amino acid sequence as shown in one of the following items:

(1) as shown in SEQ ID NO: 3;

(2) as shown in SEQ ID NO: 5;

(3) as shown in SEQ ID NO: 7;

(4) as shown in SEQ ID NO: 9, or a pharmaceutically acceptable salt thereof.

Further, the keratinase mutant is specifically a mutant formed by amino acid sequences of SEQ ID NO: 1 to valine to the serine at position 340 of keratinase, and a keratinase mutant KS 01; consisting of an amino acid sequence of SEQ ID NO: 1 from serine at position 340 to glutamic acid of keratinase to obtain keratinase mutant KS 02; consisting of an amino acid sequence of SEQ ID NO: 1 from serine at position 340 to leucine of keratinase to obtain keratinase mutant KS 03; consisting of an amino acid sequence of SEQ ID NO: 1 to the amino acid residue of serine at position 340 of keratinase to phenylalanine to obtain keratinase mutant KS 04.

The invention also provides a coding gene of the keratinase mutant, and the coding gene has a nucleotide sequence as shown in one of the following parts:

(1) as shown in SEQ ID NO: 4;

(2) as shown in SEQ ID NO: 6;

(3) as shown in SEQ ID NO: 8;

(4) as shown in SEQ ID NO: 10, or a nucleotide sequence shown in the figure.

The invention also provides a recombinant expression vector containing the coding gene of the keratinase mutant.

The invention also provides a recombinant engineering bacterium containing the coding gene of the keratinase mutant.

Furthermore, the recombinant engineering bacteria are bacillus subtilis, bacillus amyloliquefaciens, bacillus pumilus and bacillus licheniformis.

The invention also provides a feed additive which simultaneously comprises the keratinase mutant and bile acid.

Furthermore, the feed additive is prepared by mixing an enzyme preparation prepared by fermenting, filtering and drying recombinant engineering bacteria containing keratinase mutants and bile acid in a mass-volume ratio of 1: 1-5.

The invention also provides application of the keratinase mutant or the feed additive in preparing feed for promoting animal growth and reducing animal diarrhea.

Furthermore, the dosage of the keratinase mutant or the feed additive is 100 g/t to 500 g/t of animal feed.

Compared with the prior art, the invention has the advantages and the technical effects that:

the invention is provided withBacillus licheniformisThe selected keratinase gene is taken as a basis, mutants KS01, KS02, KS03 and KS04 containing S340V, S340E, S340L and S340F are obtained through screening, compared with original keratinase, the optimum reaction temperature of the mutants is reduced from 55 ℃ to 38 ℃, 45 ℃, 46 ℃ and 50 ℃, and the residual enzyme activity of the mutants KS01 is over 65 percent under the reaction condition of 25 ℃ to 35 ℃, so that the mutants have good market application potential in the fields of washing, tanning, feed and the like.

The invention also utilizes the enzyme preparation prepared by fermenting, filtering and drying the engineering bacteria containing the mutant to be compounded with bile acid, not only has good effect of enzymolysis of soybean meal antigen protein, but also can obviously play a role in diarrhea prevention and protect the intestines and stomach of animals when being used in livestock breeding.

Drawings

FIG. 1 is a diagram showing the results of the amplification electrophoresis of the keratinase gene.

FIG. 2 is a diagram of the screening process of the keratinase mutant.

FIG. 3 is the enzyme activity and optimum reaction temperature analysis of the keratinase mutant.

FIG. 4 is the fermentation data of keratinase mutant KL01 in a 15L fermentor.

FIG. 5 shows the effect of the fermentation broth of keratinase mutants on feather protein degradation.

FIG. 6 is a gel diagram of the in vitro enzymolysis of soybean meal antigenic protein by keratinase, wherein number 1 indicates that the soybean meal is not processed, and numbers 2-5 indicate that the soybean meal is processed for 2h, 4h, 8h and 16h after 200U/mL keratinase is added respectively.

Detailed Description

In order to facilitate understanding of the invention, the invention will be described in more detail below with reference to the accompanying drawings and examples, but the scope of the invention is not limited to the following specific examples.

The molecular biological experiments, which are not specifically described in the following examples, can be performed by referring to the specific methods listed in molecular cloning, a laboratory manual (third edition) J. SammBruker, or according to the kit and product instructions. Reagents and biomaterials used in specific examples are commercially available without specific recitation.

1. Strains and vectors

Bacillus subtilis WB600, plasmid pWB980, Escherichia coli BL21, plasmid pET-21a (+) from Invitrogen.

2. Reagents and culture media

A plasmid extraction kit, a fragment purification recovery kit, a restriction enzyme, a protein Marker: blue Plus II Protein Marker (14-120 kDa) and the like available from Nanjing Novophilia GmbH; ampicillin was purchased from Biotechnology engineering (Shanghai) Inc.; GeneMorph II random mutation PCR kit was purchased from Stratagene.

The LB medium formula: 1% tryptone, 0.5% yeast extract, 1% NaCl.

The fermentation medium formula comprises: 3.5-10% of soybean meal, 5-10% of cottonseed meal, 2-6% of corn flour, 0.5-1.0% of PPG-200000.5, 0.5-1.0% of protease, 0.5-1.0% of amylase and 0.2-0.5% of disodium hydrogen phosphate by mass ratio.

3. And (3) enzyme activity determination: method for determining protease in GBT 23527-2009 protease preparation

Example 1: construction of recombinant strain of keratinase gene and construction of mutant library thereof

Reference toBacillus licheniformisThe primers for the amino acid sequence (SEQ ID NO: 1) and DNA sequence (SEQ ID NO: 2) of the source keratinase were designed, a Kpn I restriction site was designed at the 5 'end, a BamH I restriction site was designed at the 3' end, and the target band was amplified by PCR using the following primers:

KF: CGGGGTACCATGATGAGGAAAAAGAGTTT（SEQ ID NO：11）；

KR: CGCCCATCCTTATTGAGCGGCAGCTTCGA（SEQ ID NO：12）。

the reaction system is as follows:

PCR upstream primer (25 pmol/. mu.L)	1µL
		PCR downstream primer (25 pmol/. mu.L)	1µL
dNTP mixture	4µL
		PCR Buffer	5µL
Template DNA	1µL
		DNA polymerase	0.5µL
Adding double distilled water to the total volume	50µL

The reaction conditions are as follows: pre-denaturation at 95 deg.C for 3min, denaturation at 94 deg.C for 10sec, annealing at 58 deg.C for 30sec, extension at 72 deg.C for 1min, circulation for 30 times, extension at 72 deg.C for 10min, and storage at 15 deg.C.

And (3) carrying out electrophoresis on the PCR product, wherein the electrophoresis result is shown in figure 1, purifying the PCR product with a single strip, carrying out double enzyme digestion, connecting the PCR product with a pWB980 vector (according to the steps of the kit instruction), transforming the Bacillus subtilis WB600, coating a plate containing antibiotics, and screening recombinant bacteria.

Constructing a mutant library, performing library construction by using a site-directed saturation mutation mode, and performing site-directed saturation mutation on the mutant library by using the sequence shown in SEQ ID NO: 2 as template, the primer sequences used are as follows:

KF: CGGGGTACCATGATGAGGAAAAAGAGTTT（SEQ ID NO：11）；

KR: CGCCCATCCTTATTGAGCGGCAGCTTCGA（SEQ ID NO：12）；

340F: CAGCAGCTTTGATCTTGNNKAAACATCCGAACCTTTCAGC（SEQ ID NO：13）

340R: CAAGATCAAAGCTGCTGCTC（SEQ ID NO：14）。

and (3) carrying out double enzyme digestion on the amplified PCR product by using Kpn I and BamH I, connecting the product to a pWB980 vector, transforming the Bacillus subtilis WB600, and screening positive clones by using a kanamycin-resistant LB plate.

Single colonies of the selected transformants were inoculated into a 96-well deep-well plate. Each plate was inoculated with 3 single colonies K0 expressing the original keratinase as controls. Each well was filled with 500uL of LB liquid medium containing kanamycin resistance, shake-cultured at 37 ℃ and 200rpm for 24 hours, and then the fermentation broth was centrifuged to take the supernatant, followed by detection of the enzymatic activity of keratinase. The results are shown in FIG. 2, and the mutant gene with the enzyme activity obviously higher than that of the control K0 under the low temperature condition (20 ℃ -40 ℃) is subjected to repeated verification and sequencing analysis.

Screening out mutants with improved enzymolysis activity under the low-temperature condition by taking original keratinase as a starting template:

the KS01 mutation mode is S340V, and the amino acid sequence is shown as SEQ ID No: 3, the gene sequence is shown as SEQ ID No: 4 is shown in the specification;

the KS02 mutation mode is S340E, and the amino acid sequence is shown as SEQ ID No: 5, the gene sequence is shown as SEQ ID No: 6 is shown in the specification;

the KS03 mutation mode is S340L, and the amino acid sequence is shown as SEQ ID No: 7, the gene sequence is shown as SEQ ID No: 8 is shown in the specification;

the KS04 mutation mode is S340F, and the amino acid sequence is shown as SEQ ID No: 9, the gene sequence is shown as SEQ ID No: shown at 10.

Example 2: shaking flask fermentation expression verification of keratinase mutant recombinant bacteria with improved enzymolysis activity under low temperature condition

Respectively inoculating the recombinant bacteria containing the mutants into a fermentation medium, performing shake flask fermentation for 78h, centrifuging the culture solution to obtain supernatants, measuring the average enzyme activity of the supernatants of each mutant fermentation broth at 40 ℃, and measuring the optimum temperature of the mutants.

The results are shown in figure 3, and the enzyme activity of the keratinase KS01, KS02, KS03 and KS04 obtained after mutation is equivalent to the enzyme activity level of the original keratinase K0 at the temperature of 40 ℃; the optimal reaction temperature of the mutants KS01, KS02, KS03 and KS04 is respectively reduced to 38 ℃, 45 ℃, 46 ℃ and 50 ℃ from 55 ℃, and the residual enzyme activity of the mutant KS01 is more than 65% under the reaction condition of 25 ℃ to 35 ℃.

Example 3: fermentation and preparation of keratinase mutants in a 15L fermenter

The genetically engineered bacteria expressing the keratinase mutant KS02 are streaked on LB plates containing kanamycin resistance (the final concentration is 20 mug/mL), and are cultured at 37 ℃ until single colonies grow out, and the single colonies with good growth vigor are selected for fermentation. The fermentation production process comprises the following steps:

(1) recombining, inoculating into an LB liquid culture medium, culturing at 37 ℃ and 200rpm overnight with shaking;

(2) inoculating the seed liquid cultured overnight into a 15L fermentation tank, wherein the liquid filling amount is 8L;

(3) controlling conditions: at 37 ℃ and 600 rpm; 20% -60% of dissolved oxygen; the pot pressure is 0.05 Mpa; the ventilation capacity is 0-8h 0.6 m ³ H; 8 hours till the tank is stopped for 0.8-0.9 m ³ /h。

(4) Fermenting until the generation rate of microscopic spores is more than 90%.

(5) Stopping the tank, and centrifuging the fermentation liquor at 5000 rpm for 5 min to obtain supernatant enzyme solution.

(6) The pH value is natural in the fermentation process, the enzyme activity is measured after fermentation is carried out for 24 hours, after the fermentation is finished (generally 48 hours), the fermentation liquor is processed by a plate-and-frame filter to obtain crude enzyme liquid, and the crude enzyme liquid is sprayed and dried by a spray tower to form an enzyme preparation for application test.

The fermentation process curve is shown in figure 4: sampling every 4h, measuring enzyme production level, and fermenting for 48h until the antibacterial activity reaches the highest point.

Example 4: feather meal degradation experiment by keratinase mutant

Collecting white feathers, cutting the feathers into pieces, taking 0.02g of the feathers into pieces, and adding 20mL of buffer solution (pH 8.00.02M Tris-HCl buffer solution) to prepare suspension;

experimental groups: centrifuging fermentation liquor of keratinase mutant KS02 genetic engineering bacteria to obtain fermentation liquor supernatant, and adding the fermentation liquor supernatant into the feather suspension;

control group: no enzyme is added, and the treatment process is consistent with that of the test group;

reaction conditions are as follows: after the enzyme solution and the substrate are mixed evenly, the enzymolysis reaction is carried out for 2 hours at 37 ℃ and 120rpm/min on a water bath shaker.

After the reaction, the results are shown in fig. 5, and compared with the control group, the feathers of the left experimental group are significantly degraded and are milky white, and the feathers of the right control group are not degraded and are transparent and suspended. The experiment shows that the keratinase mutant keeps the original high-efficiency keratin degradation property, and meanwhile, the optimal reaction temperature is reduced, so that the keratinase mutant has good application potential in the fields of washing, tanning and the like requiring lower-temperature enzymolysis reaction.

Example 5: experiment for in vitro enzymolysis of bean pulp antigen protein by keratinase

The soybean meal is the most common feed raw material, is an important protein nutrition source for livestock and poultry, and accounts for more than 70% of the protein feed raw material in China for many years. The keratinase can effectively eliminate the effect of trypsin inhibitor, degrade plant keratin and antigen protein (allergen), improve the utilization efficiency of protein raw materials, obviously reduce the nitrogen discharge amount in excrement and urine, prevent food-borne diarrhea and promote growth. 32 kinds of soybean antigenic proteins are identified, wherein glycinin and beta-conglycinin are the most immunogenic soybean antigenic proteins, account for 65-80% of the total protein of soybean seeds, and are the main antigenic proteins in soybeans.

In this example, the soybean meal was ground into fine powder, and then prepared into a suspension of 0.1g/mL soybean meal using a phosphate buffer (pH 7.5-9.0). The keratinase mutant fermentation enzyme liquid is sterilized by a sterile filter membrane with the filtration of 0.22 mu m, and then diluted to 200U/mL for standby. 5mL of the suspension is taken as a control group, and 1mL of sterile water is added; experimental group 5mL of the above suspension was added to 1mL of an enzyme solution containing 200U/mL of keratinase. The test group and the control group are put into a water bath shaking table with the temperature of 40 ℃ and the rotation of 100, and are subjected to enzymolysis digestion, and enzymolysis samples are respectively removed for 2h, 4h, 8h and 16 h. And analyzing the enzymolysis digestion condition and the antigen protein removal condition by SDS-PAGE.

As can be seen from figure 6, after 8 hours of enzymolysis, the keratinase mutant can remove most of antigen protein, obviously reduce the allergen, and meanwhile, the indigestible macromolecular protein is enzymolyzed into small peptide, thus playing a good role in promoting growth of animals such as livestock and poultry.

Example 6: preparation of feed additive and animal breeding test

The keratinase preparation prepared in example 4 was uniformly mixed with bile acid at a mass volume ratio of 1:1 to prepare a complex preparation. The active ingredients of the bile acid comprise hyocholic acid, hyodeoxycholic acid and chenodeoxycholic acid, wherein the weight percentage of the sum of the hyocholic acid and the hyodeoxycholic acid is 78.0%, the weight percentage of the chenodeoxycholic acid is 20.0%, and the balance of water and ash (the total weight percentage is calculated by 100%).

Selecting weaned piglets in a certain farm, wherein the weight of the weaned piglets is 11.3 +/-1.84 kg/head, selecting 30 piglets in a control group, performing 3 repetitions, and selecting 10 piglets in each repetition; the experimental group had 30 replicates, with 10 replicates each. The control group and the test group are fed with low-protein daily ration, the content of crude protein is 20 percent, but the test group is added with 200 g/t of compound preparation in the feed at the same time; the animals are fed respectively for 30 days. And (4) periodically counting the feed intake of the weaned piglets, weighing, and calculating the feed-weight ratio and the diarrhea index.

The results are shown in table 1, the daily gain of the test group is slightly more than that of the control group, the feed-weight ratio is basically not different, and the diarrhea index of the test group is obviously reduced from the diarrhea index, which shows that the feed additive of the invention can reduce the crude protein in the feed of the piglets to a certain extent, promote the utilization rate of the protein, and simultaneously play a significant role in preventing diarrhea and protecting the intestines and stomach of the piglets.

TABLE 1 animal Breeding test data

	Daily gain/g	Material to weight ratio	Index of diarrhea
				Control group	418±4.86	1.34±0.15	2.37±0.21
Test group	426±1.74	1.33±0.059	1.42±1.12

The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Sequence listing

<110> Shandong Longchang animal health products Co Ltd

<120> feed additive containing keratinase mutant and bile acid and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met

1 5 10 15

Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro

20 25 30

Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val

35 40 45

Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys

50 55 60

Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp

65 70 75 80

Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val

85 90 95

Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly

100 105 110

Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly

115 120 125

Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His

130 135 140

Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala

145 150 155 160

Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val

165 170 175

Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val

180 185 190

Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr

195 200 205

Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp

210 215 220

Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys

225 230 235 240

Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala

245 250 255

Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro

260 265 270

Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser

275 280 285

Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala

290 295 300

Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr

305 310 315 320

Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala

325 330 335

Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn

340 345 350

Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly

355 360 365

Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln

370 375

<210> 2

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60

atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120

attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240

aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300

gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360

gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420

caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480

tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540

aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600

aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660

aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720

caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780

ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840

gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900

gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgtca 1020

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080

ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140

<210> 3

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met

1 5 10 15

Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro

20 25 30

Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val

35 40 45

Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys

50 55 60

Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp

65 70 75 80

Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val

85 90 95

Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly

100 105 110

Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly

115 120 125

Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His

130 135 140

Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala

145 150 155 160

Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val

165 170 175

Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val

180 185 190

Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr

195 200 205

Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp

210 215 220

Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys

225 230 235 240

Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala

245 250 255

Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro

260 265 270

Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser

275 280 285

Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala

290 295 300

Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr

305 310 315 320

Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala

325 330 335

Leu Ile Leu Val Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn

340 345 350

Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly

355 360 365

Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln

370 375

<210> 4

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60

atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120

attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240

aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300

gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360

gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420

caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480

tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540

aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600

aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660

aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720

caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780

ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840

gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900

gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttggta 1020

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080

ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140

<210> 5

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met

1 5 10 15

Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro

20 25 30

Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val

35 40 45

Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys

50 55 60

Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp

65 70 75 80

Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val

85 90 95

Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly

100 105 110

Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly

115 120 125

Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His

130 135 140

Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala

145 150 155 160

Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val

165 170 175

Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val

180 185 190

Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr

195 200 205

Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp

210 215 220

Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys

225 230 235 240

Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala

245 250 255

Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro

260 265 270

Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser

275 280 285

Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala

290 295 300

Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr

305 310 315 320

Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala

325 330 335

Leu Ile Leu Glu Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn

340 345 350

Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly

355 360 365

Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln

370 375

<210> 6

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60

atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120

attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240

aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300

gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360

gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420

caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480

tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540

aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600

aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660

aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720

caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780

ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840

gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900

gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttggaa 1020

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080

ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140

<210> 7

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met

1 5 10 15

Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro

20 25 30

Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val

35 40 45

Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys

50 55 60

Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp

65 70 75 80

Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val

85 90 95

Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly

100 105 110

Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly

115 120 125

Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His

130 135 140

Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala

145 150 155 160

Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val

165 170 175

Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val

180 185 190

Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr

195 200 205

Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp

210 215 220

Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys

225 230 235 240

Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala

245 250 255

Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro

260 265 270

Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser

275 280 285

Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala

290 295 300

Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr

305 310 315 320

Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala

325 330 335

Leu Ile Leu Leu Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn

340 345 350

Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly

355 360 365

Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln

370 375

<210> 8

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60

atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120

attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240

aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300

gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360

gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420

caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480

tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540

aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600

aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660

aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720

caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780

ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840

gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900

gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgtta 1020

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080

ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140

<210> 9

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met

1 5 10 15

Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro

20 25 30

Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val

35 40 45

Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys

50 55 60

Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp

65 70 75 80

Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val

85 90 95

Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly

100 105 110

Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly

115 120 125

Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His

130 135 140

Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala

145 150 155 160

Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val

165 170 175

Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val

180 185 190

Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr

195 200 205

Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp

210 215 220

Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys

225 230 235 240

Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala

245 250 255

Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro

260 265 270

Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser

275 280 285

Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala

290 295 300

Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr

305 310 315 320

Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala

325 330 335

Leu Ile Leu Phe Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn

340 345 350

Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly

355 360 365

Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln

370 375

<210> 10

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60

atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120

attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240

aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300

gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360

gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420

caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480

tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540

aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600

aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660

aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720

caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780

ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840

gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900

gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgttc 1020

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080

ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cggggtacca tgatgaggaa aaagagttt 29

<210> 12

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgcccatcct tattgagcgg cagcttcga 29

<210> 13

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cagcagcttt gatcttgnnk aaacatccga acctttcagc 40

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

caagatcaaa gctgctgctc 20

Claims

1. A keratinase mutant, wherein the amino acid sequence of the keratinase mutant has an amino acid sequence set forth in one of:

(1) as shown in SEQ ID NO: 3;

(2) as shown in SEQ ID NO: 5;

(3) as shown in SEQ ID NO: 7;

(4) as shown in SEQ ID NO: 9, or a pharmaceutically acceptable salt thereof.

2. The keratinase mutant according to claim 1, which is characterized in that the keratinase mutant is a mutant consisting of a polypeptide having an amino acid sequence of SEQ ID NO: 1 to valine to the serine at position 340 of keratinase, and a keratinase mutant KS 01; consisting of a polypeptide with the amino acid sequence of SEQ ID NO: 1 from serine at position 340 to glutamic acid of keratinase to obtain keratinase mutant KS 02; consisting of an amino acid sequence of SEQ ID NO: 1 from serine at position 340 to leucine of keratinase to obtain keratinase mutant KS 03; consisting of a polypeptide with the amino acid sequence of SEQ ID NO: 1 to the amino acid residue of serine at position 340 of keratinase to phenylalanine to obtain keratinase mutant KS 04.

3. The keratinase mutant coding gene of claim 1, wherein the coding gene has a nucleotide sequence selected from the group consisting of:

(1) as shown in SEQ ID NO: 4;

(2) as shown in SEQ ID NO: 6;

(3) as shown in SEQ ID NO: 8;

(4) as shown in SEQ ID NO: 10, or a nucleotide sequence shown in the figure.

4. A recombinant expression vector comprising a gene encoding the keratinase mutant according to claim 3.

5. A recombinant engineered bacterium comprising a gene encoding the keratinase mutant according to claim 3.

6. A feed additive, which comprises a keratinase mutant and bile acid.

7. The feed additive according to claim 6, wherein the feed additive is prepared by mixing an enzyme preparation prepared by fermenting, filtering and drying recombinant engineering bacteria containing keratinase mutants and bile acid in a mass-to-volume ratio of 1: 1-5.

8. Use of the keratinase mutant of claim 1 or the feed additive of claim 6 for the preparation of a feed for promoting growth and reducing diarrhea in an animal.

9. The use according to claim 8, wherein the amount of the keratinase mutant or the feed additive is 100 g/t to 500 g/t of the animal feed.