CN115820613A - Keratinase preparation containing folium Eucommiae extract and its application in preparing poultry breeding feed - Google Patents

Keratinase preparation containing folium Eucommiae extract and its application in preparing poultry breeding feed Download PDF

Info

Publication number
CN115820613A
CN115820613A CN202210783352.3A CN202210783352A CN115820613A CN 115820613 A CN115820613 A CN 115820613A CN 202210783352 A CN202210783352 A CN 202210783352A CN 115820613 A CN115820613 A CN 115820613A
Authority
CN
China
Prior art keywords
keratinase
seq
preparation
amino acid
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210783352.3A
Other languages
Chinese (zh)
Inventor
曹爱智
娄倩倩
张西雷
徐志敏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Longchang Animal Health Product Co ltd
Original Assignee
Shandong Longchang Animal Health Product Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Longchang Animal Health Product Co ltd filed Critical Shandong Longchang Animal Health Product Co ltd
Priority to CN202210783352.3A priority Critical patent/CN115820613A/en
Publication of CN115820613A publication Critical patent/CN115820613A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
    • Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
    • Y02P60/87—Re-use of by-products of food processing for fodder production

Landscapes

  • Enzymes And Modification Thereof (AREA)

Abstract

The invention provides a keratinase preparation containing an eucommia ulmoides leaf extract and application thereof in preparing poultry breeding feed. The invention uses error-prone PCR method pairsBacillus licheniformisCorner of originProtease genes are mutated, keratinase mutants K5, K6, K7 and K8 are obtained through screening, and compared with the original keratinase, the enzyme activities are respectively improved by 30%,38.5%,45% and 55%. The keratinase mutant and the eucommia ulmoides leaf extract are mixed according to a scientific proportion to prepare a new preparation for breeding meat ducks, the utilization rate of protein in basic ration can be promoted, growth of the meat ducks is obviously promoted, the feed-weight ratio is obviously low, breeding cost is saved, and therefore the enzyme and the enzyme preparation have good market application prospects.

Description

Keratinase preparation containing folium Eucommiae extract and its application in preparing poultry breeding feed
Technical Field
The invention belongs to the field of enzyme engineering, and particularly relates to a keratinase preparation containing eucommia ulmoides leaf extract and application of the keratinase preparation in preparation of poultry breeding feed.
Background
Keratinase is a specific keratinase which degrades keratin substrates (e.g., cutin, dandruff, feather, etc.) and is produced by various microorganisms such as fungi, actinomycetes and bacteria when growing on keratin as a single carbon source. The keratin contains more than 80 percent of crude protein, the total amount of various amino acids is more than 70 percent, the variety of the essential amino acids of animals is complete, and simultaneously, the keratin contains more macroelements, microelements and unknown growth factors, is a good feed protein source capable of replacing or partially replacing fish meal and a fertilizer source, and has important application prospect for the development and utilization of the keratin.
At present, more researches on keratinase in China are still in the stages of screening and separating strains, separating and purifying keratinase and enzymological properties. However, there are still few potential strains capable of effectively expressing high-activity keratinase, and the problems of low enzyme production level and high production cost are common, which is also a major obstacle to industrial production and application of keratinase. Therefore, researchers are receiving more and more attention to further improving the properties of keratin by adopting a protein molecular modification strategy.
The error-prone PCR technology is that DNA polymerase is adopted to carry out PCR reaction to amplify target fragments, and simultaneously, the reaction conditions are adjusted to increase the gene mutation frequency, so that mutation is randomly introduced into target genes at a certain frequency to construct a mutant library, and then the required forward mutant is screened in a high-throughput manner. Error-prone PCR technology is an important approach in protein molecular engineering.
Disclosure of Invention
The invention provides a keratinase preparation containing an eucommia ulmoides leaf extract and application thereof in preparing poultry breeding feed. The invention passes throughBacillus licheniformisThe keratin enzyme gene is improved, a plurality of mutants with improved enzyme activity are obtained by screening, and the mutants are mixed with the eucommia ulmoides leaf extract to prepare a preparation for breeding poultry, so that the preparation has a good effect.
In order to achieve the purpose of the invention, the invention is realized by adopting the following technical scheme:
the invention provides a keratinase, which has an amino acid sequence shown as SEQ ID NO:3, and the amino acid sequence of the keratinase K5 is shown as SEQ ID NO:5, and the amino acid sequence of the keratinase K6 is shown as SEQ ID NO:7, or a keratinase K7 with an amino acid sequence shown in SEQ ID NO:9, keratinase K8.
Further, the keratinase K5 is a polypeptide consisting of an amino acid sequence of SEQ ID NO:1 from valine to alanine at position 156 of keratinase; the keratinase K6 is a polypeptide consisting of an amino acid sequence SEQ ID NO:1 from valine to alanine at position 156 and asparagine to serine at position 148 of keratinase; the keratinase K7 is a polypeptide consisting of an amino acid sequence SEQ ID NO:1 from valine to alanine at position 156 and isoleucine to methionine at position 215 of keratinase; the keratinase K8 is a polypeptide consisting of an amino acid sequence SEQ ID NO:1 from the keratinase in which valine at position 156 is changed to alanine and threonine at position 317 is changed to glutamic acid.
The invention also provides a coding gene which codes the keratinase.
Further, the nucleotide sequence of the encoding gene of the keratinase K5 is shown as SEQ ID NO:4 is shown in the specification; the nucleotide sequence of the encoding gene of the keratinase K6 is shown as SEQ ID NO:6 is shown in the specification; the nucleotide sequence of the encoding gene of the keratinase K7 is shown as SEQ ID NO:8 is shown in the specification; or the nucleotide sequence of the encoding gene of the keratinase K8 is shown as SEQ ID NO: shown at 10.
The invention also provides recombinant engineering bacteria containing the coding gene, which are characterized in that the recombinant engineering bacteria are bacillus subtilis, bacillus amyloliquefaciens, bacillus pumilus or bacillus licheniformis.
The invention also provides a keratinase preparation containing the eucommia ulmoides leaf extract, which is prepared by mixing the keratinase liquid of claim 1 and the eucommia ulmoides leaf extract together.
Further, the volume ratio of the keratinase liquid to the eucommia ulmoides leaf extract in the keratinase preparation is 1 to 3, wherein the enzyme activity of the keratinase is 3.0 x 10 3 U~ 4.0×10 3 U。
Further, the preparation method of the keratinase enzyme solution comprises the following steps: the recombinant engineering bacteria containing keratinase coding genes are placed on a flat plate containing antibiotics, and cultured until single colonies grow out, the single colonies with good growth vigor are selected and inoculated in a liquid culture medium for fermentation, the obtained seed liquid is inoculated in a fermentation tank for continuous fermentation, the obtained fermentation liquid is treated by a plate-and-frame filter to obtain crude enzyme liquid, and the crude enzyme liquid is purified, sprayed by a spray tower to be dry, and then is prepared into the keratinase liquid by using sterile water.
The invention also provides application of the keratinase or the keratinase preparation in preparing poultry breeding feed.
Furthermore, the dosage of the keratinase or the keratinase preparation is 300 g/t-600 g/t of common feed.
Compared with the prior art, the invention has the advantages and the technical effects that:
the invention is provided withBacillus licheniformisBased on the derived keratinase gene, a mutant library is constructed through random mutation and a high-throughput directional screening method, and single-site mutants K5 containing V156A, double-site mutants K6, K7 and K8 containing V156A/N148S, V156A/I215M and V156A/T317E are respectively provided; the enzyme activity of the mutant is respectively improved by 30%,38.5%,45% and 55% compared with the original keratinase, and the enzyme activity is obviously improved. The keratinase mutant and the eucommia ulmoides leaf extract are mixed according to a scientific proportion to prepare a new preparation for breeding meat ducks, and the new preparation not only can be used for breeding meat ducksThe utilization rate of protein in basic ration can be promoted, the growth of meat ducks is obviously promoted, the feed-weight ratio is obviously low, and the breeding cost is saved, so that the enzyme and the enzyme preparation have good market application prospects.
Drawings
FIG. 1 is a graph showing the results of amplification electrophoresis of a keratinase gene.
FIG. 2 is the analysis of the enzyme production level of the recombinant strain of keratinase mutant by shake flask fermentation.
FIG. 3 is the fermentation data of keratinase mutant K8 in a 15L fermentor.
Detailed Description
In order to facilitate understanding of the invention, the invention will be described in more detail below with reference to the accompanying drawings and examples, but the scope of the invention is not limited to the following specific examples.
The molecular biological experiments, which are not specifically described in the following examples, can be performed by referring to the specific methods listed in molecular cloning, a laboratory manual (third edition) J. SammBruker, or according to the kit and product instructions. Reagents and biomaterials used in specific examples are commercially available without specific reference.
In the invention, the LB culture medium formula is as follows: 1% tryptone, 0.5% yeast extract, 1% NaCl. The formula of the fermentation medium is as follows: 3.5-10% of soybean meal, 5-10% of cottonseed meal, 2-6% of corn flour, 0.5-1.0% of PPG-20000, 0.5-1.0% of protease, 0.5-1.0% of amylase and 0.2-0.5% of disodium hydrogen phosphate in terms of mass ratio.
In the invention, the enzyme activity is determined by a method for determining the protease in GBT 23527-2009 protease preparation.
Example 1: construction of recombinant strain of keratinase gene and construction of mutant library thereof
Reference toBacillus licheniformisThe amino acid sequence (SEQ ID NO: 1) and DNA sequence (SEQ ID NO: 2) of the keratinase from the source were designed as primers, and a Kpn I restriction site was designed at the 5 'end and a BamH I restriction site was designed at the 3' end. Performing PCR to amplify the target band: the primers used were as follows,
KF: CGGGGTACCATGATGAGGAAAAAGAGTTT（SEQ ID NO：11）；
KR: CGCCCATCCTTATTGAGCGGCAGCTTCGA（SEQ ID NO：12）。
the reaction system is as follows:
PCR upstream primer (25 pmol/. Mu.L) 1µL
PCR downstream primer (25 pmol/. Mu.L) 1µL
dNTP mixture 4µL
PCR Buffer 5µL
Template DNA 1µL
DNA polymerase 0.5µL
Adding double distilled water to the total volume 50µL
The reaction conditions are as follows: pre-denaturation at 95 deg.C for 3min, denaturation at 94 deg.C for 10sec, annealing at 58 deg.C for 30sec, extension at 72 deg.C for 1min, circulating for 30 times, extension at 72 deg.C for 10min, and storing at 15 deg.C.
And (3) carrying out electrophoresis on the PCR product, wherein the electrophoresis result is shown in figure 1, purifying the PCR product with a single strip, carrying out double enzyme digestion, connecting the PCR product with a pWB980 vector (according to the steps of the kit instruction), transforming the Bacillus subtilis WB600, coating a plate containing antibiotics, and screening recombinant bacteria.
Mutant library construction, using GeneMorph II random mutation PCR kit, with SEQ ID NO:2 as template, and carrying out random mutation by using the following primer sequences:
KF: CGGGGTACCATGATGAGGAAAAAGAGTTT（SEQ ID NO：11）；
KR: CGCCCATCCTTATTGAGCGGCAGCTTCGA（SEQ ID NO：12）。
and (3) carrying out double enzyme digestion on the amplified random mutation PCR product by using Kpn I and BamH I, connecting the product to a pWB980 vector, transforming the Bacillus subtilis WB600, and screening positive clones by using a kanamycin-resistant LB plate.
Single colonies of the selected transformants were inoculated into a 96-well deep-well plate. Each plate was inoculated with 3 single colonies expressing the original keratinase as controls. Each well was filled with 500uL of LB liquid medium containing kanamycin resistance, shake-cultured at 37 ℃ and 200rpm for 24 hours, and then the fermentation broth was centrifuged to take the supernatant, followed by detection of the enzymatic activity of keratinase. And (3) carrying out repeated verification and sequencing analysis on the mutant gene with the enzyme activity obviously higher than that of the control K0.
Screening mutant V156A with improved enzyme activity by taking original keratinase as an initial template, and naming the mutant as K5, wherein the amino acid sequence of the mutant is shown as SEQ ID NO:3, and the coded nucleotide sequence is shown as SEQ ID NO:4, respectively.
Example 2: error-prone PCR (polymerase chain reaction) method for constructing mutant library of keratinase K5
Performing a second round of random mutation by using the keratinase gene K5 screened in the example 1 as a template, wherein the construction process, the material reagent and the operation conditions of the mutation library are the same as those in the example 1; and (3) when the mutant is cultured and screened, K5 is used as a reference, the enzyme activity of the keratinase mutant is detected, and the mutant gene with the enzyme activity higher than K5 is sequenced.
Finally, the following mutants with improved enzyme activity are screened:
the K6 mutation mode is V156A/N148S, and the amino acid sequence is shown as SEQ ID No:5, the nucleotide sequence is shown as SEQ ID No:6 is shown in the specification;
the K7 mutation mode is V156A/I215M, and the amino acid sequence is shown as SEQ ID No:7, and the nucleotide sequence is shown as SEQ ID No:8 is shown in the specification;
the K8 mutation mode is V156A/T317E, and the amino acid sequence is shown as SEQ ID No:9, and the nucleotide sequence is shown as SEQ ID No: shown at 10.
Example 3: shaking flask fermentation expression verification of keratinase mutant recombinant bacteria with improved enzyme activity
Respectively inoculating the recombinant bacteria containing the keratinase mutants K5-K8 of the examples 1 and 2 into a fermentation medium, carrying out shake flask fermentation for 78h, centrifuging the culture solution to obtain a supernatant, and measuring the average enzyme activity of the supernatant of each mutant fermentation solution.
The results are shown in figure 2, the enzyme activities of the keratinase K5, K6, K7 and K8 obtained after mutation are respectively improved by 30 percent, 38.5 percent, 45 percent and 55 percent compared with the original keratinase K0; the enzyme activity of the keratinase mutant K8 is improved most obviously.
Example 4: fermentation and preparation of keratinase mutants in a 15L fermenter
The genetically engineered bacteria expressing the keratinase mutants K5, K6, K7 and K8 are respectively streaked on LB plates containing kanamycin resistance (the final concentration is 20 mu g/mL), cultured at 37 ℃ until single colonies grow out, and the single colonies with good growth are selected for fermentation. The fermentation production process comprises the following steps:
(1) Inoculating the recombinant bacteria containing the mutant to an LB liquid culture medium, performing shake culture at 37 ℃ and 200rpm overnight;
(2) Inoculating the seed liquid cultured overnight into a 15L fermentation tank, wherein the liquid filling amount is 8L;
(3) Controlling conditions: 300-600rpm at 37 ℃; 20% -60% of dissolved oxygen; the pot pressure is 0.05Mpa; the ventilation volume is 0-8h 0.6 m 3 H; 8 hours till the tank is stopped for 0.8-0.9 m 3 /h。
(4) Fermenting until the generation rate of microscopic spores is more than 90%.
(5) Stopping the tank, and centrifuging the fermentation liquor at 5000 rpm for 5 min to obtain supernatant enzyme solution.
(6) The pH value is natural in the fermentation process, the enzyme activity is measured after 16 hours of fermentation, the activity is measured by sampling every 4 hours, after the fermentation is finished, the fermentation liquor is processed by a plate-and-frame filter to obtain crude enzyme liquid, and then the crude enzyme liquid is sprayed and dried by a spray tower to form enzyme powder for application test.
The fermentation process curve for the keratinase mutant K8 is shown in FIG. 3: with the prolonging of the fermentation time, the enzyme activity reaches the highest point after 52 hours of fermentation.
Example 5: animal breeding test
Enzyme powder of the keratinase mutant K8 prepared in the example 4 is prepared into enzyme solution by using sterile water, and the enzyme solution is uniformly mixed with eucommia ulmoides leaf extract (the main components are chlorogenic acid more than or equal to 5%, eucommia ulmoides polysaccharide more than or equal to 20% and eucommia ulmoides flavone more than or equal to 8%) according to the volume ratio of 2. Wherein the enzyme activity of keratinase in keratinase enzyme solution is 3.0 × 10 3 U~ 4.0×10 3 U。
Selecting meat duck, selecting 9000 feathers of the experimental group and the control group respectively, repeating for 3 times, and selecting 3000 feathers of each repetition. The control group is daily ration added with cottonseed meal, peanut meal, rapeseed meal, sorghum and barley; the test group is prepared by adding 400g/t of eucommia ulmoides leaf enzyme preparation on the basis of the daily ration of a control group; the meat ducks are fed respectively, and the test period is 30 days. And (5) counting the material weight ratio and the output weight.
The results are shown in table 1, the slaughter weight and the feed weight ratio of the test group are higher than those of the control group, and the addition of the eucommia ulmoides leaf enzyme preparation can promote the utilization of protein in daily ration, further improve the feed utilization rate, reduce the feed weight ratio to a certain extent, improve the slaughter weight of meat ducks, promote the growth of the meat ducks and save the breeding cost.
TABLE 1 weight of meat duck and material/weight ratio index
Weight g for slaughtering Material to weight ratio
Control group 2968±7.50 2.24±0.05
Test group 3037±9.85 2.17±0.30
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Claims (10)

1. A keratinase, wherein the keratinase has an amino acid sequence as set forth in SEQ ID NO:3, and the amino acid sequence of the keratinase K5 is shown as SEQ ID NO:5, and the amino acid sequence of the keratinase K6 is shown as SEQ ID NO:7 or a keratinase K7 having an amino acid sequence as set forth in SEQ ID NO:9, keratinase K8.
2. The keratinase of claim 1, wherein keratinase K5 is a polypeptide consisting of the amino acid sequence of SEQ ID NO:1 from valine to alanine at position 156 of keratinase; the keratinase K6 is a polypeptide consisting of an amino acid sequence SEQ ID NO:1 from valine to alanine at position 156 and from asparagine to serine at position 148 of the keratinase; the keratinase K7 is a polypeptide consisting of an amino acid sequence SEQ ID NO:1 from valine to alanine at position 156 and isoleucine to methionine at position 215 of keratinase; the keratinase K8 is a polypeptide consisting of an amino acid sequence SEQ ID NO:1 from the keratinase in which valine at position 156 is changed to alanine and threonine at position 317 is changed to glutamic acid.
3. A coding gene encoding the keratinase of claim 1.
4. The encoding gene of claim 3, wherein the nucleotide sequence of the encoding gene of keratinase K5 is shown in SEQ ID NO:4 is shown in the specification; the nucleotide sequence of the encoding gene of the keratinase K6 is shown as SEQ ID NO:6 is shown in the specification; the nucleotide sequence of the encoding gene of the keratinase K7 is shown as SEQ ID NO:8 is shown in the specification; or the nucleotide sequence of the encoding gene of the keratinase K8 is shown as SEQ ID NO: shown at 10.
5. The recombinant engineering bacteria containing the coding gene of claim 3, wherein the recombinant engineering bacteria is Bacillus subtilis, bacillus amyloliquefaciens, bacillus pumilus or Bacillus licheniformis.
6. A keratinase preparation containing an extract of eucommia ulmoides leaf, characterized in that the keratinase preparation is prepared by mixing together the keratinase enzyme solution of claim 1 and an extract of eucommia ulmoides leaf.
7. The bile acid enzyme preparation as claimed in claim 6, wherein the volume ratio of the keratinase enzyme solution to the eucommia ulmoides leaf extract in the keratinase preparation is 1 to 3, wherein the activity of the keratinase is 3.0 x 10 3 U~ 4.0×10 3 U。
8. The bile acid enzyme preparation of claim 7, wherein the keratinase enzyme solution is prepared by a method comprising: the recombinant engineering bacteria containing keratinase coding genes are placed on a flat plate containing antibiotics, and cultured until single colonies grow out, the single colonies with good growth vigor are selected and inoculated in a liquid culture medium for fermentation, the obtained seed liquid is inoculated in a fermentation tank for continuous fermentation, the obtained fermentation liquid is treated by a plate-and-frame filter to obtain crude enzyme liquid, and the crude enzyme liquid is purified, sprayed by a spray tower to be dry, and then is prepared into the keratinase liquid by using sterile water.
9. Use of the keratinase of claim 1 or the keratinase preparation of claim 6 for the preparation of a feed for poultry farming.
10. The use according to claim 9, wherein the amount of the keratinase or keratinase preparation is 300-600 g/t of a common feed.
CN202210783352.3A 2022-07-05 2022-07-05 Keratinase preparation containing folium Eucommiae extract and its application in preparing poultry breeding feed Pending CN115820613A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210783352.3A CN115820613A (en) 2022-07-05 2022-07-05 Keratinase preparation containing folium Eucommiae extract and its application in preparing poultry breeding feed

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210783352.3A CN115820613A (en) 2022-07-05 2022-07-05 Keratinase preparation containing folium Eucommiae extract and its application in preparing poultry breeding feed

Publications (1)

Publication Number Publication Date
CN115820613A true CN115820613A (en) 2023-03-21

Family

ID=85522770

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210783352.3A Pending CN115820613A (en) 2022-07-05 2022-07-05 Keratinase preparation containing folium Eucommiae extract and its application in preparing poultry breeding feed

Country Status (1)

Country Link
CN (1) CN115820613A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BE1016629A3 (en) * 2005-06-06 2007-03-06 Sfinc Nv METHOD AND DEVICE FOR PROCESSING animal offal.
CN105992817A (en) * 2014-02-07 2016-10-05 帝斯曼知识产权资产管理有限公司 Improved bacillus host
US20200385745A1 (en) * 2017-11-01 2020-12-10 Jiangnan University An improved industrial keratinase via genetic engineering and use thereof
CN113528556A (en) * 2020-04-16 2021-10-22 四川大学 Heterologous expression of keratinase and application thereof in sheep skin depilation
CN114574469A (en) * 2022-03-21 2022-06-03 江南大学 Keratinase mutant based on directed evolution transformation and application thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BE1016629A3 (en) * 2005-06-06 2007-03-06 Sfinc Nv METHOD AND DEVICE FOR PROCESSING animal offal.
CN105992817A (en) * 2014-02-07 2016-10-05 帝斯曼知识产权资产管理有限公司 Improved bacillus host
US20200385745A1 (en) * 2017-11-01 2020-12-10 Jiangnan University An improved industrial keratinase via genetic engineering and use thereof
CN113528556A (en) * 2020-04-16 2021-10-22 四川大学 Heterologous expression of keratinase and application thereof in sheep skin depilation
CN114574469A (en) * 2022-03-21 2022-06-03 江南大学 Keratinase mutant based on directed evolution transformation and application thereof

Similar Documents

Publication Publication Date Title
CN102517304B (en) Optimized gene of recombinant glucose oxidase and expression vector and application of optimized gene
CN102517235B (en) Bacillus subtilis
WO2019227512A1 (en) Recombinant bacillus subtilis engineered bacteria capable of efficiently expressing keratinase
CN106520642B (en) Bacillus amyloliquefaciens and application thereof
CN109468259B (en) Culture medium for promoting spore generation
CN110591938A (en) High-stress-resistance bacillus coagulans mutant strain and application thereof
CN109321586A (en) Recombinant Aspergillus niger Glucose Oxidase optimization gene and its expression vector and application
UA113293C2 (en) APPLICATION OF THE ACTIVITY OF ENDOGENIC DNASHA TO REDUCE DNA CONTENT
CN108004220A (en) Improve alkali protease BmP mutant and its gene and the application of heat endurance
CN114107146A (en) Construction method and application of resistance-marker-free auxotrophic bacillus subtilis
CN114774396B (en) Keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additive
CN115029337A (en) Additive compounded by keratinase mutant and eucommia ulmoides leaf extract and application thereof
CN115074347A (en) Feed additive containing keratinase mutant and bile acid and application thereof
RU2687137C1 (en) Strain of heterotrophic bacteria klebsiella pneumonia is an associate for producing a microbial protein mass
CN115820613A (en) Keratinase preparation containing folium Eucommiae extract and its application in preparing poultry breeding feed
CN113875975B (en) Fermentation process for preparing metaplasia by using wheat processing byproducts
CN115820612A (en) Keratinase, bile acid enzyme preparation containing keratinase and application of bile acid enzyme preparation in preparation of feed for promoting growth of poultry
AU2014229409C1 (en) Extraction of nitrogen from organic materials through ammonification by mixed bacterial populations
CN110878293B (en) Application of bacillus licheniformis with deletion of yceD gene in production of heterologous protein
Nassar et al. Proteases production by a bacterial isolate Bacillus amyloliquefaciens 35s obtained from soil of the nile Delta of Egypt.
CN111378583B (en) Trichoderma reesei and application thereof
CN115927267B (en) Bile acid complex enzyme preparation and application thereof
CN115927264A (en) Keratinase, compound enzyme preparation of keratinase, eucommia ulmoides leaf extract and bile acid and application of compound enzyme preparation in preparation of animal breeding feed
CN105524849A (en) Construction and application of cephalosporin high-yield gene engineering strain independent from methionine
CN115927265A (en) Keratinase preparation containing folium Eucommiae extract and eucalyptus essential oil, and its application in preparing animal breeding feed

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information

Address after: No. 9 Yanying North Road, Yanbei Street Office, Qihe County, Dezhou City, Shandong Province, 253000

Applicant after: Shandong Longchang Animal Health Products Co.,Ltd.

Address before: 251100 No.1, North Park Road, Qihe Economic Development Zone, Dezhou City, Shandong Province

Applicant before: SHANDONG LONGCHANG ANIMAL HEALTH PRODUCT Co.,Ltd.

CB02 Change of applicant information