CN114107266A - Protease mutant with improved heat resistance, and coding gene and application thereof - Google Patents

Protease mutant with improved heat resistance, and coding gene and application thereof Download PDF

Info

Publication number
CN114107266A
CN114107266A CN202111432327.2A CN202111432327A CN114107266A CN 114107266 A CN114107266 A CN 114107266A CN 202111432327 A CN202111432327 A CN 202111432327A CN 114107266 A CN114107266 A CN 114107266A
Authority
CN
China
Prior art keywords
ala
val
gly
ser
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111432327.2A
Other languages
Chinese (zh)
Other versions
CN114107266B (en
Inventor
方安然
付五兵
肖志壮
孙建飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao Shangde Biotechnology Co ltd
Original Assignee
Qingdao Shangde Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao Shangde Biotechnology Co ltd filed Critical Qingdao Shangde Biotechnology Co ltd
Priority to CN202111432327.2A priority Critical patent/CN114107266B/en
Publication of CN114107266A publication Critical patent/CN114107266A/en
Application granted granted Critical
Publication of CN114107266B publication Critical patent/CN114107266B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/189—Enzymes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A23L29/06—Enzymes

Abstract

The invention provides a protease mutant with improved heat resistance, and a coding gene and application thereof. The invention constructs a mutant library by utilizing an error-prone PCR methodBacillus licheniformis Mutating protease gene derived from WX-02, and high-throughput screening to obtain protease mutants such as BLAPR5, BLAPR6, BLAPR7, BLAPR8 and BLAPR9. Compared with wild protease, the enzyme activities of the BLAPR10, the BLAPR11 and the BLAPR12 are respectively improved by 36.0%, 65.5%, 35.2%, 55.5%, 49.0%, 84.0%, 45.5% and 76.0%, so that the heat resistance is obviously improved, the use in various fields of feed, food and the like is facilitated, and the heat-resistant and heat-resistant modified protein has good market application prospect and industrial value.

Description

Protease mutant with improved heat resistance, and coding gene and application thereof
Technical Field
The invention belongs to the field of gene engineering and enzyme engineering, and particularly relates to a protease mutant with improved heat resistance, and a coding gene and application thereof.
Background
Proteases are a class of enzymes that catalyze the hydrolysis of peptide bonds in proteins, are widely found in animals, plants and microorganisms, and have many different physiological functions. Protease is widely used in various fields, such as food industry, brewing, detergent industry, feed industry, tanning industry, silk industry, and pharmaceutical industry, and therefore, higher demands are made on the yield and property improvement of protease in such environment.
At present, most of protease in the market only has less than 20% of enzyme activity after being treated at 70 ℃, and the overall temperature resistance is poor, so that the wide use of the protease is limited. For example, in the production of feed, the enzyme preparation is mixed with feed and then granulated at high temperature, during which the enzyme is easily inactivated. Therefore, it is important to improve the thermostability of the protease.
The error-prone PCR technology is that when DNA polymerase is used for PCR reaction amplification of a target fragment, mutation frequency in the amplification process is increased by adjusting reaction conditions, so that mutation is randomly introduced into a target gene at a certain frequency, a mutant library is constructed, and a required forward mutant is screened. The error-prone PCR technique can be well applied to molecular modification of proteins.
Disclosure of Invention
The invention provides a protease mutant with improved heat resistance, and a coding gene and application thereof. Constructing mutant library by error-prone PCR method and directional screeningBacillus licheniformis The protease gene from WX-02 is improved, and a plurality of mutants with improved heat resistance are obtained by screening, which is beneficial to improving the application of the mutant in the fields of feed, food and the like.
In order to achieve the purpose of the invention, the invention is realized by adopting the following technical scheme:
the invention provides a protease mutant BLAPR5 with improved heat resistance, wherein the amino acid sequence of the protease mutant BLAPR5 is shown as SEQ ID NO:3, the nucleotide sequence of the coding gene is shown as SEQ ID NO:4 is shown in the specification; the protease mutant BLAPR5 is obtained by changing threonine at position 183 of a protease with an amino acid sequence of SEQ ID NO. 1 into glutamic acid.
The invention also provides a protease mutant BLAPR6 with improved heat resistance, wherein the amino acid sequence of the protease mutant BLAPR6 is shown as SEQ ID NO:5, the nucleotide sequence of the coding gene is shown as SEQ ID NO:6 is shown in the specification; the protease mutant BLAPR6 is obtained by changing threonine at position 183 to glutamic acid and alanine at position 106 to aspartic acid of a protease having the amino acid sequence of SEQ ID NO. 1.
The invention also provides a protease mutant BLAPR7 with improved heat resistance, wherein the amino acid sequence of the protease mutant BLAPR7 is shown as SEQ ID NO:7, the nucleotide sequence of the coding gene is shown as SEQ ID NO:8 is shown in the specification; the protease mutant BLAPR7 is obtained by changing threonine at position 183 to glutamic acid and lysine at position 120 to proline of a protease having the amino acid sequence of SEQ ID NO. 1.
The invention also provides a protease mutant BLAPR8 with improved heat resistance, wherein the amino acid sequence of the protease mutant BLAPR8 is shown as SEQ ID NO:9, the nucleotide sequence of the coding gene is shown as SEQ ID NO:10 is shown in the figure; the protease mutant BLAPR8 is obtained by changing threonine at position 183 to glutamic acid and valine at position 176 to alanine of a protease having the amino acid sequence of SEQ ID NO. 1.
The invention also provides a protease mutant BLAPR9 with improved heat resistance, wherein the amino acid sequence of the protease mutant BLAPR9 is shown as SEQ ID NO:11, and the nucleotide sequence of the coding gene is shown as SEQ ID NO:12 is shown in the specification; the protease mutant BLAPR9 is obtained by changing threonine to glutamic acid at position 183 and tyrosine to methionine at position 208 of a protease having the amino acid sequence of SEQ ID NO. 1.
The invention also provides a protease mutant BLAPR10 with improved heat resistance, wherein the amino acid sequence of the protease mutant BLAPR10 is shown as SEQ ID NO:13, and the nucleotide sequence of the coding gene is shown as SEQ ID NO:14 is shown in the figure; the protease mutant BLAPR10 is obtained by changing threonine at position 183 to glutamic acid and asparagine at position 344 to cysteine of a protease having the amino acid sequence of SEQ ID NO. 1.
The invention also provides a protease mutant BLAPR11 with improved heat resistance, wherein the amino acid sequence of the protease mutant BLAPR11 is shown as SEQ ID NO:15, the nucleotide sequence of the coding gene is shown as SEQ ID NO:16 is shown in the figure; the protease mutant BLAPR11 is obtained by changing threonine at position 183 to glutamic acid and lysine at position 369 to asparagine of a protease having the amino acid sequence of SEQ ID NO. 1.
The invention also provides a protease mutant BLAPR12 with improved heat resistance, wherein the amino acid sequence of the protease mutant BLAPR12 is shown as SEQ ID NO:17, the nucleotide sequence of the coding gene is shown as SEQ ID NO:18 is shown in the figure; the protease mutant BLAPR11 is obtained by changing threonine to glutamic acid at position 183, valine to alanine at position 53, and asparagine to aspartic acid at position 166 of a protease having the amino acid sequence of SEQ ID NO. 1.
The invention also provides a genetic engineering bacterium containing the protease mutant coding gene.
Furthermore, the genetic engineering bacteria are bacillus subtilis and bacillus licheniformis.
The invention also provides application of the protease mutant in preparing feed additives or food additives.
Compared with the prior art, the invention has the advantages and beneficial technical effects that:
the invention is provided withBacillus licheniformis Based on the protease gene derived from WX-02, single-site mutant BLAPR5 containing T183E, double-site mutants BLAPR6 to BLAPR11 containing T183E/A106D, T183E/K120P, T183E/V176A, T183E/Y208M, T183E/N344C and T183E/K369N, and triple-site mutant BLAPR12 containing T183E/V53A/N166D are respectively provided.
The heat resistance of the modified mutants of BLAPR 5-BLAPR 12 is respectively improved by 36.0%, 65.5%, 35.2%, 55.5%, 49.0%, 84.0%, 45.5% and 76.0% compared with that of the original protease when the mutants are treated for 3 minutes at 75 ℃, so that the heat resistance of the protease mutant is remarkably improved compared with that of the wild-type protease, the wide application of the protease mutant in the fields of feed, food and the like is facilitated, and the protease mutant has good market application prospect.
Drawings
FIG. 1 is a plate screen of the protease mutants of the present invention, in which the number 0 is BLAPR0 and the numbers 5 to 12 are BLAPR5 to BLAPR 12.
FIG. 2 shows the comparison of the heat resistance of the protease mutants of the present invention in a water bath at 75 ℃ for 3 min.
FIG. 3 shows the fermentation data of the protease of the present invention in a 30L fermentor.
Detailed Description
In order to facilitate understanding of the invention, the invention will be described in more detail below with reference to the accompanying drawings and examples, but the scope of the invention is not limited to the following specific examples.
The molecular biological experiments, which are not specifically described in the following examples, can be performed by referring to the specific methods listed in molecular cloning, a laboratory manual (third edition) J. SammBruker, or according to the kit and product instructions. Reagents and biomaterials used in specific examples are commercially available without specific recitation.
1. Strains and vectors
Bacillus subtilis WB600, plasmid pUB110, Escherichia coli BL21, plasmid pET-21a (+) were purchased from Invitrogen.
2. Reagents and culture media
Plasmid extraction kit, fragment purification recovery kit, restriction enzyme and the like are purchased from precious bioengineering (Dalian) Co., Ltd; the GeneMorph II random mutation PCR kit was purchased from Stratagene; ampicillin, IPTG, etc. were purchased from Biotechnology engineering (Shanghai) Co., Ltd; protein Marker: blue Plus II Protein Marker (14-120 kDa) was purchased from Beijing Quanjin Biotechnology, Inc.
The LB medium formula: 1% tryptone, 0.5% yeast extract, 1% NaCl.
Fermentation medium: 50-80g/L of soybean meal, 60-100g/L of corn starch, 2-4g/L of disodium hydrogen phosphate, 1-2g/L of sodium carbonate and natural pH.
Example 1: error-prone PCR construction of protease mutant library
Reference toBacillus licheniformis The amino acid sequence (SEQ ID NO:1) and DNA sequence (SEQ ID NO:2) of the WX-02-derived protease were used to design primers, Xba I restriction sites were designed at the 5 'end, and BamH I restriction sites were designed at the 3' end.
Random mutation is carried out by using a GeneMorph II random mutation PCR kit and taking the gene of SEQ ID NO:2 as a template, and the used primer sequences are as follows:
BLAPR-F：GCTCTAGAATGATGAGGAAGAAATC（SEQ ID NO:19）；
BLAPR-R：CGCGGATCCTTACTGTGCAGCTGCTTCGA（SEQ ID NO:20）。
the reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s and elongation at 72 ℃ for 1min for 30 cycles.
And carrying out double enzyme digestion on the amplified random mutation PCR product by using Xba I and BamH I, purifying and recycling the product, connecting the product to a pET-21a (+) vector, transforming escherichia coli BL21-DE3, and screening positive clones by using an ampicillin-resistant LB plate to obtain pET-BLAPREX. The synthesized original gene was ligated to pET-21a (+) vector and transformed into E.coli BL21-DE3 to obtain pET-BLAPR0 in the same manner.
The selected single colonies were inoculated into 96-well deep-well plates. Each plate was inoculated with 2 single colonies expressing BLAPR0 as controls. After 300. mu.L of LB liquid medium (containing 100. mu.g/mL ampicillin) was placed in each well and cultured with shaking at 37 ℃ and 200rpm for 4 hours, 50. mu.L of the bacterial solution was transferred to a new 96-well plate for stock preservation, 200. mu.L of LB-Amp medium containing IPTG was added to the remaining bacterial solution on the plate so that the final concentration of IPTG was 1mM and the final concentration of ampicillin was 100. mu.g/mL, and cultured with shaking at 37 ℃ and 200rpm for 10 hours to induce expression of protease.
And (3) repeatedly freezing and thawing the induced bacterial liquid for crushing, centrifuging the crushed cell sap, taking supernatant, carrying out heat treatment (water bath at 75 ℃ for 3min), and then detecting the residual activity of the protease. And sequencing the mutant gene with the residual enzyme activity higher than that of the control.
The mutant T183E (named as BLAPR5) with improved heat resistance and using the BLAPR0 as a starting template is screened, the amino acid sequence of the mutant is shown as SEQ ID NO. 3, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 4.
Example 2: second round error-prone PCR construction of mutant library of protease BLAPR1
The protease gene BLAPR5 selected in example 1 was used as a template to perform a second round of random mutagenesis, construction of a mutant library, and the materials, primers and conditions used were the same as in example 1. The residual activity of the protease mutants was determined after heat treatment (75 ℃ water bath for 3min) using BLAPR5 as a control for both mutant culture and selection. The mutant gene with residual enzyme activity higher than that of BLAPR5 was sequenced.
The following mutants with improved heat resistance were finally screened:
the mutation mode of the BLAPR6 is T183E/A106DC (threonine at position 183 is changed into glutamic acid, alanine at position 106 is changed into aspartic acid), the amino acid sequence of the mutation mode is shown as SEQ ID NO. 5, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 6;
the mutation mode of the BLAPR7 is T183E/K120P (threonine at the 183 th site is changed into glutamic acid, lysine at the 120 th site is changed into proline), the amino acid sequence of the BLAPR7 is shown as SEQ ID NO. 7, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 8;
the mutation mode of the BLAPR8 is T183E/V176A (threonine at position 183 is changed into glutamic acid, valine at position 176 is changed into alanine), the amino acid sequence is shown as SEQ ID NO. 9, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 10.
The mutation mode of the BLAPR9 is T183E/Y208M (threonine at position 183 is changed into glutamic acid, tyrosine at position 208 is changed into methionine), the amino acid sequence is shown as SEQ ID NO. 11, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 12.
The mutation mode of the BLAPR10 is T183E/N344C (threonine at position 183 is changed into glutamic acid, and asparagine at position 344 is changed into cysteine), the amino acid sequence is shown as SEQ ID NO. 13, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 14.
The mutation mode of the BLAPR11 is T183E/K369N (threonine at position 183 is changed into glutamic acid, lysine at position 369 is changed into asparagine), the amino acid sequence of the mutation mode is shown as SEQ ID NO. 15, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 16.
The mutation mode of the BLAPR12 is T183E/V53A/N166D (threonine at position 183 is changed into glutamic acid, valine at position 53 is changed into alanine, and asparagine at position 166 is changed into aspartic acid), the amino acid sequence of the BLAPR12 is shown as SEQ ID NO. 17, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 18.
Example 3: expression verification of protease mutant with improved heat resistance in bacillus subtilis
The mutant of example 2 and BLAPR0 were cloned into plasmid pUB110 at Xba I and BamH I sites, respectively; referring to a Bacillus subtilis transformation method created by Spizizen, the recombinant plasmid is transformed into Bacillus subtilis WB600 to obtain a recombinant bacterium. The mutants of BLAPR5 to BLAPR12 obtained by plate screening are shown in FIG. 1, in which the number 0 is BLAPR0 and the numbers 5-12 are BLAPR5 to BLAPR 12. After the recombinant bacteria are subjected to shake flask fermentation in a fermentation medium for 78 hours, the culture solution is centrifuged to obtain a supernatant, the average enzyme activity of the supernatant of each mutant fermentation liquid is measured, and the supernatant of the transformant fermentation with the highest enzyme activity in each mutant is taken and treated in a water bath at 75 ℃ for 3 minutes, and then the enzyme activity retention rate is compared.
As a result, as shown in FIG. 2, the heat resistance of the mutated proteases BLAPR5 to BLAPR12 was improved by 36.0%, 65.5%, 35.2%, 55.5%, 49.0%, 84.0%, 45.5%, and 76.0%, respectively, when treated at 75 ℃ for 3 minutes.
The above results show that the heat resistance can be improved while the original enzyme activity is maintained by mutating Thr at 183 th position of BLAPR0 to Glu. On the basis, the mutant is obtained by mutating Ala at the 106 th position of the mutant into Asp, or the mutant is obtained by mutating Lys at the 120 th position of the mutant into Pro; or mutant obtained by mutating Val at position 176 to Ala; or mutant obtained by mutating 208 Tyr to Met; or mutation of 344 Asn to Cys; or mutant obtained by mutating 369 Lys position to Asn; or a mutant in which Val at position 53 is mutated to Ala and Asn at position 166 is mutated to Asp, and the heat resistance is further improved. Therefore, compared with the wild type, the heat resistance of the mutant protease is greatly improved, and the mutant protease is more beneficial to the application in the fields of feed, food or washing.
Example 4: protease mutants were fermented and prepared in a 30L fermentor
Recombinant bacteria expressing the protease BLAPR0 and the protease mutants BLAPR5, BLAPR6, BLAPR7, BLAPR8, BLAPR9, BLAPR10, BLAPR11 and BLAPR12 in example 3 were streaked on LB plates resistant to kanamycin (20. mu.g/mL) respectively, cultured at 37 ℃ until single colonies were grown, and the single colonies with good growth were selected and streaked on LB plates resistant to kanamycin (20. mu.g/mL) respectively, and the thus-obtained three generations of recombinant Bacillus subtilis colonies were activated and inoculated into 50mL of LB medium containing kanamycin (20. mu.g/mL) and cultured at 37 ℃ and 200rpm for 24 hours. Inoculated into 1L LB medium containing kanamycin (final concentration of 20. mu.g/mL) at an inoculum size of 2%, cultured at 37 ℃ and 200rpm to OD600About 5, and is used as a seed liquid inoculation fermentation tank.
The fermentation production process comprises the following steps: 5-10% of soybean meal, 1-5% of corn flour, 1-1.0% of PPG-200000.1, 0.1-1.0% of protease, 0.1-1.0% of amylase, 0.2-0.5% of disodium hydrogen phosphate (12 water), natural pH, 37 ℃, stirring speed of 600rpm, ventilation volume of 1.5(v/v), and dissolved oxygen controlled at more than 20%. The pH value is natural in the fermentation process, the enzyme activity is measured after fermentation is carried out for 24 hours, and the measurement is carried out once every 4 hours until the fermentation is finished (48 hours).
The enzyme activity results are shown in figure 3, the enzyme activity of the protease is continuously improved along with the increase of the fermentation time, the enzyme activity of the protease mutant is equivalent to that of wild type protease BLAPR0, but the heat resistance of the protease mutant is better than that of the wild type protease.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> Qingdao Shangde Biotechnology Co., Ltd
<120> protease mutant with improved heat resistance, and coding gene and application thereof
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 379
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Phe Met
1 5 10 15
Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro
20 25 30
Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val
35 40 45
Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys
50 55 60
Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Lys Ala Lys Leu Asp
65 70 75 80
Lys Glu Ala Leu Lys Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val
85 90 95
Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly
100 105 110
Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Phe Lys Gly
115 120 125
Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His
130 135 140
Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala
145 150 155 160
Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val
165 170 175
Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Ser Val
180 185 190
Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr
195 200 205
Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp
210 215 220
Val Ile Asn Met Ser Leu Gly Gly Ala Ser Gly Ser Thr Ala Met Lys
225 230 235 240
Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala
245 250 255
Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro
260 265 270
Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser
275 280 285
Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala
290 295 300
Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Asn Thr Tyr Ala Thr
305 310 315 320
Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala
325 330 335
Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn
340 345 350
Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly
355 360 365
Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln
370 375
<210> 2
<211> 1140
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgatgagga agaaatcatt ttggttaggg atgctgacgg cgtttatgtt agtgtttacg 60
atggcgtttt cagatagcgc ttctgctgca caacctgcga aaaatgttga aaaagattat 120
atcgtggggt ttaaatctgg agttaaaacg gcgtctgtga aaaaagatat tattaaagaa 180
tcaggcggca aagtcgataa acagtttcgg attatcaatg ctgcgaaagc gaaacttgat 240
aaagaagcat tgaaagaagt caaaaatgat ccggatgttg cttacgtcga agaagatcat 300
gtcgcacatg cacttgctca gacggtgccg tatggcatcc ctcttatcaa agcagataaa 360
gtccaagcac aaggctttaa aggcgctaat gtcaaagtcg cggtccttga tacgggaatc 420
caagcaagtc atccggatct taatgtggtt gggggtgcgt catttgtcgc gggagaagca 480
tataatacag atggcaacgg tcatggaaca catgttgcgg gaacggtcgc agcgttagat 540
aatacgacgg gtgtgcttgg tgttgcaccg tctgtctcac tgtatgcggt gaaagtcctt 600
aattctagcg gatctggatc ttattcagga attgtgtctg gaatcgaatg ggctacaacg 660
aatggcatgg atgtcatcaa tatgagcctg ggaggcgcga gcggctctac agctatgaaa 720
caagcagtcg ataatgcgta tgcgcgcggt gttgtggtgg tcgcagctgc gggcaattca 780
ggctcatctg gcaatacgaa tacgatcggc tatccggcta aatatgattc agtcattgct 840
gtgggcgcgg tcgattctaa ttctaatcgt gcttctttta gctcagtggg cgcagaactt 900
gaagtgatgg caccgggcgc tggagtgtat agcacctatc cgacaaatac ctatgctaca 960
ctgaatggca cgtctatggc ttcacctcat gttgcaggcg ccgccgctct tatcctgagc 1020
aaacatccta atttgagcgc gagccaggtt cgtaatagac tttcttcaac agcgacgtat 1080
ttgggctcta gcttttatta tggcaaagga ctgatcaatg tcgaagcagc tgcacagtaa 1140
<210> 3
<211> 379
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Phe Met
1 5 10 15
Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro
20 25 30
Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val
35 40 45
Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys
50 55 60
Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Lys Ala Lys Leu Asp
65 70 75 80
Lys Glu Ala Leu Lys Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val
85 90 95
Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly
100 105 110
Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Phe Lys Gly
115 120 125
Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His
130 135 140
Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala
145 150 155 160
Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val
165 170 175
Ala Ala Leu Asp Asn Thr Glu Gly Val Leu Gly Val Ala Pro Ser Val
180 185 190
Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr
195 200 205
Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp
210 215 220
Val Ile Asn Met Ser Leu Gly Gly Ala Ser Gly Ser Thr Ala Met Lys
225 230 235 240
Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala
245 250 255
Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro
260 265 270
Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser
275 280 285
Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala
290 295 300
Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Asn Thr Tyr Ala Thr
305 310 315 320
Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala
325 330 335
Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn
340 345 350
Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly
355 360 365
Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln
370 375
<210> 4
<211> 1140
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
atgatgagga agaaatcatt ttggttaggg atgctgacgg cgtttatgtt agtgtttacg 60
atggcgtttt cagatagcgc ttctgctgca caacctgcga aaaatgttga aaaagattat 120
atcgtggggt ttaaatctgg agttaaaacg gcgtctgtga aaaaagatat tattaaagaa 180
tcaggcggca aagtcgataa acagtttcgg attatcaatg ctgcgaaagc gaaacttgat 240
aaagaagcat tgaaagaagt caaaaatgat ccggatgttg cttacgtcga agaagatcat 300
gtcgcacatg cacttgctca gacggtgccg tatggcatcc ctcttatcaa agcagataaa 360
gtccaagcac aaggctttaa aggcgctaat gtcaaagtcg cggtccttga tacgggaatc 420
caagcaagtc atccggatct taatgtggtt gggggtgcgt catttgtcgc gggagaagca 480
tataatacag atggcaacgg tcatggaaca catgttgcgg gaacggtcgc agcgttagat 540
aatacggagg gtgtgcttgg tgttgcaccg tctgtctcac tgtatgcggt gaaagtcctt 600
aattctagcg gatctggatc ttattcagga attgtgtctg gaatcgaatg ggctacaacg 660
aatggcatgg atgtcatcaa tatgagcctg ggaggcgcga gcggctctac agctatgaaa 720
caagcagtcg ataatgcgta tgcgcgcggt gttgtggtgg tcgcagctgc gggcaattca 780
ggctcatctg gcaatacgaa tacgatcggc tatccggcta aatatgattc agtcattgct 840
gtgggcgcgg tcgattctaa ttctaatcgt gcttctttta gctcagtggg cgcagaactt 900
gaagtgatgg caccgggcgc tggagtgtat agcacctatc cgacaaatac ctatgctaca 960
ctgaatggca cgtctatggc ttcacctcat gttgcaggcg ccgccgctct tatcctgagc 1020
aaacatccta atttgagcgc gagccaggtt cgtaatagac tttcttcaac agcgacgtat 1080
ttgggctcta gcttttatta tggcaaagga ctgatcaatg tcgaagcagc tgcacagtaa 1140
<210> 5
<211> 379
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Phe Met
1 5 10 15
Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro
20 25 30
Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val
35 40 45
Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys
50 55 60
Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Lys Ala Lys Leu Asp
65 70 75 80
Lys Glu Ala Leu Lys Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val
85 90 95
Glu Glu Asp His Val Ala His Ala Leu Asp Gln Thr Val Pro Tyr Gly
100 105 110
Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Phe Lys Gly
115 120 125
Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His
130 135 140
Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala
145 150 155 160
Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val
165 170 175
Ala Ala Leu Asp Asn Thr Glu Gly Val Leu Gly Val Ala Pro Ser Val
180 185 190
Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr
195 200 205
Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp
210 215 220
Val Ile Asn Met Ser Leu Gly Gly Ala Ser Gly Ser Thr Ala Met Lys
225 230 235 240
Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala
245 250 255
Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro
260 265 270
Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser
275 280 285
Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala
290 295 300
Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Asn Thr Tyr Ala Thr
305 310 315 320
Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala
325 330 335
Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn
340 345 350
Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly
355 360 365
Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln
370 375
<210> 6
<211> 1140
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
atgatgagga agaaatcatt ttggttaggg atgctgacgg cgtttatgtt agtgtttacg 60
atggcgtttt cagatagcgc ttctgctgca caacctgcga aaaatgttga aaaagattat 120
atcgtggggt ttaaatctgg agttaaaacg gcgtctgtga aaaaagatat tattaaagaa 180
tcaggcggca aagtcgataa acagtttcgg attatcaatg ctgcgaaagc gaaacttgat 240
aaagaagcat tgaaagaagt caaaaatgat ccggatgttg cttacgtcga agaagatcat 300
gtcgcacatg cacttgatca gacggtgccg tatggcatcc ctcttatcaa agcagataaa 360
gtccaagcac aaggctttaa aggcgctaat gtcaaagtcg cggtccttga tacgggaatc 420
caagcaagtc atccggatct taatgtggtt gggggtgcgt catttgtcgc gggagaagca 480
tataatacag atggcaacgg tcatggaaca catgttgcgg gaacggtcgc agcgttagat 540
aatacggagg gtgtgcttgg tgttgcaccg tctgtctcac tgtatgcggt gaaagtcctt 600
aattctagcg gatctggatc ttattcagga attgtgtctg gaatcgaatg ggctacaacg 660
aatggcatgg atgtcatcaa tatgagcctg ggaggcgcga gcggctctac agctatgaaa 720
caagcagtcg ataatgcgta tgcgcgcggt gttgtggtgg tcgcagctgc gggcaattca 780
ggctcatctg gcaatacgaa tacgatcggc tatccggcta aatatgattc agtcattgct 840
gtgggcgcgg tcgattctaa ttctaatcgt gcttctttta gctcagtggg cgcagaactt 900
gaagtgatgg caccgggcgc tggagtgtat agcacctatc cgacaaatac ctatgctaca 960
ctgaatggca cgtctatggc ttcacctcat gttgcaggcg ccgccgctct tatcctgagc 1020
aaacatccta atttgagcgc gagccaggtt cgtaatagac tttcttcaac agcgacgtat 1080
ttgggctcta gcttttatta tggcaaagga ctgatcaatg tcgaagcagc tgcacagtaa 1140
<210> 7
<211> 379
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 7
Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Phe Met
1 5 10 15
Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro
20 25 30
Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val
35 40 45
Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys
50 55 60
Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Lys Ala Lys Leu Asp
65 70 75 80
Lys Glu Ala Leu Lys Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val
85 90 95
Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly
100 105 110
Ile Pro Leu Ile Lys Ala Asp Pro Val Gln Ala Gln Gly Phe Lys Gly
115 120 125
Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His
130 135 140
Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala
145 150 155 160
Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val
165 170 175
Ala Ala Leu Asp Asn Thr Glu Gly Val Leu Gly Val Ala Pro Ser Val
180 185 190
Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr
195 200 205
Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp
210 215 220
Val Ile Asn Met Ser Leu Gly Gly Ala Ser Gly Ser Thr Ala Met Lys
225 230 235 240
Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala
245 250 255
Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro
260 265 270
Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser
275 280 285
Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala
290 295 300
Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Asn Thr Tyr Ala Thr
305 310 315 320
Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala
325 330 335
Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn
340 345 350
Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly
355 360 365
Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln
370 375
<210> 8
<211> 1140
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
atgatgagga agaaatcatt ttggttaggg atgctgacgg cgtttatgtt agtgtttacg 60
atggcgtttt cagatagcgc ttctgctgca caacctgcga aaaatgttga aaaagattat 120
atcgtggggt ttaaatctgg agttaaaacg gcgtctgtga aaaaagatat tattaaagaa 180
tcaggcggca aagtcgataa acagtttcgg attatcaatg ctgcgaaagc gaaacttgat 240
aaagaagcat tgaaagaagt caaaaatgat ccggatgttg cttacgtcga agaagatcat 300
gtcgcacatg cacttgctca gacggtgccg tatggcatcc ctcttatcaa agcagatcca 360
gtccaagcac aaggctttaa aggcgctaat gtcaaagtcg cggtccttga tacgggaatc 420
caagcaagtc atccggatct taatgtggtt gggggtgcgt catttgtcgc gggagaagca 480
tataatacag atggcaacgg tcatggaaca catgttgcgg gaacggtcgc agcgttagat 540
aatacggagg gtgtgcttgg tgttgcaccg tctgtctcac tgtatgcggt gaaagtcctt 600
aattctagcg gatctggatc ttattcagga attgtgtctg gaatcgaatg ggctacaacg 660
aatggcatgg atgtcatcaa tatgagcctg ggaggcgcga gcggctctac agctatgaaa 720
caagcagtcg ataatgcgta tgcgcgcggt gttgtggtgg tcgcagctgc gggcaattca 780
ggctcatctg gcaatacgaa tacgatcggc tatccggcta aatatgattc agtcattgct 840
gtgggcgcgg tcgattctaa ttctaatcgt gcttctttta gctcagtggg cgcagaactt 900
gaagtgatgg caccgggcgc tggagtgtat agcacctatc cgacaaatac ctatgctaca 960
ctgaatggca cgtctatggc ttcacctcat gttgcaggcg ccgccgctct tatcctgagc 1020
aaacatccta atttgagcgc gagccaggtt cgtaatagac tttcttcaac agcgacgtat 1080
ttgggctcta gcttttatta tggcaaagga ctgatcaatg tcgaagcagc tgcacagtaa 1140
<210> 9
<211> 379
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 9
Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Phe Met
1 5 10 15
Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro
20 25 30
Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val
35 40 45
Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys
50 55 60
Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Lys Ala Lys Leu Asp
65 70 75 80
Lys Glu Ala Leu Lys Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val
85 90 95
Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly
100 105 110
Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Phe Lys Gly
115 120 125
Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His
130 135 140
Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala
145 150 155 160
Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Ala
165 170 175
Ala Ala Leu Asp Asn Thr Glu Gly Val Leu Gly Val Ala Pro Ser Val
180 185 190
Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr
195 200 205
Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp
210 215 220
Val Ile Asn Met Ser Leu Gly Gly Ala Ser Gly Ser Thr Ala Met Lys
225 230 235 240
Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala
245 250 255
Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro
260 265 270
Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser
275 280 285
Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala
290 295 300
Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Asn Thr Tyr Ala Thr
305 310 315 320
Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala
325 330 335
Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn
340 345 350
Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly
355 360 365
Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln
370 375
<210> 10
<211> 1140
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
atgatgagga agaaatcatt ttggttaggg atgctgacgg cgtttatgtt agtgtttacg 60
atggcgtttt cagatagcgc ttctgctgca caacctgcga aaaatgttga aaaagattat 120
atcgtggggt ttaaatctgg agttaaaacg gcgtctgtga aaaaagatat tattaaagaa 180
tcaggcggca aagtcgataa acagtttcgg attatcaatg ctgcgaaagc gaaacttgat 240
aaagaagcat tgaaagaagt caaaaatgat ccggatgttg cttacgtcga agaagatcat 300
gtcgcacatg cacttgctca gacggtgccg tatggcatcc ctcttatcaa agcagataaa 360
gtccaagcac aaggctttaa aggcgctaat gtcaaagtcg cggtccttga tacgggaatc 420
caagcaagtc atccggatct taatgtggtt gggggtgcgt catttgtcgc gggagaagca 480
tataatacag atggcaacgg tcatggaaca catgttgcgg gaacggccgc agcgttagat 540
aatacggagg gtgtgcttgg tgttgcaccg tctgtctcac tgtatgcggt gaaagtcctt 600
aattctagcg gatctggatc ttattcagga attgtgtctg gaatcgaatg ggctacaacg 660
aatggcatgg atgtcatcaa tatgagcctg ggaggcgcga gcggctctac agctatgaaa 720
caagcagtcg ataatgcgta tgcgcgcggt gttgtggtgg tcgcagctgc gggcaattca 780
ggctcatctg gcaatacgaa tacgatcggc tatccggcta aatatgattc agtcattgct 840
gtgggcgcgg tcgattctaa ttctaatcgt gcttctttta gctcagtggg cgcagaactt 900
gaagtgatgg caccgggcgc tggagtgtat agcacctatc cgacaaatac ctatgctaca 960
ctgaatggca cgtctatggc ttcacctcat gttgcaggcg ccgccgctct tatcctgagc 1020
aaacatccta atttgagcgc gagccaggtt cgtaatagac tttcttcaac agcgacgtat 1080
ttgggctcta gcttttatta tggcaaagga ctgatcaatg tcgaagcagc tgcacagtaa 1140
<210> 11
<211> 379
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 11
Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Phe Met
1 5 10 15
Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro
20 25 30
Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val
35 40 45
Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys
50 55 60
Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Lys Ala Lys Leu Asp
65 70 75 80
Lys Glu Ala Leu Lys Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val
85 90 95
Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly
100 105 110
Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Phe Lys Gly
115 120 125
Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His
130 135 140
Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala
145 150 155 160
Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val
165 170 175
Ala Ala Leu Asp Asn Thr Glu Gly Val Leu Gly Val Ala Pro Ser Val
180 185 190
Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Met
195 200 205
Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp
210 215 220
Val Ile Asn Met Ser Leu Gly Gly Ala Ser Gly Ser Thr Ala Met Lys
225 230 235 240
Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala
245 250 255
Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro
260 265 270
Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser
275 280 285
Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala
290 295 300
Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Asn Thr Tyr Ala Thr
305 310 315 320
Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala
325 330 335
Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn
340 345 350
Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly
355 360 365
Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln
370 375
<210> 12
<211> 1140
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
atgatgagga agaaatcatt ttggttaggg atgctgacgg cgtttatgtt agtgtttacg 60
atggcgtttt cagatagcgc ttctgctgca caacctgcga aaaatgttga aaaagattat 120
atcgtggggt ttaaatctgg agttaaaacg gcgtctgtga aaaaagatat tattaaagaa 180
tcaggcggca aagtcgataa acagtttcgg attatcaatg ctgcgaaagc gaaacttgat 240
aaagaagcat tgaaagaagt caaaaatgat ccggatgttg cttacgtcga agaagatcat 300
gtcgcacatg cacttgctca gacggtgccg tatggcatcc ctcttatcaa agcagataaa 360
gtccaagcac aaggctttaa aggcgctaat gtcaaagtcg cggtccttga tacgggaatc 420
caagcaagtc atccggatct taatgtggtt gggggtgcgt catttgtcgc gggagaagca 480
tataatacag atggcaacgg tcatggaaca catgttgcgg gaacggtcgc agcgttagat 540
aatacggagg gtgtgcttgg tgttgcaccg tctgtctcac tgtatgcggt gaaagtcctt 600
aattctagcg gatctggatc tatgtcagga attgtgtctg gaatcgaatg ggctacaacg 660
aatggcatgg atgtcatcaa tatgagcctg ggaggcgcga gcggctctac agctatgaaa 720
caagcagtcg ataatgcgta tgcgcgcggt gttgtggtgg tcgcagctgc gggcaattca 780
ggctcatctg gcaatacgaa tacgatcggc tatccggcta aatatgattc agtcattgct 840
gtgggcgcgg tcgattctaa ttctaatcgt gcttctttta gctcagtggg cgcagaactt 900
gaagtgatgg caccgggcgc tggagtgtat agcacctatc cgacaaatac ctatgctaca 960
ctgaatggca cgtctatggc ttcacctcat gttgcaggcg ccgccgctct tatcctgagc 1020
aaacatccta atttgagcgc gagccaggtt cgtaatagac tttcttcaac agcgacgtat 1080
ttgggctcta gcttttatta tggcaaagga ctgatcaatg tcgaagcagc tgcacagtaa 1140
<210> 13
<211> 379
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 13
Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Phe Met
1 5 10 15
Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro
20 25 30
Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val
35 40 45
Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys
50 55 60
Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Lys Ala Lys Leu Asp
65 70 75 80
Lys Glu Ala Leu Lys Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val
85 90 95
Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly
100 105 110
Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Phe Lys Gly
115 120 125
Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His
130 135 140
Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala
145 150 155 160
Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val
165 170 175
Ala Ala Leu Asp Asn Thr Glu Gly Val Leu Gly Val Ala Pro Ser Val
180 185 190
Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr
195 200 205
Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp
210 215 220
Val Ile Asn Met Ser Leu Gly Gly Ala Ser Gly Ser Thr Ala Met Lys
225 230 235 240
Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala
245 250 255
Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro
260 265 270
Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser
275 280 285
Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala
290 295 300
Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Asn Thr Tyr Ala Thr
305 310 315 320
Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala
325 330 335
Leu Ile Leu Ser Lys His Pro Cys Leu Ser Ala Ser Gln Val Arg Asn
340 345 350
Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly
355 360 365
Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln
370 375
<210> 14
<211> 1140
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
atgatgagga agaaatcatt ttggttaggg atgctgacgg cgtttatgtt agtgtttacg 60
atggcgtttt cagatagcgc ttctgctgca caacctgcga aaaatgttga aaaagattat 120
atcgtggggt ttaaatctgg agttaaaacg gcgtctgtga aaaaagatat tattaaagaa 180
tcaggcggca aagtcgataa acagtttcgg attatcaatg ctgcgaaagc gaaacttgat 240
aaagaagcat tgaaagaagt caaaaatgat ccggatgttg cttacgtcga agaagatcat 300
gtcgcacatg cacttgctca gacggtgccg tatggcatcc ctcttatcaa agcagataaa 360
gtccaagcac aaggctttaa aggcgctaat gtcaaagtcg cggtccttga tacgggaatc 420
caagcaagtc atccggatct taatgtggtt gggggtgcgt catttgtcgc gggagaagca 480
tataatacag atggcaacgg tcatggaaca catgttgcgg gaacggtcgc agcgttagat 540
aatacggagg gtgtgcttgg tgttgcaccg tctgtctcac tgtatgcggt gaaagtcctt 600
aattctagcg gatctggatc ttattcagga attgtgtctg gaatcgaatg ggctacaacg 660
aatggcatgg atgtcatcaa tatgagcctg ggaggcgcga gcggctctac agctatgaaa 720
caagcagtcg ataatgcgta tgcgcgcggt gttgtggtgg tcgcagctgc gggcaattca 780
ggctcatctg gcaatacgaa tacgatcggc tatccggcta aatatgattc agtcattgct 840
gtgggcgcgg tcgattctaa ttctaatcgt gcttctttta gctcagtggg cgcagaactt 900
gaagtgatgg caccgggcgc tggagtgtat agcacctatc cgacaaatac ctatgctaca 960
ctgaatggca cgtctatggc ttcacctcat gttgcaggcg ccgccgctct tatcctgagc 1020
aaacatcctt gtttgagcgc gagccaggtt cgtaatagac tttcttcaac agcgacgtat 1080
ttgggctcta gcttttatta tggcaaagga ctgatcaatg tcgaagcagc tgcacagtaa 1140
<210> 15
<211> 379
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 15
Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Phe Met
1 5 10 15
Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro
20 25 30
Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val
35 40 45
Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys
50 55 60
Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Lys Ala Lys Leu Asp
65 70 75 80
Lys Glu Ala Leu Lys Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val
85 90 95
Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly
100 105 110
Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Phe Lys Gly
115 120 125
Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His
130 135 140
Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala
145 150 155 160
Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val
165 170 175
Ala Ala Leu Asp Asn Thr Glu Gly Val Leu Gly Val Ala Pro Ser Val
180 185 190
Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr
195 200 205
Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp
210 215 220
Val Ile Asn Met Ser Leu Gly Gly Ala Ser Gly Ser Thr Ala Met Lys
225 230 235 240
Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala
245 250 255
Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro
260 265 270
Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser
275 280 285
Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala
290 295 300
Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Asn Thr Tyr Ala Thr
305 310 315 320
Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala
325 330 335
Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn
340 345 350
Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly
355 360 365
Asn Gly Leu Ile Asn Val Glu Ala Ala Ala Gln
370 375
<210> 16
<211> 1140
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
atgatgagga agaaatcatt ttggttaggg atgctgacgg cgtttatgtt agtgtttacg 60
atggcgtttt cagatagcgc ttctgctgca caacctgcga aaaatgttga aaaagattat 120
atcgtggggt ttaaatctgg agttaaaacg gcgtctgtga aaaaagatat tattaaagaa 180
tcaggcggca aagtcgataa acagtttcgg attatcaatg ctgcgaaagc gaaacttgat 240
aaagaagcat tgaaagaagt caaaaatgat ccggatgttg cttacgtcga agaagatcat 300
gtcgcacatg cacttgctca gacggtgccg tatggcatcc ctcttatcaa agcagataaa 360
gtccaagcac aaggctttaa aggcgctaat gtcaaagtcg cggtccttga tacgggaatc 420
caagcaagtc atccggatct taatgtggtt gggggtgcgt catttgtcgc gggagaagca 480
tataatacag atggcaacgg tcatggaaca catgttgcgg gaacggtcgc agcgttagat 540
aatacggagg gtgtgcttgg tgttgcaccg tctgtctcac tgtatgcggt gaaagtcctt 600
aattctagcg gatctggatc ttattcagga attgtgtctg gaatcgaatg ggctacaacg 660
aatggcatgg atgtcatcaa tatgagcctg ggaggcgcga gcggctctac agctatgaaa 720
caagcagtcg ataatgcgta tgcgcgcggt gttgtggtgg tcgcagctgc gggcaattca 780
ggctcatctg gcaatacgaa tacgatcggc tatccggcta aatatgattc agtcattgct 840
gtgggcgcgg tcgattctaa ttctaatcgt gcttctttta gctcagtggg cgcagaactt 900
gaagtgatgg caccgggcgc tggagtgtat agcacctatc cgacaaatac ctatgctaca 960
ctgaatggca cgtctatggc ttcacctcat gttgcaggcg ccgccgctct tatcctgagc 1020
aaacatccta atttgagcgc gagccaggtt cgtaatagac tttcttcaac agcgacgtat 1080
ttgggctcta gcttttatta tggcaatgga ctgatcaatg tcgaagcagc tgcacagtaa 1140
<210> 17
<211> 379
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 17
Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Phe Met
1 5 10 15
Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro
20 25 30
Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val
35 40 45
Lys Thr Ala Ser Ala Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys
50 55 60
Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Lys Ala Lys Leu Asp
65 70 75 80
Lys Glu Ala Leu Lys Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val
85 90 95
Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly
100 105 110
Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Phe Lys Gly
115 120 125
Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His
130 135 140
Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala
145 150 155 160
Tyr Asn Thr Asp Gly Asp Gly His Gly Thr His Val Ala Gly Thr Val
165 170 175
Ala Ala Leu Asp Asn Thr Glu Gly Val Leu Gly Val Ala Pro Ser Val
180 185 190
Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr
195 200 205
Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp
210 215 220
Val Ile Asn Met Ser Leu Gly Gly Ala Ser Gly Ser Thr Ala Met Lys
225 230 235 240
Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala
245 250 255
Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro
260 265 270
Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser
275 280 285
Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala
290 295 300
Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Asn Thr Tyr Ala Thr
305 310 315 320
Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala
325 330 335
Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn
340 345 350
Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly
355 360 365
Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln
370 375
<210> 18
<211> 1140
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
atgatgagga agaaatcatt ttggttaggg atgctgacgg cgtttatgtt agtgtttacg 60
atggcgtttt cagatagcgc ttctgctgca caacctgcga aaaatgttga aaaagattat 120
atcgtggggt ttaaatctgg agttaaaacg gcgtctgcga aaaaagatat tattaaagaa 180
tcaggcggca aagtcgataa acagtttcgg attatcaatg ctgcgaaagc gaaacttgat 240
aaagaagcat tgaaagaagt caaaaatgat ccggatgttg cttacgtcga agaagatcat 300
gtcgcacatg cacttgctca gacggtgccg tatggcatcc ctcttatcaa agcagataaa 360
gtccaagcac aaggctttaa aggcgctaat gtcaaagtcg cggtccttga tacgggaatc 420
caagcaagtc atccggatct taatgtggtt gggggtgcgt catttgtcgc gggagaagca 480
tataatacag atggcgacgg tcatggaaca catgttgcgg gaacggtcgc agcgttagat 540
aatacggagg gtgtgcttgg tgttgcaccg tctgtctcac tgtatgcggt gaaagtcctt 600
aattctagcg gatctggatc ttattcagga attgtgtctg gaatcgaatg ggctacaacg 660
aatggcatgg atgtcatcaa tatgagcctg ggaggcgcga gcggctctac agctatgaaa 720
caagcagtcg ataatgcgta tgcgcgcggt gttgtggtgg tcgcagctgc gggcaattca 780
ggctcatctg gcaatacgaa tacgatcggc tatccggcta aatatgattc agtcattgct 840
gtgggcgcgg tcgattctaa ttctaatcgt gcttctttta gctcagtggg cgcagaactt 900
gaagtgatgg caccgggcgc tggagtgtat agcacctatc cgacaaatac ctatgctaca 960
ctgaatggca cgtctatggc ttcacctcat gttgcaggcg ccgccgctct tatcctgagc 1020
aaacatccta atttgagcgc gagccaggtt cgtaatagac tttcttcaac agcgacgtat 1080
ttgggctcta gcttttatta tggcaaagga ctgatcaatg tcgaagcagc tgcacagtaa 1140
<210> 19
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
gctctagaat gatgaggaag aaatc 25
<210> 20
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
cgcggatcct tactgtgcag ctgcttcga 29

Claims (10)

1. The protease mutant BLAPR5 with improved heat resistance is characterized in that the amino acid sequence of the protease mutant BLAPR5 is shown as SEQ ID NO:3, the nucleotide sequence of the coding gene is shown as SEQ ID NO:4 is shown in the specification; the protease mutant BLAPR5 is obtained by changing threonine at position 183 of a protease with an amino acid sequence of SEQ ID NO. 1 into glutamic acid.
2. The protease mutant BLAPR6 with improved heat resistance is characterized in that the amino acid sequence of the protease mutant BLAPR6 is shown as SEQ ID NO:5, the nucleotide sequence of the coding gene is shown as SEQ ID NO:6 is shown in the specification; the protease mutant BLAPR6 is obtained by changing threonine at position 183 to glutamic acid and alanine at position 106 to aspartic acid of a protease having the amino acid sequence of SEQ ID NO. 1.
3. The protease mutant BLAPR7 with improved heat resistance is characterized in that the amino acid sequence of the protease mutant BLAPR7 is shown as SEQ ID NO:7, the nucleotide sequence of the coding gene is shown as SEQ ID NO:8 is shown in the specification; the protease mutant BLAPR7 is obtained by changing threonine at position 183 to glutamic acid and lysine at position 120 to proline of a protease having the amino acid sequence of SEQ ID NO. 1.
4. The protease mutant BLAPR8 with improved heat resistance is characterized in that the amino acid sequence of the protease mutant BLAPR8 is shown as SEQ ID NO:9, the nucleotide sequence of the coding gene is shown as SEQ ID NO:10 is shown in the figure; the protease mutant BLAPR8 is obtained by changing threonine at position 183 to glutamic acid and valine at position 176 to alanine of a protease having the amino acid sequence of SEQ ID NO. 1.
5. The protease mutant BLAPR9 with improved heat resistance is characterized in that the amino acid sequence of the protease mutant BLAPR9 is shown as SEQ ID NO:11, and the nucleotide sequence of the coding gene is shown as SEQ ID NO:12 is shown in the specification; the protease mutant BLAPR9 is obtained by changing threonine to glutamic acid at position 183 and tyrosine to methionine at position 208 of a protease having the amino acid sequence of SEQ ID NO. 1.
6. The protease mutant BLAPR10 with improved heat resistance is characterized in that the amino acid sequence of the protease mutant BLAPR10 is shown as SEQ ID NO:13, and the nucleotide sequence of the coding gene is shown as SEQ ID NO:14 is shown in the figure; the protease mutant BLAPR10 is obtained by changing threonine at position 183 to glutamic acid and asparagine at position 344 to cysteine of a protease having the amino acid sequence of SEQ ID NO. 1.
7. The protease mutant BLAPR11 with improved heat resistance is characterized in that the amino acid sequence of the protease mutant BLAPR11 is shown as SEQ ID NO:15, the nucleotide sequence of the coding gene is shown as SEQ ID NO:16 is shown in the figure; the protease mutant BLAPR11 is obtained by changing threonine at position 183 to glutamic acid and lysine at position 369 to asparagine of a protease having the amino acid sequence of SEQ ID NO. 1.
8. The protease mutant BLAPR12 with improved heat resistance is characterized in that the amino acid sequence of the protease mutant BLAPR12 is shown as SEQ ID NO:17, the nucleotide sequence of the coding gene is shown as SEQ ID NO:18 is shown in the figure; the protease mutant BLAPR11 is obtained by changing threonine to glutamic acid at position 183, valine to alanine at position 53, and asparagine to aspartic acid at position 166 of a protease having the amino acid sequence of SEQ ID NO. 1.
9. A genetically engineered bacterium comprising a gene encoding the protease mutant according to any one of claims 1 to 8.
10. Use of a protease mutant according to any one of claims 1-8 for the preparation of a feed additive or a food additive.
CN202111432327.2A 2021-11-29 2021-11-29 Protease mutant with improved heat resistance, encoding gene and application thereof Active CN114107266B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111432327.2A CN114107266B (en) 2021-11-29 2021-11-29 Protease mutant with improved heat resistance, encoding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111432327.2A CN114107266B (en) 2021-11-29 2021-11-29 Protease mutant with improved heat resistance, encoding gene and application thereof

Publications (2)

Publication Number Publication Date
CN114107266A true CN114107266A (en) 2022-03-01
CN114107266B CN114107266B (en) 2023-11-14

Family

ID=80371766

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111432327.2A Active CN114107266B (en) 2021-11-29 2021-11-29 Protease mutant with improved heat resistance, encoding gene and application thereof

Country Status (1)

Country Link
CN (1) CN114107266B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114774396A (en) * 2022-06-20 2022-07-22 山东龙昌动物保健品有限公司 Keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additive
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002002726A1 (en) * 2000-06-30 2002-01-10 The Procter & Gamble Company Detergent compositions comprising a maltogenic alpha-amylase enzyme
WO2002002725A1 (en) * 2000-06-30 2002-01-10 The Procter & Gamble Company Detergent compositions comprising a cyclodextrin glucanotransferase enzyme
CN101528920A (en) * 2006-10-19 2009-09-09 丹尼斯科美国公司 Multiple mutation variants of serine protease
CN101575635A (en) * 2002-02-26 2009-11-11 金克克国际有限公司 Subtilisin carlsberg proteins with reduced immunogenicity
US8535927B1 (en) * 2003-11-19 2013-09-17 Danisco Us Inc. Micrococcineae serine protease polypeptides and compositions thereof
CN107075491A (en) * 2014-10-28 2017-08-18 谷万达公司 Method and composition for stablizing the protease that the intein of trans-splicing is modified
CN109055288A (en) * 2018-06-30 2018-12-21 浙江工业大学 A kind of recombined bacillus subtilis and its application
US20200255813A1 (en) * 2017-07-09 2020-08-13 Igc Bio, Inc. Pross optimized enzymes
CN111549018A (en) * 2020-04-27 2020-08-18 青岛尚德生物技术有限公司 Protease mutant with improved thermal stability and coding gene and application thereof
CN112574978A (en) * 2021-01-19 2021-03-30 青岛尚德生物技术有限公司 Protease mutant capable of improving alcohol-soluble protein degradation capacity and coding gene and application thereof
WO2022090293A1 (en) * 2020-10-27 2022-05-05 Carbios Novel esterases and uses thereof

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002002726A1 (en) * 2000-06-30 2002-01-10 The Procter & Gamble Company Detergent compositions comprising a maltogenic alpha-amylase enzyme
WO2002002725A1 (en) * 2000-06-30 2002-01-10 The Procter & Gamble Company Detergent compositions comprising a cyclodextrin glucanotransferase enzyme
CN101575635A (en) * 2002-02-26 2009-11-11 金克克国际有限公司 Subtilisin carlsberg proteins with reduced immunogenicity
US8535927B1 (en) * 2003-11-19 2013-09-17 Danisco Us Inc. Micrococcineae serine protease polypeptides and compositions thereof
CN103421760A (en) * 2003-11-19 2013-12-04 金克克国际有限公司 Serine proteases, nucleic acids encoding serine enzymes and vectors and host cells incorporating same
CN101528920A (en) * 2006-10-19 2009-09-09 丹尼斯科美国公司 Multiple mutation variants of serine protease
CN107075491A (en) * 2014-10-28 2017-08-18 谷万达公司 Method and composition for stablizing the protease that the intein of trans-splicing is modified
US20200255813A1 (en) * 2017-07-09 2020-08-13 Igc Bio, Inc. Pross optimized enzymes
CN109055288A (en) * 2018-06-30 2018-12-21 浙江工业大学 A kind of recombined bacillus subtilis and its application
CN111549018A (en) * 2020-04-27 2020-08-18 青岛尚德生物技术有限公司 Protease mutant with improved thermal stability and coding gene and application thereof
WO2022090293A1 (en) * 2020-10-27 2022-05-05 Carbios Novel esterases and uses thereof
CN112574978A (en) * 2021-01-19 2021-03-30 青岛尚德生物技术有限公司 Protease mutant capable of improving alcohol-soluble protein degradation capacity and coding gene and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KHAWAR SOHAIL SIDDIQUI: "Some like it hot, some like it cold: Temperature dependent biotechnological applications and improvements in extremophilic enzymes", BIOTECHNOLOGY ADVANCES, vol. 33, pages 1912 - 1922, XP029328727, DOI: 10.1016/j.biotechadv.2015.11.001 *
RAMNANI , P. 等: "keratinase [Bacillus licheniformis]", GENEBANK DATABASE, pages 86761 *
肖 志壮等: "蛋白质定向进化的研究进展", 生物工程进展, vol. 21, no. 6, pages 31 - 33 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
CN114774396A (en) * 2022-06-20 2022-07-22 山东龙昌动物保健品有限公司 Keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additive
CN114774396B (en) * 2022-06-20 2022-08-30 山东龙昌动物保健品有限公司 Keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additive

Also Published As

Publication number Publication date
CN114107266B (en) 2023-11-14

Similar Documents

Publication Publication Date Title
CN111549018B (en) Protease mutant with improved thermal stability as well as coding gene and application thereof
CN114107266B (en) Protease mutant with improved heat resistance, encoding gene and application thereof
CN112574978B (en) Protease mutant capable of improving alcohol-soluble protein degradation capacity and coding gene and application thereof
WO2022134236A1 (en) Alkaline protease mutant, gene thereof, engineering bacteria thereof, preparation method therefor and use thereof
CN114480352B (en) Alkaline protease mutant and application thereof
CN110982807B (en) High-efficiency stable cellulase mutant
CN112662653B (en) Keratinase mutant with improved low-temperature enzymolysis performance and application thereof
ES2606536T3 (en) New gene products of Bacillus licheniformis that form or break down polyamino acids and improved biotechnological production process based on them
CN112458072B (en) Alkaline protease mutant and preparation thereof
CN108004220B (en) Alkaline protease BmP mutant for improving thermal stability and gene and application thereof
CN110042092B (en) Xylanase mutant with improved stability and coding gene and application thereof
CN107400666A (en) A kind of aminopeptidase and its encoding gene and application
CN113462678B (en) Glutamic acid decarboxylase mutant
CN111944790B (en) Neutral protease gene, neutral protease, preparation method and application thereof
CN113046337B (en) Pantolactone hydrolase mutant strain and application thereof
CN113699138A (en) Alkaline protease gene, hybrid promoter, recombinant expression vector, recombinant expression engineering bacterium, alkaline protease, method and application
CN115960873A (en) Protein glutaminase and application thereof
CN116790564A (en) Heat-resistant protease mutant and encoding gene and application thereof
CN112852788B (en) Subtilisin E mutant with improved alkaline substrate selectivity and application thereof
KR102026836B1 (en) Novel lipase gene Lip-1420 derived from soil metagenome and use thereof
CN109022471B (en) Escherichia coli expression system for producing oxalate oxidase, and production method and application of oxalate oxidase
CN113321718A (en) Insect CPCFC family epidermal protein, coding nucleotide sequence and application thereof
CN117904082A (en) Protease with improved acid resistance, mutant and application thereof
CN110862952A (en) 5-aminolevulinic acid production strain and construction method and application thereof
CN110157691A (en) 5-aminolevulinate synthetase mutant and its host cell and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant