CN103589693B

CN103589693B - A kind of expression IBDV VP2 and bursa of Fabricius bursin chimeric protein recombinant herpesvirus of turkeys

Info

Publication number: CN103589693B
Application number: CN201310566984.5A
Authority: CN
Inventors: 潘群兴; 王永山; 欧阳伟; 王晓丽; 毕振威; 夏兴霞; 诸玉梅; 董晨红; 何孔旺; 肖琦
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2013-11-13
Filing date: 2013-11-13
Publication date: 2016-02-03
Anticipated expiration: 2033-11-13
Also published as: CN103589693A

Abstract

Do you the present invention relates to a kind of expression IBDV? VP2 and bursa of Fabricius bursin chimeric protein recombinant herpesvirus of turkeys, belong to genetically engineered and biological products research field.By the chimeric IBDV of 10 copy bursa of Fabricius bursin (BS10)? VP2 expression casette and herpes turkey virus (HVT) combine, obtain a kind of brand-new recombinant herpesvirus of turkeys (rHVT-BS10-VP2), this virus is also the bigeminy recombiant vaccine of a kind of Marek and infectious bursal disease simultaneously.Bigeminy recombiant vaccine of the present invention; not only can play good immanoprotection action to chicken MD; and the prolonged protective immune of anti-ibd V can be induced in the commercialization chicken group with high IBDV maternal antibody level; compared with existing chicken infectivity bursa of Fabricius virus herpes turkey virus carrier live (vHVT-013-69 strain), the protection ratio (100%) of rHVT-BS10-VP2 immune group is higher than the protection ratio (93.3%) of rHVT-VP2 immune group.

Description

A kind of expression IBDV VP2 and bursa of Fabricius bursin chimeric protein recombinant herpesvirus of turkeys

one, technical field

The invention belongs to genetically engineered and biological products research field.Be specifically related to a kind of recombinant herpesvirus of turkeys of expressing IBDVVP2 and bursa of Fabricius bursin chimeric protein.

two, background technology

Chicken Marek's disease (Marek ' sdisease, MD) and infectious bursal disease (Infectiousbursal

Disease, IBD) be two kinds and affect the modal immunosuppressive disease of poultry production.Wherein IBD is caused by infections chicken cloacal bursa virus (Infectiousbursaldiseasevirus, IBDV), acute, the high degree in contact sexually transmitted disease of main harm young chicken in 3 weeks ages ~ 12 week age.The appearance of variant and highly virulent strain (vvIBDV) makes the prevention and control difficulty of this disease strengthen, and IBD immunoprophylaxis failure has become the major issue in poultry diease prevention and control.

Current commercial infectious bursal disease malicious vaccine alive is divided into weak poison, poisoning and strong malicious three classes.Attenuated live vaccines

To SPF chicken safety, but very poor to there being the immune protective efficiency of maternal antibody chicken group.The immunoprotection of mesogenic and strong malicious vaccine

Although power wants high a lot, damage the fabricius bursa owing to having certain virulence.Meanwhile, due to interference and the IBDV of maternal antibody, traditional vaccine can form the inevitable Blank immunization phase in actual applications.Therefore, in current I BD prevention and control real work, urgent need immune efficacy is strong, the high novel IBD vaccine of biological safety.

MD is the chicken lymphoproliferative disease caused by marek's disease virus (Marek ' sdiseasevirus, MDV), and with the lymphoid cell infiltration of peripheral nerve, iris, skin, muscle and internal organs, hyperplasia and tumour are formed as feature.MDV vaccine strain can be used as live vector and carrys out expression alien gene, shows its molecular biological research, and MDV genome is comparatively large, and has determined virus replication nonessential region, many places, itself is excellent virus expression carrier.Compared to other virus vector, MDV has unique advantage as carrier, and MDV is strict Cell binding type, can break through the interference of maternal antibody, is applicable to early immune, by embryo immunization, and more convenient operation.Further, primary immune response can bring out lifelong cell and humoral immunoresponse(HI), cost-saving.Based on above feature, be that the living vaccine research that carrier carries out gains great popularity with MDV, and herpes turkey virus (HVT) is a kind of α simplexvirus wherein, because of itself and MDV antigen dependency, simultaneously again because HVT and MDV has obviously difference to chicken no pathogenicity, be widely used as the living vaccine preventing Marek (MD).

The fabricius bursa (BF) is the distinctive immune organ of bird, for B cell growth, maturation provides microenvironment, is Ig gene conversion place; Its immunologic active material is Bursin (Bursin, BS), and it can induce poultry and the differentiation of Mammals B cell precursor; Its target organ is BF, can antagonism IBD vaccine to the damage of BF, improve ND attenuated vaccine and oil seepage and produce antibody horizontal.Therefore the efficient living vaccine research how can carrying out infectious bursal disease (IBD) with herpes turkey virus (HVT) for carrier becomes a difficult problem of urgently capturing.

three, summary of the invention

technical problem

The present inventor provides a kind of recombinant herpesvirus of turkeys (rHVT-BS10-VP2); not only can play good immanoprotection action to chicken MD, and there is the prolonged protective immune can inducing anti-ibd V in high IBDV maternal antibody horizontal commercialization chicken group.

technical scheme

Express a recombinant herpesvirus of turkeys rHVT-BS10-VP2 for IBDVVP2 and bursa of Fabricius bursin chimeric protein, it is characterized in that: its gene order being carried at the chimeric IBDVVP2 expression casette of 10 copy bursa of Fabricius bursin (BS10) under promoter sequence control is as shown in SEQIDNO.1.

Described expression IBDVVP2 and the recombinant herpesvirus of turkeys rHVT-BS10-VP2 of bursa of Fabricius bursin chimeric protein, its preparation method is as follows:

1) synthesis of 10 copy bursa of Fabricius bursin BS10 oligonucleotide: select the conventional codon of encodes lysine Lys, histidine and glycine Gly to be arranged in BS gene in order: 5'-AAGCATGGC-3 ', a continuous synthesis l0 BS, BS tandem gene strand and reverse complemental chain thereof, make its renaturation become double-strand by annealing;

2) containing the structure of the herpes turkey virus HVT transfer vector of IBDVVP2 and BS10 mosaic gene expression cassette: according to the gpt gene order design primer of registered GenBankNO.X00221.1, with e.colidH ₅α DNA is that template adopts PCR method amplification gpt gene, with it as external source screening-gene, be connected with the CMV promoter in plasmid pEGFP and poly (A) and build gpt expression cassette CMV-gpt-polyA, cut after sequence verification through enzyme, be inserted in the homology arm cloned plasmids pUAB containing US10, SORF3 both sides, herpes turkey virus HVT nonessential region gene, build the cloned plasmids pUAB-gpt with screening-gene expression cassette; Be inserted in pUAB-gpt by BS10-VP2 mosaic gene, obtain recombinant herpesvirus of turkeys transfer vector pUAB-gpt-BS10-VP2, size is 10100bp;

3) preparation of the recombinant herpesvirus of turkeys of chimeric protein is expressed: adopt liposome mediated-method, by recombinant transfer vector plasmid pUAB-gpt-BS10-VP2 and the primary chick embryo fibroblast CEF of HVT-FC126 pnca gene cotransfection, after Virus plaque to appear, utilize mycophenolic acid MPA to block nucleic acid metabolism approach, obtain the recombinant virus rHVT-BS10-VP2 of purifying through screening.

Described recombinant herpesvirus of turkeys rHVT-BS10-VP2, it induces the application of the protective immunity of anti-bird simplexvirus and infections chicken cloacal bursa virus in avian host, and it also can be used as vaccine strain application.

beneficial effect

1) position that the chimeric IBDVVP2 expression casette of 10 copy bursa of Fabricius bursin (BS10) inserts in HVT genome is positioned between the nonessential region US10 gene of HVTFC126 genome (ACCESSIONNO.NC_002641) and SORF3 gene, position is between the 138687bp-138826bp position of HVTFC126 genome (ACCESSIONNO.NC_002641) more specifically, obtain a kind of immunity enhancement type recombinant herpesvirus of turkeys rHVT-BS10-VP2, this virus is also the bigeminy vaccine of a kind of Marek and infectious bursal disease simultaneously, rHVT-BS10-VP2 not only can play good immanoprotection action to chicken MD, and there is the prolonged protective immune can inducing anti-ibd V in high IBDV maternal antibody horizontal commercialization chicken group, compared with existing chicken infectivity bursa of Fabricius virus herpes turkey virus carrier live (vHVT-013-69 strain), ((100%) is higher than the protection ratio (93.3%) of rHVT-VP2 immune group for the protection ratio of rHVT-BS10-VP2 immune group.

2) be that the rHVT-BS10-VP2 recombinant virus that screening-gene builds can express gpt with gpt, the external source that this enzyme utilizes external source xanthine to complete guanine remedies synthesis, thus copying of recombinant virus dna can normally be carried out, can be passed through several screening wild virus of taking turns all dead, and recombinant virus can obtain enrichment and purifying gradually.

four, accompanying drawing explanation

Fig. 1 is the DNA sequence pattern figure of rHVT-BS10-VP2 recombinant virus;

Fig. 2 HVT genome inserts BS10-VP2 schematic diagram;

The expression cassette Egpt(CMV-gpt-polyA of Fig. 3 riddled basins gpt) amplification electrophoresis schematic diagram;

Fig. 4 is BS10-VP2PCR amplification electrophoresis schematic diagram;

Fig. 5 is recombinant plasmid pUAB-gpt-BS10-VP2 building process schematic diagram.

five, embodiment

IBDV variant AH1 strain (see reference document: Wang Yongshan etc. cause the characterization of molecules of the infectivity bursa of Fabricius virus VP 2 gene of immuning failure in the recent period. and Chinese veterinary science, 2008, 38 (12): 1013-1019) VP2 gene line RT-PCR method to cause clone the IBDV variant (AH1) of immuning failure from December, 2007 in Anhui, this variant has the whole significant amino-acid residue of IBDV virulent strain, VP2 gene seven peptide motif is SWSASGS, 222, 253, 256, 279, 284, amino-acid residue on 294 and 299 is A respectively, Q, I, D, A, I and S, larger difference is had with the VP2 gene order of existing commercially available vaccine strain B87.Therefore, specific aim and practical significance are had more to the prevention and control of current I BDV.

experiment material

1.1 carriers, bacterial classification and main agentspMD18-Tsimplevector is purchased from precious biotechnology (Dalian) company limited; Expression plasmid Liu pEGFP-N1(containing green fluorescence protein gene is drizzly, Yang Decheng, Zhou Guohui etc., the structure of coexpression O type FMDV capsid protein and green fluorescent protein recombinant adenovirus, 2012(24) 83-86); E.coliDH5 α and E.coliDH10B(is purchased from precious biotechnology (Dalian) company limited).AxyPrep plasmid small scale purification test kit, DNA gel reclaim test kit purchased from Axygen, X-gal, IPTG, restriction endonuclease, T4DNALigase, ATP, dNTP and Taq DNA polymerase all purchased from precious biotechnology (Dalian) company limited; DMEM substratum is purchased from Invitrogen company; Pancreatin is purchased from Thermo company.

1.2SPF chicken embryo and virus9 ~ 10 age in days SPF chicken embryos, herpes turkey virus (Herpesvirusofturkey, HVT) Fc126 strain all purchased from nanjing Tianbang Bio-industry Co., Ltd.; The standard strain of infectious bursa of Fabricius virus BC6/85 is purchased from China Veterinary Drugs Supervisory Inst.;

2 experimental techniques

2.1 design of primers and synthesis

Devise following PCR primer (table 1) according to HVTFc126 strain full-length gene group sequence (AF291866) that GenBank delivers, gpt sequence (X00221.1) and pEGFP-C1 plasmid sequence, primer is synthesized by Invitrogen company.

The primer of table 1 recombinant virus transfer vector builds

the structure of 2.2 homology arm cloned plasmids pUAB

With HVTFc126 strain infector for chick embryo fibroblast (CEF) sick cell STb gene for template, respectively with A-F/A-R and B-F/B-R for primer amplification recombinant virus transfer vector left/right homology arm A/B, reclaim the PCR primer of left/right homology arm A/B, be cloned into pMD18-Tsimplevector, obtain positive colony plasmid pMD-A and pMD-B.PMD-A, EcoR I, ScaI and Xba I 3 restriction analysis pMD-B is analyzed, confirmation of checking order further with BamH I and EcoR I double digestion.Then, by pMD-A EcoR I and Xba I double digestion, pMD-B EcoR I, ScaI and Xba I 3 enzyme are cut, reclaim pMD-A carrier segments and B fragment, T4DNALigase connects, and transforms DH5 α competence bacterium, extracts recombinant plasmid, EcoR I and the qualification of Xba I double digestion, obtain the cloned plasmids pUAB containing HVT left/right homology arm A/B.

the amplification of gene and Egpt gene

Take gpt-F/gpt-R as primer, with E.coliDH5 α DNA for template, adopt PCR method amplification gpt gene, with it as external source screening-gene, be connected with the CMV promoter in plasmid pEGFP-N1 and poly (A) and build gpt expression cassette (CMV-gpt-polyA), after PCR sequence verification, be inserted in the homology arm cloned plasmids pUAB containing US10, SORF3 both sides, herpes turkey virus (HVT) nonessential region gene, build the cloned plasmids pUAB-gpt with screening-gene expression cassette.

the Design and synthesis of gene

The conventional codon of encodes lysine (Lys), Histidine (His) and glycine (Gly) is selected to be arranged in BS gene in order: 5'-AAGCATGGC-3 '.A continuous synthesis l0 BS (BS tandem gene strand (BS-F) and reverse complemental chain (BS-R) thereof, make its renaturation become double-strand by annealing, concrete sequence is as follows: BS-F:5-gtcgacatgaagcatggcaagcatggcaagcatggcaagcatggcaagc atggcaagcatggcaag-3 (SalI restriction enzyme site is added in front end); BS-R:5- ttgcaggttcgccatgcc-atg-ctt gccatgcttgccatgcttgccatg-ctt-gcc-atg-ctt-gcc-atg-3( black italicpart is primer I BDVVP2-F Primers complementary opposite sequence, and Overlap extension PCR method (SOE method) increases BS10-VP2 mosaic gene).

the structure of pUAB-gpt-BS10-VP2 is carried in recombinant herpesvirus of turkeys transfer

IBDVVP2 sequences Design (GenBankNO.AF362747) according to registration designs primer, the IBDVVP2 gene increasing complete from AH1 viral RNA by RT-PCR method.Primer sequence is as follows: VP2-F:5- atg-gcg – aac-ctg-caa -gat – caa-ac-3; VP2-R:5-ggg-aag-ctt-cta-cta-cct-cct-tat-ggc-ccg-gat-tat-gtc-ttt-g-3 (HindIII restriction enzyme site is added in front end).Adopt Overlap extension PCR method (SOE method), with BS10 and VP2 for template, BS-F and VP2 – R is primer amplification BS10-VP2 mosaic gene .be inserted in pUAB-gpt by BS10-VP2 mosaic gene, obtain recombinant herpesvirus of turkeys transfer and carry pUAB-gpt-BS10-VP2, size is 10100bp.

the acquisition of recombinant virus

Adopt liposome Lipofectamine2000 mediated method, by recombinant transfer vector plasmid pUAB-gpt-BS10-VP2 and the primary chick embryo fibroblast of HVT-FC126 pnca gene cotransfection (CEF), when cytopathy reaches about 70%, pass on the individual layer CEF of fresh preparation, nutrient solution changed pressurization screening and culturing liquid into (containing 2% serum, 1%S/P before 1 hour, 300ug/mL mycophenolic acid, 60ug/mL xanthine and the hypoxanthic DMEM of 100ug/mL), every 24h changes the screening and culturing liquid that once pressurizes.Pass to when sick cell reaches about 70% on the individual layer CEF of another fresh preparation, take turns through 6 the recombinant virus rHVT-BS10-VP2 that pressurization screening obtains purifying.

the qualification of recombinant virus rHVT-BS10-VP2

2.7.1PCR qualification

At the both sides of BS10-VP2 expression cassette design primer, primer sequence is as follows: rHVT-F:5-atg-aag-cat-ggc-aag-cat – ggc-3; RHVT-R:5-cta-cta-cct-cct-tat-ggc-3.With the rHVT-BS10-VP2 of above-mentioned acquisition for template utilizes this primer to increase, the specific fragment of 1458bp can be amplified, through sequence verification, the fragment of this 1458bp is IBDV-VP2 expression cassette sequence, successfully inserts BS10-VP2 mosaic gene expression cassette in the recombinant virus rHVT-BS10-VP2 of known acquisition;

2.7.2 indirect immunofluorescence assay (IFA) detects

The rHVT-BS10-VP2 of 100PFU virus quantity is inoculated on 6 porocyte culture plates.After there is obvious plaque in cultivation 4d, growth media is outwelled, acetone with cold: 10min fixed by ethanol (3: 2) stationary liquid, PBS washes 1 time, 0.5mL (1: 100 dilution) IBDV-VP2 monoclonal antibody is added in each hole, be positioned in 37 DEG C of constant incubators and react 1h, 3 times are cleaned with PBS, every hole adds that 0.5mLFITC marks against murine IgG fluorescence antibody, be positioned in 37 DEG C of constant temperature biochemical cultivation cases and react 1h, 3 times are washed with PBS, observe under inverted fluorescence microscope, rHVT-BS10-VP2 infects hole and has occurred specificity green fluorescence, and HVT infects control wells unstressed configuration, show the correction that BS10-VP2 gene can be good.

recombinant virus rHVT-BS10-VP2 is applied to containing the immunization experiment in the commercial chicken of maternal antibody

120 1 age in days commercial chickens, are divided into 4 groups at random, detect its maternal antibody for positive by ELISA method.The

One group of inoculation rHVT-BS10-VP2, immunizing dose is 2500PFU/.Second group of inoculation rHVT-VP2 (chicken infectivity bursa of Fabricius virus herpes turkey virus carrier live vHVT-013-69 strain, purchased from Cimmeria animal health company limited), immunizing dose is for being 2500PFU/.3rd group is nonimmunely attack malicious group, and the 4th group is nonimmunely non-ly attack malicious group.35 ages in days carry out IBDVBC6/85 strong virus attack, and after attacking, 5d cuts open and kills, and carry out naked eyes pathological observation and get immune maincenter organ fabricius bursa tissue 10% formaldehyde fixing to make pathological study.Immune effect is in table 1, and known containing in the commercial chicken of maternal antibody by table 1 content, the protection ratio of rHVT-BS10-VP2 immune group reaches 100%, higher than the protection ratio (93.3%) of rHVT-VP2 immune group

Immunity recombinant virus	Attack poison strain	Lethality rate	The fabricius bursa damages
				rHVT-VP2	BC6/85	0/30	2/30(6.7%)
rHVT-BS10-VP2	BC6/85	0/30	0/30（0%）
				-	BC6/85	7/30(23%)	30/30(100%)
-	-		0/30(0%)

SEQUENCELISTING

<110> Jiangsu Province Agriculture Science Institute

<120> expresses IBDVVP2 and bursa of Fabricius bursin chimeric protein recombinant herpesvirus of turkeys

<130>0

<160>13

<170>PatentInversion3.1

<210>1

<211>1458

<212>DNA

<213> is artificial

<220>

The DNA sequence dna of <221>rHVT-BS10-VP2 recombinant virus

<222>(1)..(1458)

<223>

<400>1

atgaagcatggcaagcatggcaagcatggcaagcatggcaagcatggcaagcatggcaag60

catggcaagcatggcaagcatggcaagcatggcatggcgaacctgcaagatcaaacccaa120

cagattgttccgttcatacggagccttctgatgccaacaaccggaccggcgtccattccg180

gacgacaccctagagaagcacactctcaggtcagagacctcgacctacaatttgactgtg240

ggggacacagggtcagggctaattgtctttttccctggtttccctggctcaattgtgggt300

gctcactacacactgcagagcaatgggaactacaagttcgatcagatgctcctgactgcc360

cagaacctaccggccagctacaactactgcaggctagtgagtcggagtctcacagtgagg420

tcaagcacactccctggtggcgtttatgcactaaatggcaccataaacgccgtgaccttc480

cgaggaagcctgagtgaactgacagatgttagctacaatgggttgatgtctgcaacagcc540

aacatcaacgacaaaatcaggaacgtcctagtgggggaaggggtgaccgtcctcagctta600

cccacatcatatgatcttgggtatgtgagactcggtgaccccattcccgctatagggctc660

gacccaaaaatggtagcaacatgtgacagcagtgacaggcccagagtctacaccataact720

gcagccgatgattaccaattctcatcacagtaccaagcaggtggggtaacaatcacactg780

ttctcagctaatatcgatgccatcacaagcctcagcatcgggggagaactcgtgtttcaa840

acaagcgtccaaggcctcatactgggtgctaccatctaccttataggctttgatgggact900

gcggtaatcacccgagctgtggccgcagacaatgggctaacggccggcactgacaacctt960

atgccattcaacattgtgattccaaccagcgagataacccagccaatcacatccatcaaa1020

ctggagatagtgacctccaaaagtggtggccaggcgggggatcagatgtcatggtcagca1080

agtgggagcctagcagtgacgatccacggtggcaactatccaggggccctccgtcccgtc1140

acactagtagcctacgaaagagtggcaacagggtctgtcgttacggtcgccggggtaagc1200

aacttcgagctgatcccaaatcctgaactagcaaagaacctggtcacagaatacggccga1260

tttgacccaggggccatgaactacacaaaattgatactgagtgagagggaccgtcttggc1320

atcaagaccgtatggccaacaagggagtacactgactttcgcgagtacttcatggaggtg1380

gccgacctcaactctcccctgaagattgcaggagcatttggcttcaaagacataatccgg1440

gccataaggaggtagtag1458

<210>2

<211>28

<212>DNA

<213> is artificial

<220>

<221>A-F

<222>(1)..(28)

<223>

<400>2

cgggatccacatcgggccacgttccgcc28

<210>3

<211>42

<212>DNA

<213> is artificial

<220>

<221>A-R

<222>(1)..(42)

<223>

<400>3

gctctagagcgtcgaccggaattcgatgagctgacgtgtgga42

<210>4

<211>41

<212>DNA

<213> is artificial

<220>

<221>B-F

<222>(1)..(41)

<223>

<400>4

ggaattcaagtcgacggaagcttccactaatatgggcacac41

<210>5

<211>28

<212>DNA

<213> people

<220>

<221>B-R

<222>(1)..(28)

<223>

<400>5

gctctagatggcccatctaggtgattat28

<210>6

<211>30

<212>DNA

<213> people

<220>

<221>gpt-F

<222>(1)..(30)

<223>

<400>6

gcgctagcgtcatgagcgaaaaatacatcg30

<210>7

<211>29

<212>DNA

<213> people

<220>

<221>gpt-R

<222>(1)..(29)

<223>

<400>7

actggatccttagcgaccggagattggcg29

<210>8

<211>39

<212>DNA

<213> people

<220>

<221>Egpt-F

<222>(1)..(39)

<223>

<400>8

gcgaattctattaatagtaatcaattacggggtcattag39

<210>9

<211>36

<212>DNA

<213> people

<220>

<221>Egpt-R

<222>(1)..(36)

<223>

<400>9

gcgtcgaccgcgttaagatacattgatgagtttgga36

<210>10

<211>66

<212>DNA

<213> people

<220>

<221>BS-F

<222>(1)..(66)

<223>

<400>10

gtcgacatgaagcatggcaagcatggcaagcatggcaagcatggcaagcatggcaagcat60

ggcaag66

<210>11

<211>66

<212>DNA

<213> people

<220>

<221>BS-R

<222>(1)..(66)

<223>

<400>11

ttgcaggttcgccatgccatgcttgccatgcttgccatgcttgccatgcttgccatgctt60

gccatg66

<210>12

<211>23

<212>DNA

<213> people

<220>

<221>VP2-F

<222>(1)..(23)

<223>

<400>12

atggcgaacctgcaagatcaaac23

<210>13

<211>43

<212>DNA

<213> people

<220>

<221>VP2-R

<222>(1)..(43)

<223>

<400>13

gggaagcttctactacctccttatggcccggattatgtctttg43

Claims

1. express a recombinant herpesvirus of turkeys rHVT-BS10-VP2 for IBDVVP2 and bursa of Fabricius bursin chimeric protein, it is characterized in that: its 10 copy bursa of Fabricius bursin BS10 be carried under promoter sequence control are fitted together to the gene order of IBDVVP2 expression casette as shown in SEQIDNO.1.

2. the recombinant herpesvirus of turkeys rHVT-BS10-VP2 of expression IBDVVP2 according to claim 1 and bursa of Fabricius bursin chimeric protein, its preparation method is as follows:

3. the recombinant herpesvirus of turkeys rHVT-BS10-VP2 described in claim 1 or 2 is preparing in avian host the application in the protective immunity preparation of inducing anti-bird simplexvirus and infections chicken cloacal bursa virus.

4. the recombinant herpesvirus of turkeys rHVT-BS10-VP2 described in claim 1 or 2 is preparing the application in vaccine.

5. recombinant herpesvirus of turkeys rHVT-BS10-VP2 according to claim 3 is preparing the application in vaccine.