CN110117608A

CN110117608A - Application of the endogenous Rv2823c coding albumen in tubercle bacillus gene insertion, knockout, interference and mutant library screening

Info

Publication number: CN110117608A
Application number: CN201910229594.6A
Authority: CN
Inventors: 曹罡; 陈西; 穆罕默德·贾迈勒; 凯斯塔·拉赫曼; 徐伟泽; 周伟; 杨冰; 雷莹莹; 曹晓建; 林达; 傅振芳
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2019-03-25
Filing date: 2019-03-25
Publication date: 2019-08-13

Abstract

Field the present invention relates to prokaryotes endogenous gene as application tool, more particularly to a kind of application of endogenous Rv2823c coding albumen in tubercle bacillus gene insertion, knockout, interference and mutant library screening, wherein, the amino acid sequence of endogenous Rv2823c coding albumen is as shown in SEQ ID No.1；The nucleotide sequence of endogenous Rv2823c gene is as shown in SEQ ID No.2.The present invention, which imports the plasmid pMV-gRNA-HDR built in tubercle bacillus, can be realized insertion, knockout or the interference of gene and the screening of mutant library.Compared with bacteriophage or swivel base submethod, the interference of growth indispensable gene is more optimizedly may be implemented in editor while this method can fast implement single or multiple gene.

Description

Endogenous Rv2823c coding albumen is in tubercle bacillus gene insertion, knockout, interference and dashes forward Application in Mutant libraries screening

Technical field

Field the present invention relates to prokaryotes endogenous gene as application tool, and in particular to a kind of endogenous Rv2823c encodes application of the albumen in tubercle bacillus gene insertion, knockout, interference and mutant library screening.

Background technique

According to the latest report of the World Health Organization (World Health Organization, WHO), by tubercle bacillus Tuberculosis caused by (Mycobacterium tuberculosis, abbreviation Mtb) infects is one of big cause of the death in the whole world ten, Newly-increased 1,040,000 people of tuberculosis patient in the whole world in 2016,140,000 people die of the disease.Tuberculosis death more than 95% occurs low Income and middle income country, China are also one of pathogenetic major country of tuberculosis.Due to the unreasonable use of antibiotic Etc. reasons, cause the appearance of multi-drug resistant and extensive drug resistance tubercle bacillus bacterial strain, this brings great challenge for the prevention and treatment of the disease. Termination strategy lungy has been issued in the whole world, but BCG vaccine used at present becomes increasingly preventive effect lungy It is unobvious, therefore there is an urgent need to develop novel attenuated vaccines.Parsing to tubercle bacillus gene function and its pathogenic molecular mechanism It is most important to excavation newtype drug target spot and Vaccine candidate gene.

It is had disadvantages that however, currently used Phage Infection method knocks out tubercle bacillus virulence gene tool, such as efficiency It is low, the period is long, some growths must the knockout of gene cannot achieve, need novel genetic manipulation tool to carry out tuberculosis point The knockout and silencing of branch bacillus virulence gene.

Summary of the invention

It is an object of the invention to overcome the deficiencies of the prior art and provide a kind of endogenous Rv2823c coding albumen to tie The application in gene insertion, knockout, interference and growth indispensable gene mutant library screening is carried out in core bacillus.The present invention Analysis finds that the protein of Rv2823c coding has the function of genetic modification, which, which plays a role, only needs to provide guidance Sequence can realize that insertion, knockout, interference and the screening in gene mutation body library of gene (only need to import gRNA Realize the editor of gene).This method is inserted into inactivation technique, and the party much higher than traditional transposons to the editorial efficiency of gene Method can also realize the purpose for killing bacterium, bring hope for the research and development of tuberculosis novel method for the treatment of.Endogenous nucleic acid has Very high transformation efficiency and genetic modification efficiency.

To achieve the above object, a kind of endogenous Rv2823c coding albumen designed by the present invention carries out base in tubercle bacillus Because of the application in insertion, knockout or interference and growth indispensable gene mutant library screening, wherein endogenous Rv2823c coding The amino acid sequence of albumen is as shown in SEQ ID No.1；The nucleotide sequence of endogenous Rv2823c gene such as SEQ ID No.2 institute Show.

Further, the insertion, the gene for knocking out or interfering are any one or more in the genome of tubercle bacillus Gene.

Still further, the gene is growth indispensable gene.The tubercle bacillus is tubercle bacillus H37Rv, gene All sequences, which disclose in NCBI, in group sees NCBI tubercle bacillus gene (https: //www.ncbi.nlm.nih.gov/ Genome/166? genome_assembly_id=159 857).

The present invention also provides a kind of suitable for gene insertion, the recombinant plasmid of knockout or interference editting function, the matter Intragranular contains the boot sequence of more than one and tubercle bacillus target gene interaction_x, x 1,2,3,4 ...；Wherein, boot sequence_x For the nucleotide sequence for arbitrarily choosing 40bp in target-gene sequence.

The recombinant plasmid library that the present invention also provides a kind of suitable for growing the screening of indispensable gene mutant library, institute State N number of plasmid in plasmid library, the boot sequence containing 5658 with tubercle bacillus target gene interaction in all plasmids_x, x is 1,2,3,4……；Wherein, boot sequence is the nucleotide sequence of any 40bp on target gene coding strand.

Suitable for autogene insertion, the building method for the recombinant plasmid for knocking out or interfering editting function, feature exists In: the following steps are included:

1) repetitive sequence is designed, wherein repetitive sequence repeat is tcgtcagacccaaaaccccgagaggggacgg Aaac,

2) complex sequences repeat is aggravated at the both ends restriction enzyme site BbsI, synthesis obtains sequence repeat-BbsI-repeat；

3) repeat-BbsI-repeat is inserted into plasmid pMV-261 using the strategy of homologous recombination, that is, forms pMV- 261-crRNA (Fig. 1)；

4) using the DNA sequence dna of any one gene in tubercle bacillus gene group as template, select length for 40bp's respectively Boot sequence x；

5) single-stranded boot sequence is made to become double-strand by Gradient annealing,

6) it will be inserted into pMV261 plasmid after the BbsI digestion of double-strand boot sequence, obtain pMV261-gRNA；

It 7) is stencil design upstream and downstream homology arm according to target gene upstream and downstream gene, for the ease of screening, specificity insertion EGFP obtains upstream homology arm -- the downstream EGFP-- homology arm sequence (HDR)；Sequence HDR is by the terminator of upstream homology arm It is removed with the promoter of EGFP, becomes an ORF；

8) pMV261-gRNA is subjected to digestion with PstI, then connected, form pMV-gRNA-HDR；

9) above-mentioned connection product is converted into stable3 infection state cell, extracts plasmid pMV-gRNA-HDR, then Sequencing identification；Obtain recombinant plasmid pMV-gRNA-HDR.

It is answered in building insertion, the bacterial strain for knocking out or interfering editor's gene using above-mentioned recombinant plasmid pMV-gRNA-HDR With.

It must be sieved with dispensable gene mutant library using above-mentioned recombinant plasmid library suitable for growth of bacillus tubercle Choose application.

Beneficial effects of the present invention:

The plasmid pMV-gRNA-HDR that the present invention only needs to build, which is imported, can be realized inserting for gene in tubercle bacillus Enter, knock out or interfere and the screening of mutant library.Compared with bacteriophage or swivel base submethod, this method can be quick The interference of growth indispensable gene more optimizedly may be implemented in editor while realizing single or multiple gene.

Detailed description of the invention

Fig. 1 is pMV261-crRNA map；

Fig. 2 is relative position of two Repeats and BbsI in plasmid；

Fig. 3 is the fluorescence microscope detection, PCR detection and sequencing result of gene insertion；

Fig. 4 is the fluorescence microscope detection, PCR detection and sequencing result of gene delection；

Fig. 5 is the qPCR verification result of polygenes RNA interference；

Fig. 6 is mutant library the selection result.

Specific embodiment

The present invention is described in further detail combined with specific embodiments below, so as to those skilled in the art understand that.

Embodiment 1 realizes the insertion (gyrA gene) of tubercle bacillus gene using endogenous Rv2823c coding albumen

1. being suitable for the building method of the plasmid of autogene insertion, comprising the following steps:

1) according to the DNA sequence dna of gyrA gene (see NCBI tubercle bacillus gene https: // Www.ncbi.nlm.nih.gov/gene/887105), the gene order of 40bp: (GTCTGGTCTGCGCCGTTGGCG is selected TCCACGGCATTATCGTCGC), as spacer.

2) according to existing document report, the repeat sequence (gtcgtcagacccaaaaccccgagag of 36bp is selected Gggacggaaac it), and among two repeats is inserted into a BbsI restriction enzyme site (repeat-BbsI-repeat), it will The sequence is sent to Nanjing Genscript Biotechnology Co., Ltd.'s synthesis.

Relative position of two Repeats and BbsI in plasmid as shown in Fig. 2,

3) to carry out digestion actual conditions to plasmid with BbsI as follows:

Reaction system

37 DEG C of effect 2h.

4) single-stranded gRNA is made to become double-strand by Gradient annealing, actual conditions are as follows:

Reaction system

37 DEG C of 30min, 95 DEG C of 5min, then by the gradient cooling of 5 DEG C/min to 25 DEG C.Finally by double-strand oligo 200 times of dilution for connecting reaction.

Double-strand gRNA is such as

5) gRNA is inserted into pMV261 plasmid, actual conditions are as follows:

Linked system

16 DEG C of incubation 1-2h.

6) in order to be inserted into EGFP, therefore upstream and downstream homology arm (upstream homology arm -- the downstream EGFP-- of 400bp is devised Homology arm).Meanwhile removing the promoter of the terminator of upstream homology arm and EGFP, become an ORF.

7) above-mentioned connection product is converted into stable3 infection state cell, extracts plasmid (pMV-gRNA-gyrA- EGFP), then sequencing identification.

2. utilizing the screening of plasmid pMV-gRNA-gyrA-EGFP gene insertion tubercle bacillus strain

1) 0.5 μ g is taken to identify the tubercle bacillus H37Ra of correct recombinant plasmid pMV-gRNA-gyrA-EGFP and 200 μ l Competent cell ice bath 10min.

2) competent cell containing recombinant plasmid is transferred in 0.2 centimetre of sterile electric revolving cup.

3) electroporation GenePulser Xcell (BIO-RAD) parameter is set as 2.5kV, 25 μ F, 1000 Ω.

4) when hearing a sound of " drop ", illustrate that electricity changes into function, be immediately transferred to the competent cell after electric shock newly Sterile EP tube.

5) the 7H9 culture medium containing 10%OADC, 0.02%Tween 80 and 0.5% glycerol of addition 1ml preheating is to the electricity In revolving cup.

6) for 24 hours by the cell incubation in step 5.

7) the cell 3000rpm in step 6 is centrifuged 10min, inhales and abandons supernatant.

8) bacterial sediment is resuspended with 100 μ l fresh cultures, and is coated with the 7H10 plate for containing kanamycins (50 μ g/ μ l) It is grown to single colonie.

9) Olympus IX73 fluorescence microscope is observed.

As shown in Fig. 2, having converted the bacterium colony of the plasmid containing gRNA under fluorescence microscope it can be seen that apparent green is glimmering Light, and control plasmid then can't see green fluorescence, illustrate that EGFP is successfully plugged into bacterial genomes.

3. being sequenced and analyzing

1) the positive bacterium solution of identification is taken into 10 μ l, and boils 5min, to crack bacterium.

2) 1 μ l sample is taken to carry out PCR amplification as template.It is specific as follows:

Reaction system

Reaction condition

Primer information

3) PCR product of 5 μ l is taken to carry out agarose gel electrophoresis.Fluorescent positive clone detects 1.8kb's as the result is shown Band, and control group is then without corresponding band (Fig. 3 B).

4) taking the identification of 40 μ l previous steps, correctly positive PCR product send Wuhan Qing Ke biotechnology company to be sequenced, to slotting Enter gene to be verified.Egfp gene is inserted in the end of gyrA gene as the result is shown, illustrates that egfp gene is successfully plugged into In tubercle bacillus gene group (Fig. 3 C).

Embodiment 2 realizes that tubercle bacillus gene knocks out (by taking esxQ as an example) using endogenous Rv2823c coding albumen

1. being suitable for the building method for the recombinant plasmid that autogene knocks out, comprising the following steps:

1) according to the DNA sequence dna of esxQ gene (see NCBI tubercle bacillus gene https: // Www.ncbi.nlm.nih.gov/gene/888508), the gene order (CACCAGCCGGTCCGAAACGTCG of 40bp is selected GGTGATTGGTTGACGGCT), as spacer.

3) digestion is carried out to plasmid with BbsI, specific as follows:

Reaction system

37 DEG C of effect 2h.

Reaction system

5) gRNA is inserted into pMV261 plasmid, actual conditions are as follows:

Linked system

16 DEG C of incubation 1-2h.

6) for screening-gene knock-out bacterial strain, we replace target gene with BFP, therefore devise the upstream and downstream of 400bp Homology arm (upstream homology arm -- the downstream BFP-- homology arm).

7) above-mentioned connection product is converted into stable3 infection state cell, and carries out bacterium solution PCR identification.Specifically such as Under:

Reaction system

Primer is from plasmid backbone, for detecting HDR, to avoid the amplification gene from genome.Primer sequence is such as Under:

Reaction condition

8) it extracts PCR and identifies correct recombinant plasmid (pMV-gRNA-esxQ-BFP), further sequencing detection.

2. utilizing the screening of plasmid pMV-gRNA-esxQ-BFP gene knockout tubercle bacillus strain

Detailed in Example 1

3. being sequenced and analyzing

Reaction system

Reaction condition

Primer information

3) 50 μ l PCR products is taken to carry out agarose gel electrophoresis.Fluorescent positive clone detects 1.6kb's as the result is shown Band, and control group then detects the band (Fig. 4 B) of 1.4kb.

4) it send Wuhan Qing Ke biotechnology company to be sequenced after purification positive PCR product, is verified to gene is knocked out. Bfp gene replacement esxQ gene (Fig. 4 C) as the result is shown.

4.DNA library construction, sequencing and analysis

1) picking wild strain, mutant strain and plasmid control bacterial strain single bacterium fall in 7H9 culture medium and cultivate to OD_600nm It is 1.0.

2) 6000rpm is centrifuged 15min and collects bacterial sediment.

3) bacterial sediment is resuspended in the TE buffer of 1ml.

4) it adds the SDS (1%) of 1ml and is incubated for 10min.

5) 100 μ l Proteinase Ks, 55 DEG C of incubation 3h are added.

6) RNase (Roche, Mannheim, Germany) of 100 μ l DNase-free, 37 DEG C of overnight incubations are added.

7) it adds 1mL phenol/chloroform/isoamyl alcohol (25:24:1) and cracks bacterium, 13000rpm is centrifuged 15min.

8) step 7) is repeated three times.

9) supernatant is transferred in a new centrifuge tube.

10) the 3M sodium acetate (pH=5.2) of 0.1 times of volume is added.

11) 100% ethyl alcohol for adding proper volume becomes 80% ethyl alcohol.

12) 13000rpm centrifugation 15min, 4 DEG C.

13) 80% ethanol washing DNA is precipitated three times, each 30s.

14) DNA is resuspended without DNA enzymatic water, and measures its concentration.

15) library is constructed using Nextera Illumina kit.Fragmentation processing, 55 DEG C of works are carried out to DNA with Tn5 Use 30min.It is specific as follows:

16) DNA of fragmentation is attached in different connectors, joint information is as follows:

17) KAPA HiFi archaeal dna polymerase is expanded, specific as follows:

Reaction system

Reaction condition

18) Ampure XP beads is only praised using Nanjing promise to purify library.

19) HiSeq 2000paired-ended (2x 151bp) technology carries out deep sequencing.

20) sequencing result is shown, compared with wild strain, mutant strain has lacked esxQ gene, illustrates successful knockout esxQ Gene (Fig. 4 D and E).

Embodiment 3 realizes that polygenic interference (is with katG, inhA and lpqE gene using Rv2823c coding albumen Example)

1. being suitable for the building method of the recombinant plasmid of autogene interference, comprising the following steps:

1) according to katG, inhA and lpqE gene (see NCBI tubercle bacillus gene

https://www.ncbi.nlm.nih.gov/gene/885638；

https://www.ncbi.nlm.nih.gov/gene/886523；

Https: //www.ncbi.nlm.nih.gov/gene/887254) non-coding sequence finds motif (5 '- GAAAC-3 '), the gene order of motif downstream 40bp, as guide sequence (spacer).

gatG:TGTTGTCCCATTTCGTCGGGGTGTTCGTCCATACGACCTC inhA:

GCGATCGACGAGTCGGTGATGATTCCGCTAACCAGAATCC lpqE:

GTCGGGTGATTGGTTGACGGCTACCAGCACCAGATCCACC

2) repetitive sequence (repeats) that a upper 36bp is added at the both ends spacer, then by repeats- Spacer-repeats-spacer-repeats-spacer-repeats sends to Wuhan Qing Ke biotech company and is synthesized (lpqE-katG-ihnA-gRNA)。

3) digestion is carried out to pMV-261 plasmid with BbsI, specific as follows:

Reaction system

37 DEG C of effect 2h.

4) single-stranded lpqE-katG-ihnA-gRNA is made to become double-strand by Gradient annealing, actual conditions are as follows:

Reaction system

37 DEG C of 30min, 95 DEG C of 5min, then by the gradient cooling of 5 DEG C/min to 25 DEG C.Finally by double-strand oligo 200 times of dilution for connecting reaction.5) lpqE-katG-ihnA-gRNA is inserted into pMV261 plasmid, actual conditions are as follows:

Linked system

16 DEG C of incubation 1-2h.

Reaction system

Reaction condition

8) it extracts PCR and identifies correct recombinant plasmid (pMV-gRNA-katG), further sequencing detection.

Verifying of the 3.qPCR to related gene low expression

1) it chooses positive, plasmid control and wild-type bacterium single bacterium falls in 7H9 culture medium (10ml) and cultivates to OD_600nm It is 1.0.

2) 3000rpm is centrifuged 10min and collects bacterial sediment and freeze in -80 DEG C.

3) bacterial sediment is transferred in mortar, and adds appropriate liquid nitrogen, grind 2min to destroy cell wall.

4) bacterial chip is transferred in the EP pipe of no RNA enzyme and adds 1mlTrizol.

5) it adds in appropriate Lysing Matrix B (MP USA) to the pipe.

6) 6000rpm vortex 1min is further crushed bacterium.

7) 200 μ l chloroforms of addition into bacterial lysate and are vortexed 30 seconds.

8) 12000rpm takes the aqueous phase solution of 400 μ l into new EP pipe after being centrifuged 15min.

9) isopropanol and the mixing of 400 μ l are added, incubation at room temperature 10min precipitates RNA.

10) 13000rpm is centrifuged 30min.

11) 80% ethanol washing RNA precipitate of fresh configuration three times, 30 seconds every time.

12) 13000rpm, which is centrifuged to inhale as far as possible after 5min, abandons residual ethanol.

13) RNA is resuspended in 20 μ l nuclease-free waters after being air-dried 10min.

14) genomic DNA remaining with the removal of TURBO DNA-free kit.It is specific as follows:

Reaction system

It mixes gently, is incubated for 30min.Add the DNase Inactivation Reagent room temperature effect of 0.1 times of volume RNA is transferred in new EP pipe after 5min, 10000rpm centrifugation 1.5min.

16) after Nanodrop measures RNA concentration, adjustment RNA concentration is 100ngRNA

17) RNA is inverted to cDNA.It is specific as follows:

Reaction system

18) PerfeCTaSYBR green Supermix applied Biosystems 7300real time PCR is used System carries out relative quantification detection to katG, inhA and lpqE gene.It is specific as follows:

Reaction system

Reaction condition

Primer information

PMV-lpqE-katG-inhA-gRNA plasmid turns Gization C group GlpqE, katG and inhA expression quantity point as the result is shown Do not decline, and there is significant difference (Fig. 5) compared with the control group.

Embodiment 4 realizes the screening in gene mutation body library using Rv2823c coding albumen

The synthesis of 1.gRNA plasmid library

1) according to the sequence information of tubercle bacillus H37Rv genome (https: //www.ncbi.nlm.nih.gov/ Genome/166? genome_assembly_id=159 857), design is directed to the gRNA of 5658 tubercle bacillus genes and send It is synthesized toward company.Designed gRNA is inserted into pMV261-crRNA plasmid, to form plasmid library (method of pMV261-crRNA plasmid construction is shown in embodiment 1).

2. the screening of gene mutation body strain library

Detailed in Example 1

Target gene varies less after plasmid library expands in Escherichia coli as the result is shown, and after tubercle bacillus amplification Variation is then very big, illustrates that library can interfere with the growth indispensable gene (Fig. 6 A and B) of tubercle bacillus.Simultaneously it has also been found that with big Enterobacteria is compared, and library can influence the expression (Fig. 6 C and D) of some genes of tubercle bacillus.These differential genes are analyzed It was found that 208 belong to growth of bacillus tubercle auxiliary gene and 385 growth of bacillus tubercle indispensable genes (Fig. 6 E).At 208 80% gene has been confirmed in growth auxiliary gene, illustrates that this method can be used for the screening of mutant library.Preceding 15% belongs to oxin-antitoxin family, 35% belongs to the gene packet of pressure GAP-associated protein GAP, 10% in 20 growth related genes It is to assume albumen containing zone of ignorance, 15% and 25% is Unknown Function albumen (Fig. 6 F).208 growths of comparative analysis assist base Probiotics genome finds that these gene pairs probiotics have certain side effect, the thermodynamic chart of preceding 31 genes in cause and 43 It shows and the similitude of 43 kinds of probiotics (Fig. 6 G) to the greatest extent.

Other unspecified parts are the prior art.Although above-described embodiment is made that in detail the present invention Description, but it is only a part of the embodiment of the present invention, rather than whole embodiments, people can also exist according to the present embodiment Without other embodiments are obtained under the premise of creativeness, these embodiments belong to the scope of the present invention.

Sequence table

<110>Hua Zhong Agriculture University

<120>endogenous Rv2823c coding albumen is in tubercle bacillus gene insertion, knockout, interference and mutant library screening Using

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 809

<212> PRT

<213>tubercle bacillus H37Rv (Mycobacterium tuberculosis H37Rv)

<400> 1

Met Asn Pro Gln Leu Ile Glu Ala Ile Ile Gly Cys Leu Leu His Asp

1 5 10 15

Ile Gly Lys Pro Val Gln Arg Ala Ala Leu Gly Tyr Pro Gly Arg His

20 25 30

Ser Ala Ile Gly Arg Ala Phe Met Lys Lys Val Trp Leu Arg Asp Ser

35 40 45

Arg Asn Pro Ser Gln Phe Thr Asp Glu Val Asp Glu Ala Asp Ile Gly

50 55 60

Val Ser Asp Arg Arg Ile Leu Asp Ala Ile Ser Tyr His His Ser Ser

65 70 75 80

Ala Leu Arg Thr Ala Ala Glu Asn Gly Arg Leu Ala Ala Asp Ala Pro

85 90 95

Ala Tyr Ile Ala Tyr Asn Ile Ala Ala Gly Thr Asp Arg Arg Lys Ala

100 105 110

Asp Ser Asp Asp Gly His Gly Ala Ser Thr Trp Asp Pro Asp Thr Pro

115 120 125

Leu Tyr Ser Met Phe Asn Arg Phe Gly Ser Gly Thr Ala Asn Leu Ala

130 135 140

Phe Ala Pro Glu Met Leu Asp Asp Arg Lys Pro Ile Asn Ile Pro Ser

145 150 155 160

Pro Arg Arg Ile Glu Phe Asp Lys Asp Arg Tyr Ala Ala Ile Val Asn

165 170 175

Lys Leu Lys Ala Ile Leu Val Asp Leu Glu Arg Ser Asp Thr Tyr Leu

180 185 190

Ala Ser Leu Leu Asn Val Leu Glu Ala Thr Leu Ser Phe Val Pro Ser

195 200 205

Ser Thr Asp Ala Ser Glu Val Val Asp Val Ser Leu Phe Asp His Leu

210 215 220

Lys Leu Thr Gly Ala Leu Gly Ala Cys Ile Trp His Tyr Leu Gln Ala

225 230 235 240

Thr Gly Gln Ser Asp Phe Lys Ser Ala Leu Phe Asp Lys Gln Asp Thr

245 250 255

Phe Tyr Asn Glu Lys Ala Phe Leu Leu Thr Thr Phe Asp Val Ser Gly

260 265 270

Ile Gln Asp Phe Ile Tyr Thr Ile His Ser Ser Gly Ala Ala Lys Met

275 280 285

Leu Arg Ala Arg Ser Phe Tyr Leu Glu Met Leu Thr Glu His Leu Ile

290 295 300

Asp Glu Leu Leu Ala Arg Val Gly Leu Ser Arg Ala Asn Leu Asn Tyr

305 310 315 320

Ser Gly Gly Gly His Ala Tyr Leu Leu Leu Pro Asn Thr Glu Ser Ala

325 330 335

Arg Lys Ser Val Glu Gln Phe Glu Arg Glu Ala Asn Asp Trp Leu Leu

340 345 350

Glu Asn Phe Ala Thr Arg Leu Phe Ile Ala Thr Gly Ser Val Pro Leu

355 360 365

Ala Ala Asn Asp Leu Met Arg Arg Pro Asn Glu Ser Ala Ser Gln Ala

370 375 380

Ser Asn Arg Ala Leu Arg Tyr Ser Gly Leu Tyr Arg Glu Leu Ser Glu

385 390 395 400

Gln Leu Ser Ala Lys Lys Leu Ala Arg Tyr Ser Ala Asp Gln Leu Arg

405 410 415

Glu Leu Asn Ser Arg Asp His Asp Gly Gln Lys Gly Asp Arg Glu Cys

420 425 430

Ser Val Cys His Thr Val Asn Arg Thr Val Ser Ala Asp Asp Glu Pro

435 440 445

Lys Cys Ser Leu Cys Gln Ala Leu Thr Ala Ala Ser Ser Gln Ile Gln

450 455 460

Ser Glu Ser Arg Arg Phe Leu Leu Ile Ser Asp Gly Ala Thr Lys Gly

465 470 475 480

Leu Pro Leu Pro Phe Gly Ala Thr Leu Thr Phe Cys Ser Arg Ala Asp

485 490 495

Ala Asp Lys Ala Leu Gln Gln Pro Gln Thr Arg Arg Arg Tyr Ala Lys

500 505 510

Asn Lys Phe Phe Ala Gly Glu Cys Leu Gly Thr Gly Leu Trp Val Gly

515 520 525

Asp Tyr Val Ala Gln Met Glu Phe Gly Asp Tyr Val Lys Arg Ala Ser

530 535 540

Gly Ile Ala Arg Leu Gly Val Leu Arg Leu Asp Val Asp Asn Leu Gly

545 550 555 560

Gln Ala Phe Thr His Gly Phe Met Glu Gln Gly Asn Gly Lys Phe Asn

565 570 575

Thr Ile Ser Arg Thr Ala Ala Phe Ser Arg Met Leu Ser Leu Phe Phe

580 585 590

Arg Gln His Ile Asn Tyr Val Leu Ala Arg Pro Lys Leu Arg Pro Ile

595 600 605

Thr Gly Asp Asp Pro Ala Arg Pro Arg Glu Ala Thr Ile Ile Tyr Ser

610 615 620

Gly Gly Asp Asp Val Phe Val Val Gly Ala Trp Asp Asp Val Ile Glu

625 630 635 640

Phe Gly Ile Glu Leu Arg Glu Arg Phe His Glu Phe Thr Gln Gly Lys

645 650 655

Leu Thr Val Ser Ala Gly Ile Gly Met Phe Pro Asp Lys Tyr Pro Ile

660 665 670

Ser Val Met Ala Arg Glu Val Gly Asp Leu Glu Asp Ala Ala Lys Ser

675 680 685

Leu Pro Gly Lys Asn Gly Val Ala Leu Phe Asp Arg Glu Phe Thr Phe

690 695 700

Gly Trp Asp Glu Leu Leu Ser Lys Val Ile Glu Glu Lys Tyr Arg His

705 710 715 720

Ile Ala Asp Tyr Phe Ser Gly Asn Glu Glu Arg Gly Met Ala Phe Ile

725 730 735

Tyr Lys Leu Leu Glu Leu Leu Ala Glu Arg Asp Asp Arg Ile Thr Lys

740 745 750

Ala Arg Trp Val Tyr Phe Leu Thr Arg Met Arg Asn Pro Thr Gly Asp

755 760 765

Thr Ala Pro Phe Gln Gln Phe Ala Asn Arg Leu His Gln Trp Phe Gln

770 775 780

Asp Pro Thr Asp Ala Lys Gln Leu Lys Thr Ala Leu His Leu Tyr Ile

785 790 795 800

Tyr Arg Thr Arg Lys Glu Glu Ser Glu

805

<210> 2

<211> 2430

<212> DNA

<213>tubercle bacillus H37Rv (Mycobacterium tuberculosis H37Rv)

<400> 2

atgaacccgc aactcatcga ggccataatc ggctgcctct tgcacgacat tggcaaaccg 60

gtccagcgcg cggcgctcgg ctacccgggc aggcacagtg cgattggccg cgcttttatg 120

aagaaggtgt ggttgcgcga cagccgcaat ccgtcgcagt tcaccgacga ggtggatgag 180

gctgacattg gggtctccga ccgccgcatt ctcgacgcga tcagctatca ccacagttct 240

gcgctgcgta cggcggccga gaatggccgc cttgccgccg atgcgccggc ctacatcgcc 300

tacaatatcg cggccggaac cgaccgccgc aaggccgact ccgacgacgg ccatggtgcg 360

agcacttggg atccggacac gcccctgtat tcgatgttca accgattcgg ctccggcaca 420

gcgaatctgg catttgcccc ggagatgctc gacgaccgca agccgatcaa tataccgtcg 480

ccacgccgga tcgaattcga caaggaccgc tacgccgcca tcgtcaacaa acttaaagcc 540

attctggtcg acctcgaacg ttccgacacc tacctcgcca gcctcctcaa cgtcctcgag 600

gcgacgctgt cgttcgtgcc gtcctcgacc gacgcgtccg aggtcgtcga cgtctcactc 660

ttcgaccacc tgaagctgac gggtgcgctc ggcgcctgca tctggcacta cctacaagcc 720

accggacaaa gcgacttcaa gtcagcgctg ttcgacaagc aggacacctt ctacaacgaa 780

aaagccttcc tgctcacaac tttcgacgtc tcaggcatcc aggacttcat ctacacgatc 840

cattcctcgg gtgccgcgaa gatgctgcgt gcccgcagct tctacctgga gatgctgacc 900

gagcatctca tcgacgagct acttgcgcgg gtgggtctca gccgcgcgaa tctcaactac 960

tccggcggcg ggcacgcgta cctgctgctg cccaacacgg agtccgcgcg gaaatccgtc 1020

gaacagttcg agcgtgaggc caacgactgg ctgctggaaa acttcgcaac ccggctcttc 1080

atcgccacgg gcagcgtacc gcttgccgcg aacgacctga tgcgtcggcc gaacgagagt 1140

gcgagccagg caagtaaccg cgccctccgc tacagcgggc tctaccgtga gttgagcgag 1200

caactttccg cgaagaagct cgcccgatac agcgctgacc aactgcggga actcaactcg 1260

cgcgatcacg acggtcagaa aggtgaccgg gaatgcagcg tgtgccacac ggtcaaccgc 1320

acggtcagcg ccgacgacga gccaaagtgc agcctgtgcc aagcgctgac cgctgcgtct 1380

tcgcagattc aatccgagtc tcgccgcttc ctactcatct ctgacggcgc caccaaaggt 1440

ctgcccctgc cgttcggcgc cacactcacg ttctgtagcc gagccgacgc cgataaggca 1500

ctccagcaac cccaaacccg aaggcggtac gcgaagaaca agttcttcgc cggcgagtgt 1560

ttgggcaccg ggctctgggt gggcgactac gtcgcacaga tggagttcgg tgactacgtg 1620

aagcgtgcga gcggaatcgc gcgcctcggg gttctgcgcc ttgacgtcga taacctgggc 1680

caggcattca cgcacggctt catggagcaa ggcaacggca agttcaacac gattagccgc 1740

acggccgcgt tctcccggat gctgtcgttg ttcttccggc agcacatcaa ctacgtgttg 1800

gcacgcccga aactgcgccc gatcaccggc gatgacccgg cgcggccccg cgaggccacg 1860

atcatctact ccggtggcga tgacgtcttc gtcgtgggcg cgtgggacga cgtcatcgag 1920

ttcgggatcg agcttcggga gcggttccac gaattcaccc agggcaaact caccgtgtcg 1980

gctggcatcg gcatgttccc cgacaagtac cccatctccg tgatggcccg cgaagtcgga 2040

gatctcgaag acgcggcgaa gtcgctgccc ggcaagaacg gggttgcact cttcgatcgc 2100

gagttcacct tcggctggga tgagctgctc agcaaggtga tcgaggagaa gtaccggcac 2160

atcgccgact atttcagtgg caacgaagaa cgcggcatgg ccttcatcta caagctgctc 2220

gaactactcg ccgaacgcga cgatcgaatc acaaaggcca gatgggtgta cttcctcacg 2280

cgcatgcgta accccaccgg tgacacagcg ccttttcagc agtttgctaa ccggctacac 2340

caatggttcc aagatccgac agacgccaag caactcaaga ccgcgctgca cctctacatc 2400

tatcgcactc gcaaggagga gtccgaatga 2430

Claims

1. a kind of endogenous Rv2823c coding albumen carries out gene insertion, knockout or interference in tubercle bacillus and growth is required Application in gene mutation body library screening, wherein the amino acid sequence such as SEQ ID No.1 of endogenous Rv2823c coding albumen It is shown；The nucleotide sequence of endogenous Rv2823c gene is as shown in SEQ ID No.2.

2. application according to claim 1, it is characterised in that: the insertion, the gene for knocking out or interfering are tubercle bacillus Genome in any one or more genes.

3. application according to claim 1, it is characterised in that: still further, the gene is growth indispensable gene.

4. a kind of suitable for the insertion of gene described in claim 1, the recombinant plasmid of knockout or interference editting function, feature exists In: the boot sequence x, x 1,2,3,4 ... containing more than one and tubercle bacillus target gene interaction in the plasmid；Wherein, Boot sequence x is the nucleotide sequence that 40bp is arbitrarily chosen in target-gene sequence.

5. a kind of recombinant plasmid library suitable for growth indispensable gene mutant library screening described in claim 1, feature It is: N number of plasmid in the plasmid library, the boot sequence containing 5658 with tubercle bacillus target gene interaction in all plasmids X, x 1,2,3,4 ...；Wherein, boot sequence is the nucleotide sequence of any 40bp on target gene coding strand.

6. being suitable for the building of autogene insertion, the recombinant plasmid for knocking out or interfering editting function described in a kind of claim 4 Method, it is characterised in that: the following steps are included:

1) repetitive sequence is designed, wherein repetitive sequence repeat is tcgtcagacccaaaaccccgagaggggacggaaac,

3) repeat-BbsI-repeat is inserted into plasmid pMV-261 using the strategy of homologous recombination, that is, forms pMV-261- crRNA；

4) using the DNA sequence dna of any one gene in tubercle bacillus gene group as template, select length for the guidance of 40bp respectively Sequence x；

It 7) is stencil design upstream and downstream homology arm according to target gene upstream and downstream gene, for the ease of screening, specificity is inserted into EGFP, Obtain upstream homology arm -- the downstream EGFP-- homology arm sequence；Sequence HDR is opened the terminator of upstream homology arm and EGFP's Mover removes, and becomes an ORF；

9) above-mentioned connection product is converted into stable3 infection state cell, extracts plasmid pMV-gRNA-HDR, then sequencing mirror It is fixed；Obtain recombinant plasmid pMV-gRNA-HDR.

7. a kind of in building insertion, knockout or interfere editor's base using the recombinant plasmid pMV-gRNA-HDR of claim 4 or 6 It is applied in the bacterial strain of cause.

8. a kind of, using recombinant plasmid library is stated described in claim 5, growth of bacillus tubercle is required and dispensable gene being suitable for It is applied in mutant library screening.