CN103698512A

CN103698512A - Application of mycobacterium tuberculosis proteins in preparation of products used for diagnosis of latent tuberculosis infection

Info

Publication number: CN103698512A
Application number: CN201310608293.7A
Authority: CN
Inventors: 邓教宇; 张先恩; 毕利军; 陶生策; 张治平; 谷晶; 江何伟; 周盈; 王绪德; 郭书娟; 张鸿泰; 杨姗姗; 王靖方; 侯剑; 周杰; 赵斐
Original assignee: Tb Healthcare Co ltd
Current assignee: Guangdong Skywork Biotechnology Co Ltd
Priority date: 2013-11-25
Filing date: 2013-11-25
Publication date: 2014-04-02
Anticipated expiration: 2033-11-25
Also published as: CN103698512B

Abstract

The invention provides 13 mycobacterium tuberculosis proteins in development and/or designing of products capable of discrimination, diagnosis, auxiliary diagnosis, screening and/or auxiliary screening of latent tuberculosis infection. The invention further provides protein chips prepared from 13 mycobacterium tuberculosis protein antigens. The protein chips prepared in the invention are used for detecting the levels of IgG antibodies respectively corresponding to the 13 protein antigens in serum of a patient with latent tuberculosis infection and of a normal person, and detection results of the antibodies respectively corresponding to the three protein are analyzed together so as to determine whether an examined person suffers from latent tuberculosis infection; detection results show that optimal operating points of the protein chips provided by the invention in auxiliary diagnosis of latent tuberculosis infection have specificity of 89.4% and sensitivity of 80.6%, both higher than indexes of diagnosis of latent tuberculosis infection in the prior art.

Description

The purposes of Mycobacterium tuberculosis albumen in the product of preparation diagnosis latency Pulmonary Tuberculosis Infection

Technical field

The invention belongs to biomedicine field, be specifically related to the purposes of Mycobacterium tuberculosis albumen in the product of preparation diagnosis and/or auxiliary diagnosis disease.

Background technology

Since a plurality of centuries, tuberculosis continues to become in the whole world public health problem can not be ignored.At present the population in the whole world existing 1/3rd carries Much's bacillus, and 2010 1 year just newly-increased cases of tuberculosis 8,800,000 is only dead 1,450,000, on average less than 22 seconds, has a people to die from pulmonary tuberculosis, and tuberculosis is in first of Death of Infectious Diseases number.And China is one of the high burden of 22, whole world tuberculosis country, tuberculosis patient number is in global second, infected number surpasses 500,000,000, only within 2010 1 year, just there are new cases 90～1,200,000, occupy approximately 12% of global total newly-increased case, as adopted an effective measure not in time, at Future Ten, in year, may have 3,000 ten thousand people's morbidities, will cause serious public health problem and social concern, so must realize as early as possible phthisical effective control from national strategy aspect.

Scientific evidence shows, after tuberculosis infection human body, in most of the cases, can be subject to immune control in human body, thereby in a latent infection state, likely be converted at any time active tuberculosis.Considering global tuberculosis infection population, is even all a very huge numeral in China, and in conjunction with transmissibility lungy and social harm, in healthy population, the examination tuberculosis patient that hides just seems particularly important.Existing latency Pulmonary Tuberculosis Infection (the 1atent tuberculosis infection that studies confirm that, LTBI) it is the risk of activity TB (Bucher HC that prophylactic treatment can reduce HIV/TB double infection crowd progress, Griffith LE, Guyatt GH, et al:Isoniazid prophylaxis for tuberculosis in HIV infection:a meta-analysis of randomized controlled trails[J] .AIDS, 1999,13:501-508).But the result of current domestic diagnosis latent infection Main Basis tuberculin skin test (PPD skin test), it is generally acknowledged PPD strong positive or transfers the positive person that is latent tuberculosis infection to from feminine gender in a short time.Yet because PPD skin test cannot be distinguished the immune response of the BCG inoculation generation of extensively promoting in China and the responsing reaction that latent infection produces.And serodiagnosis based on antigen-antibody reaction, due to its simplicity, rapidity, is the important clinical complementary diagnostic means of latency Pulmonary Tuberculosis Infection.Therefore, from a long-term perspective, should be devoted to find all good tuberculosis marks of susceptibility and specificity.

Desirable Diagnosis of Tuberculosis mark should meet following condition: (1) susceptibility is high; (2) specificity is high; (3) be present in body fluid, particularly, in blood, be easy to detect.But at present Mycobacterium tuberculosis serodiagnosis for antigen as antigen 5,38KD antigen, 30/31KD antigen and antigen 60 etc., all exist positive rate low, the problems such as cross-immunity with other mycobacterium, although in curative effect monitoring, prompting recurrence, judging prognosis and people at highest risk's generaI investigation, there is certain value, at present still can not making a definite diagnosis for latency Pulmonary Tuberculosis Infection.In order to realize the high sensitivity to latency Pulmonary Tuberculosis Infection, the diagnosis of high specific, is badly in need of searching out more responsive, more special latency Pulmonary Tuberculosis Infection biomarker on molecular level.

Summary of the invention

An object of the present invention is to provide and detect anti-Rv0174 antibody in serum, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, the product of Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and/or anti-Rv3835 antibody horizontal has the application in the product of discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection purposes in preparation.

In described application, described Rv0174 be following a) or b) albumen:

A) protein that the amino acid sequence shown in the SEQ ID № .1 in sequence table forms;

B) by the amino acid residue sequence of the SEQ ID № .1 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .1 have identical function by a) derivative protein;

Described Rv2823c is following c) or albumen d):

C) protein that the amino acid sequence shown in the SEQ ID № .2 in sequence table forms;

D) by the amino acid residue sequence of the SEQ ID № .2 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .2 have identical function by c) derivative protein;

Described Rv1860 is following e) or albumen f):

E) protein that the amino acid sequence shown in the SEQ ID № .3 in sequence table forms;

F) by the amino acid residue sequence of the SEQ ID № .3 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .3 have identical function by e) derivative protein;

Described Rv1984c is following g) or albumen h):

G) protein that the amino acid sequence shown in the SEQ ID № .4 in sequence table forms;

H) by the amino acid residue sequence of the SEQ ID № .4 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .4 have identical function by g) derivative protein;

Described Rv2220 is following i) or albumen j):

I) protein that the amino acid sequence shown in the SEQ ID № .5 in sequence table forms;

J) by the amino acid residue sequence of the SEQ ID № .5 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .5 have identical function by i) derivative protein;

Described Rv2874 is following k) or albumen l):

K) protein that the amino acid sequence shown in the SEQ ID № .6 in sequence table forms;

L) by the amino acid residue sequence of the SEQ ID № .6 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .6 have identical function by k) derivative protein;

Described Rv0002 is following m) or albumen n):

M) protein that the amino acid sequence shown in the SEQ ID № .7 in sequence table forms;

N) by the amino acid residue sequence of the SEQ ID № .7 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .7 have identical function by m) derivative protein;

Described Rv0040c is following o) or albumen p):

O) protein that the amino acid sequence shown in the SEQ ID № .8 in sequence table forms;

P) by the amino acid residue sequence of the SEQ ID № .8 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .8 have identical function by o) derivative protein;

Described Rv0583c is following q) or albumen r):

Q) protein that the amino acid sequence shown in the SEQ ID № .9 in sequence table forms;

R) by the amino acid residue sequence of the SEQ ID № .9 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .9 have identical function by q) derivative protein;

Described Rv1899c is following s) or albumen t):

S) protein that the amino acid sequence shown in the SEQ ID № .10 in sequence table forms;

T) by the amino acid residue sequence of the SEQ ID № .10 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .10 have identical function by s) derivative protein;

Described Rv3803c is following u) or albumen v):

U) protein that the amino acid sequence shown in the SEQ ID № .11 in sequence table forms;

V) by the amino acid residue sequence of the SEQ ID № .11 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .11 have identical function by u) derivative protein;

Described Rv1166 is following w) or albumen x):

W) protein that the amino acid sequence shown in the SEQ ID № .12 in sequence table forms;

X) by the amino acid residue sequence of the SEQ ID № .12 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .12 have identical function by w) derivative protein;

Described Rv3835 is following y) or albumen z):

Y) protein that the amino acid sequence shown in the SEQ ID № .13 in sequence table forms;

Z) by the amino acid residue sequence of the SEQ ID № .13 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .13 have identical function by y) derivative protein;

And/or, described have a discriminating, diagnosis, auxiliary diagnosis, in the product of examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection, comprise the instructions that is described below content: compare with the people who does not normally suffer from any disease, in latency Pulmonary Tuberculosis Infection people, anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, in anti-Rv1166 antibody and anti-Rv3835 antibody horizontal, have at least 7 kinds significantly to raise.

Described antibody is IgG.

Also object of the present invention be to provide a kind of for differentiating, the mark composition of diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection, by anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and anti-Rv3835 antibody form;

In described mark composition, the antibody antibody in vitro serum of behaving described in each;

Described antibody is IgG.

Described Rv0174 be following a) or b) albumen:

Described Rv2823c is following c) or albumen d):

Described Rv1860 is following e) or albumen f):

Described Rv1984c is following g) or albumen h):

Described Rv2220 is following i) or albumen j):

Described Rv2874 is following k) or albumen l):

Described Rv0002 is following m) or albumen n):

Described Rv0040c is following o) or albumen p):

Described Rv0583c is following q) or albumen r):

Described Rv1899c is following s) or albumen t):

Described Rv3803c is following u) or albumen v):

Described Rv1166 is following w) or albumen x):

Described Rv3835 is following y) or albumen z):

Z) by the amino acid residue sequence of the SEQ ID № .13 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQ ID № .13 have identical function by y) derivative protein.

A further object of the present invention is to provide the anti-Rv0174 antibody in serum, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, and the application in the product with discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection purposes is being developed and/or designed to Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and/or anti-Rv3835 antibody as a token of thing;

Described Rv0174 be following a) or b) albumen:

Described Rv2823c is following c) or albumen d):

Described Rv1860 is following e) or albumen f):

Described Rv1984c is following g) or albumen h):

Described Rv2220 is following i) or albumen j):

Described Rv2874 is following k) or albumen l):

Described Rv0002 is following m) or albumen n):

Described Rv0040c is following o) or albumen p):

Described Rv0583c is following q) or albumen r):

Described Rv1899c is following s) or albumen t):

Described Rv3803c is following u) or albumen v):

Described Rv1166 is following w) or albumen x):

Described Rv3835 is following y) or albumen z):

Described have a discriminating, diagnosis, auxiliary diagnosis, in the product of examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection, comprise the instructions that is described below content: compare with the people who does not normally suffer from any disease, in latency Pulmonary Tuberculosis Infection people, anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, in anti-Rv1166 antibody and anti-Rv3835 antibody horizontal, have at least 7 kinds significantly to raise.

Described antibody is IgG.

In described arbitrary application, described discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection specifically refer to whether discriminating, diagnosis and/or auxiliary diagnosis people to be measured suffers from latency Pulmonary Tuberculosis Infection; Or in examination and/or auxiliary examination crowd to be measured, suffers from the situation of latency Pulmonary Tuberculosis Infection.

Another object of the present invention be to provide a kind of for differentiating, the kit of diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection, comprise detection chip, in described detection chip, be connected with at least 7 kinds of albumen in Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and Rv3835 albumen, every kind of albumen is set up separately a check point; Preferably, in described detection chip, be connected with Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and Rv3835 albumen;

Described Rv0174 be following a) or b) albumen:

Described Rv2823c is following c) or albumen d):

Described Rv1860 is following e) or albumen f):

Described Rv1984c is following g) or albumen h):

Described Rv2220 is following i) or albumen j):

Described Rv2874 is following k) or albumen l):

Described Rv0002 is following m) or albumen n):

Described Rv0040c is following o) or albumen p):

Described Rv0583c is following q) or albumen r):

Described Rv1899c is following s) or albumen t):

Described Rv3803c is following u) or albumen v):

Described Rv1166 is following w) or albumen x):

Described Rv3835 is following y) or albumen z):

In described kit, described detection chip is that the solution point sample that contains respectively Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and/or Rv3835 albumen is made on carrier slide.

The described solution that contains respectively Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and/or Rv3835 albumen, by solute and solvent composition, described solute and the concentration in described solution thereof are:

Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and/or Rv3835 albumen 50 μ g/mL;

Solvent is water.

In described solution, also comprise: the glycerine that percent by volume is 25%, the BSA of Tween20,0.05mg/ml and the NaN of 0.1g/L that percent by volume is 0.02% ₃.

Described point sample specifically adopts biochip point sample instrument point sample; The point sample volume of described point sample is 0.3-1nl; Preferred 0.5-1nl; 1nl most preferably.

What described carrier slide specifically adopted is three-dimensional H carrier slide.

After described point sample finishes, also need to stick the plastics fence in 12 holes, and after remaining on and spending the night in 4 ℃ of environment of 30%RH-40%RH humidity, slide is positioned over to-80 ℃ of low temperature of sealing in plastic casing and preserves; Preferably, humidity is 35%RH.

Described kit also comprises IgG positive control and/or the anti-human second antibody of Cy5 mark;

Described kit also comprises instructions, and described instructions is described below content:

Compare with the people who does not normally suffer from any disease, in latency Pulmonary Tuberculosis Infection people, anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, have at least 7 kinds significantly to raise in Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and anti-Rv3835 antibody horizontal.

Described anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, in anti-Rv1166 antibody and anti-Rv3835 antibody horizontal, have at least 7 kinds of remarkable risings to judge as follows: in the testing result of testing sample, anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, in anti-Rv1166 antibody and/or anti-Rv3835 antibody, have at least 7 kinds of antibody to be positive, judge that this testing sample is that latency Pulmonary Tuberculosis Infection is positive, otherwise be that latency Pulmonary Tuberculosis Infection is negative.

The snr value that concrete criterion is each antibody if described antibody is positive, between following value, thinks that this antibody is positive: the snr value of the antibody of Rv0174, between 10.26 and 11.83, comprises 10.26 and 11.83; The snr value of the antibody of Rv2823c, between 10.22 and 11.60, comprises 10.22 and 11.60; The snr value of the antibody of Rv1860, between 10.27 and 11.56, comprises 10.27 and 11.56; The snr value of the antibody of Rv1984c, between 10.21 and 11.65, comprises 10.21 and 11.65; The snr value of the antibody of Rv2220, between 10.10 and 11.14, comprises 10.10 and 11.14; The snr value of the antibody of Rv2874, between 10.30 and 11.53, comprises 10.30 and 11.53; The snr value of the antibody of Rv0002, between 10.29 and 11.48, comprises 10.29 and 11.48; The snr value of the antibody of Rv0040c, between 10.30 and 11.52, comprises 10.30 and 11.52; The snr value of the antibody of Rv0583c, between 10.37 and 11.69, comprises 10.37 and 11.69; The snr value of the antibody of Rv1899c, between 10.34 and 11.68, comprises 10.34 and 11.68; The snr value of the antibody of Rv3803c, between 10.20 and 11.42, comprises 10.20 and 11.42; The snr value of the antibody of Rv1166, between 10.31 and 11.66, comprises 10.31 and 11.66; The snr value of the antibody of Rv3835, between 10.78 and 12.15, comprises 10.78 and 12.15.

Described anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and/or anti-Rv3835 antibody specific are IgG.

The computing formula of described signal to noise ratio (S/N ratio) is:

SNR = \frac{S - B}{σ}

In formula, S and B represent respectively the signal value of the direct demonstration of scanner in described detection chip and the background value in non-sample spot region processed, and σ is the standard deviation that represents this original signal; The experiment number that described σ is corresponding is 3 times; Described S and B value obtain in the scanning of 635nm passage with scanner; Described scanner is GenePix.

Described kit also comprises the reagent that coordinates detection chip to use together, and described reagent comprises following 1)-4):

1) pH7.4PBS solution, it consists of:

2) the PBST solution of pH7.4, it consists of:

3) contain the pH7.4PBS solution of BSA:

4) fluorescently-labeled anti-human second antibody.

Described anti-human second antibody is specially anti-human IgG second antibody.

Last object of the present invention is to provide above-mentioned arbitrary described kit and has the application in the product of discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection purposes in preparation.

Accompanying drawing explanation

Fig. 1 is that the silver of prepared 13 antigen protein Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and Rv3835 dyes quantitative result figure.

Fig. 2 is the Western-Blotting qualification result figure of prepared 13 antigen protein Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and Rv3835.

Fig. 3 is specificity and the susceptibility statistics figure of the method for application protein-chip auxiliary diagnosis latency Pulmonary Tuberculosis Infection.

Embodiment

The experimental technique using in following embodiment if no special instructions, is conventional method.

In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.

The preparation of embodiment 1, protein-chip

The preparation of (one) 13 kind of Mycobacterium tuberculosis antigen protein

1, express

Saccharomyces cerevisiae by genetic engineering modified mistake utilizes galactose induction overexpression, and detailed process is:

First from mycobacterium Much's bacillus (Mycobacterium M.tuberculosis) H37Rv bacterial strain (Beijing Strain), by PCR, from the beginning clone and obtain albumen Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, the gene code fragment of Rv1166 and Rv3835, BP enzyme by Invitrogen company is connected to fragment on pDONR221 carrier (purchased from Invitrogen), be transformed in bacillus coli DH 5-Alpha and increase, extract carrier and by LR enzyme (Invitrogen), change again that (this carrier is at " Jian Zhu to the pEGH-A carrier that can express GST label through transforming, Heng Zhu, et al:J.Virol.May2009vol.83no.105219-5231 " in disclosed, the public can obtain from Ti Bikang bio tech ltd, Guangdong), again be transformed in bacillus coli DH 5-Alpha and increase, extraction plasmid is transformed into Pep4 Wine brewing yeast strain, and (this bacterial strain is at document " Heng Zhu, Michael Snyder, et al:Nature Genetics26, 283 – 289 (2000) doi:10.1038/81576 " in disclosed, the public can obtain from Ti Bikang bio tech ltd, Guangdong).In inducing culture, cultivate, when its OD600 is 0.6-0.8, adding final concentration is the galactose of 2g/L, induction 6h, the centrifugal collection of 4000rpm bacterium ,-80 ℃ of preservations.

The PCR primer sequence that PCR is used in from the beginning cloning is as follows:

The primer pair of the gene code fragment of amplification Rv0174 albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTACTGACTCGCTTCATCCGACGCCAG

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATCAGCTGGCCGGCGCCAG

The primer pair of the gene code fragment of amplification Rv2823c albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAAACCCGCAACTCATCGAGGCC

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATCATTCGGACTCCTCCTTGCGAGT

The primer pair of the gene code fragment of amplification Rv1860 albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTACATCAGGTGGACCCCAACTTGACA

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATCAGGCCGGTAAGGTCCGC

The primer pair of the gene code fragment of amplification Rv1984c albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACTCCACGCAGCCTTGTT

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATCATCCGGCGTGATCGAG

The primer pair of the gene code fragment of amplification Rv2220 albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACGGAAAAGACGCCCGACG

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATTAAACGTCGTAGTACAGCGCGAA

The primer pair of the gene code fragment of amplification Rv2874 albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGTTGAGTCGAGACGAGCT

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATCATCCGTAGGTGAAGGAAAA

The primer pair of the gene code fragment of amplification Rv0002 albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGACGCGGCTACGACAAGAGTT

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATCAGCCCGGCAACCGAAC

The primer pair of the gene code fragment of amplification Rv0040c albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCCAGATCGCGCGCACCTGGC

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTACTAGCGCGGCGGGACTGGTGTC

The primer pair of the gene code fragment of amplification Rv0583c albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAAAGCACTTCACGGCGGCCG

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATTAGGGCGTGATGGTCGTCTGCTC

The primer pair of the gene code fragment of amplification Rv1899c albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTATCCCGGGCTGCCGGGTTG

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTACTACCGTCGAGCGGTATCTTCTCC

The primer pair of the gene code fragment of amplification Rv3803c albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAAAGGGTCGGTCGGCGCTG

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATTAGCGGATCGCACCGACGATATC

The primer pair of the gene code fragment of amplification Rv1166 albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGGCGTGCCCAGCCCAGTC

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTACTATTGCCCGGTCTTCACCCATTG

The primer pair of the gene code fragment of amplification Rv3835 albumen:

Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTATTGGACGCGCCCGAGCAGGAC

Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTACTAGCCTGCCGGTGCGGGCTC

The component containing in every 1L inducing culture (solvent is water) is as shown in table 1:

Table 1

2, purifying

1), prepare lysate:

In 50ml lysate, add 50 μ l mercaptoethanols, 125 μ lPMSF and two Roche protein inhibitors;

2), in-80 ℃ of refrigerators, take out the bacterium (cultivating the thalline of collecting from 120ml inducing culture) that above-mentioned steps 1 is collected, add 400 μ l zirconium oxide beads and 400 μ l lysates, in 4 ℃ of environment, shake 30s, postposition is 2min on ice, repeats four times;

3), take out after the centrifugal 2min of 11,000rpm, get supernatant in a new 15ml centrifuge tube;

4), repeat 2 and 3 step four times, supernatant is collected in same centrifuge tube;

5), add lysate to 12ml be 1/10 of original inducing culture volume, simultaneously with not having the lysate of inhibiting that glutathione beads is cleaned 3 times.In 12ml lysate, add the beads of 300 μ l;

6), add the lysate after beads to hatch 2h in 4 ℃;

7), 11, after the centrifugal 2min of 000rpm, get supernatant and be stored in 4 ℃.Beads respectively washes 3 times with cleaning fluid Ι and cleaning fluid II;

8), add 300 μ l eluents and hatch after 15min, centrifuging and taking supernatant is collected in a new centrifuge tube, repeats once.

The eluent obtaining is dissolved with this albumen.

In above-mentioned purge process, the composition of damping fluid used (solvent is water) is in Table 2-table 5.

Table 2 lysate (1L)

Table 3 cleaning fluid I (1L)

Table 4 cleaning fluid II (1L)

Table 5 eluent (1L)

3, identify

In following experimentation, described solvent or the percentage of liquid are percent by volume.

1), material preparation

Configure the SDS-PAGE glue of two 12%, 1.0mm, 15 holes.A silver dyes, a Western Blotting.Get each 20 μ l of albumen that above-mentioned purifying is good, add 4 μ l6X Loading buffer, the BSA sample of simultaneously preparing specification concentration gradient dyes quantitative contrast as silver, boils sample 5min.

2), run glue

Every hole adds the above-mentioned sample preparing of 12 μ l, BSA gradient sample, 2.5 μ Marker(Takara successively) record order.80V30min，140V1h。

3) silver dyes operation steps:

Fixing: 30min or longer time 40% ethanol 10% glacial acetic acid add water to 250ml

Sensitization: 30min75ml ethanol 30% ethanol 17g sodium acetate 28.2g sodium acetate trihydrate 0.5g sodium thiosulfate (dodium thiosulfate) adds water to final volume 250ml

Washing: 3x10min

Silver dyes: 20min0.625g AgNO3100 μ l37% formaldehyde (adding before use) adds water to final volume 250ml

Washing: 2x1min

Colour developing: the time 6.25g Na that depends on the circumstances ₂cO ₃50 μ l37% formaldehyde (adding before use) add water to final volume 250ml

Stop: 10min1g glycocoll adds water to final volume 250ml

Preserve: 1% glacial acetic acid, 4 ℃

4) Western-Blotting step:

Transferring film: 15V40min(is half-dried to be turned, Bio-Rad).Transferring film damping fluid: glycocoll 2.9g; Tris5.8g; SDS0.37g; Methyl alcohol 200ml; Add ddH ₂o is settled to 1000ml

Sealing: 5% skim milk (Bio-Rad) 1h.

First antibody is hatched: Anti-GST mouse-anti (NovaGen) final concentration 1 μ g/ml1h

Second antibody is hatched: sheep mouse-anti fluorescence 800 passages (Odyssey) final concentration 1 μ g/ml1h

Odyssey scanner scanning, preserves picture.

Carry out silver and dye result quantitative and that Western-Blotting identifies respectively as depicted in figs. 1 and 2.Fig. 1 result shows that the amount of prepared Rv Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and Rv3835 albumen is 50 μ g/ml; Fig. 2 result proves, prepared Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and Rv3835 albumen are correct.

Through order-checking, prepared Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and Rv3835 albumen have respectively the amino acid sequence shown in SEQ ID № .1-13 in sequence table successively.

(2) put in advance the preparation of the protein-chip of antigen

In the eluate solution of the Rv0174 antigen protein containing 50 μ g/ml of above-mentioned preparation, adding final concentration is 25%(percent by volume) glycerine, 0.02%(percent by volume) the BSA of Tween20,0.05mg/ml and the NaN of 0.1g/L ₃.Adopt biochip point sample instrument that above-mentioned mixed liquor is put in carrier slide (carrier slide is commercial three-dimensional H carrier slide, purchased from CapitalBio Corporation) upper, every about 1nL of point sample, 2 parallel points.Adopt biochip point sample instrument (purchased from CapitalBio Corporation) some system.

Above-mentioned Rv0174 antigen protein is replaced with to Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 or Rv3835 antigen protein (being 50 μ g/ml), IgG (1mg/ml) standard items or the anti-human antibody two of Cy5 mark anti-(20 μ g/ml) as positive control, in mixed liquor, other component and final concentration are constant, prepare respectively containing Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 or Rv3835 antigen protein, the anti-mixed liquor of the anti-human antibody two of IgG standard items or Cy5 mark.

With above-mentioned identical point sample method, to containing Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 or the anti-mixed liquor of the anti-human antibody two of Rv3835 antigen protein, IgG standard items or Cy5 mark, put on above-mentioned identical carrier slide respectively, form microarray, every slide can be put 12 and repeat parallel seal interval.After point sample finishes, stick the plastics fence in 12 holes, and remain in 4 ℃ of environment of 35%RH humidity after 16h, slide is positioned over to-80 ℃ of low temperature of sealing in plastic casing and preserves.

Embodiment 2, application protein-chip auxiliary diagnosis latency Pulmonary Tuberculosis Infection

(1) preparation of test serum sample

Whole blood sample in room temperature place within 2 hours or 4 ℃, spend the night after in 1000g centrifugal about 20 minutes, get supernatant and can detect immediately; Or carry out packing, and sample is put in to-20 ℃ or-80 ℃ of preservations, but should avoid multigelation.4 ℃ of samples after thawing should be again centrifugal, then detects.

(2) related various damping fluids and the preparation of reagent in diagnostic procedure

(1) sample diluting liquid (in Table 6): pH7.4PBS solution

Table 6

(2) the PBST solution of cleansing solution (in Table 7): pH7.4

Table 7

(3) chip confining liquid (in Table 8): containing the pH7.4PBS solution of BSA

Table 8

(4) the anti-concentrate of the anti-human antibody two of Cy5 mark: use commercially available anti-human IgG-Cy5 fluorescence labeling two anti-,, being diluted to concentration is 1mg/ml, is sub-packed in lucifuge tubule.

(3) method of application protein-chip auxiliary diagnosis latency Pulmonary Tuberculosis Infection

Use the protein-chip of embodiment 1 preparation can detect in tested person's blood sample 13 proteantigen Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 or the Rv3835 level of corresponding IgG antibody separately, the testing result of the corresponding antibodies of these 13 protein of Conjoint Analysis, can judge whether tested person is latency Pulmonary Tuberculosis Infection.

1, concrete operation step

1) chip that 1 of embodiment is made to sealing is from-80 ℃ of taking-ups, room temperature rewarming 10 minutes.

2) sealing: chip is put into sink, add about 50ml chip confining liquid (table 8), shaking table 50rpm, room temperature 1h.

3) get rid of fast liquid unnecessary on chip, be placed in wet box.

4) dilution of testing sample and application of sample: by sample diluting liquid (table 6) dilution of above-mentioned preparation for 1:100 by volume of test serum sample, the solution containing test serum of getting after 30 μ L dilutions joins in the fence-enclosing space of sealing.Reaction 1h, room temperature.Detected sample preparation in 15 minutes before use.

5) chip is taken out from wet box, be placed in sink, add the cleansing solution of the above-mentioned preparation of about 50ml, shaking table 50rpm, room temperature 5min, repeats 3 times.

6) get rid of fast liquid unnecessary on chip, be placed in wet box.

7) the Cy5 fluorescence anti-human two that each enclosure space adds 30 μ L to be diluted to final concentration 1 μ g/ml resists on chip, lucifuge reaction 1h.

8) chip is taken out from wet box, be placed in sink, add the cleansing solution of the above-mentioned preparation of about 50ml, shaking table 50rpm, room temperature 5min, repeats 3 times.Use again the ultrapure washing of about 50ml once, 5min.

9) centrifugal drying, with Genepix scanner reading out data under 635nm passage.

2, the testing sample judgement to 13 kinds of antigen protein resistances respectively

By the result that Genepix scanner obtains in the scanning of 635nm passage, be to weigh by the signal to noise ratio (snr) of point of sample, the signal to noise ratio (snr) computing formula of point of sample is:

SNR = \frac{S - B}{σ}

In formula, S and B represent respectively signal value original in chip (being the numerical value that scanner directly shows) and background value (signal value in non-sample spot region processed), and σ is the standard deviation (experiment number that σ is corresponding is 3 times) that represents this original signal.

The signal to noise ratio (S/N ratio) interval (described signal to noise ratio (S/N ratio) interval comprises the endpoints thereof in given signal to noise ratio (S/N ratio) interval) of the snr value of point of sample on protein-chip and following table 9-table 21 is contrasted, to carry out the judgement of testing sample to the positive of corresponding antigens resistance, negative findings:

Anti-Rv0174(is in Table 9):

Table 9

Anti-Rv2823c(is in Table 10):

Table 10

Anti-Rv1860(is in Table 11):

Table 11

Anti-Rv1984c(is in Table 12):

Table 12

Anti-Rv2220(is in Table 13):

Table 13

Anti-Rv2874(is in Table 14):

Table 14

Anti-Rv0002(is in Table 15):

Table 15

Anti-Rv0040c(is in Table 16):

Table 16

Anti-Rv0583c(is in Table 17):

Table 17

Anti-Rv1899c(is in Table 18):

Table 18

Anti-Rv3803c(is in Table 19):

Table 19

Anti-Rv1166(is in Table 20):

Table 20

Anti-Rv3835(is in Table 21):

Table 21

3, the judgement of testing sample assay

Criterion:

Compare with the people who does not normally suffer from any disease, in latency Pulmonary Tuberculosis Infection people, anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, in Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and anti-Rv3835 antibody horizontal, have at least 7 kinds of antibody significantly to raise, be embodied in:

If in the testing result of testing sample, described anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, (when 2 parallel point of samples that judge same antigen on the protein-chip of the standard whether antibody is positive: embodiment 1 preparation are all judged to be the positive, this antibody is positive in Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and anti-Rv3835 antibody horizontal, to have at least 7 kinds of antibody to be positive.), judge that this testing sample is that latency Pulmonary Tuberculosis Infection is positive, otherwise be that latency Pulmonary Tuberculosis Infection is negative.

(4), specificity and the susceptibility of the method for application protein-chip auxiliary diagnosis latency Pulmonary Tuberculosis Infection

(clinical diagnosis is 100 parts of the patients of latency Pulmonary Tuberculosis Infection, 100 parts of Healthy Peoples to adopt the serum of 200 parts of latency Pulmonary Tuberculosis Infection associated patient; Serum sample is provided by Guangdong Province tuberculosis control center, serum sample obtain the informed consent of all passing through patient and examinee.) protein-chip of embodiment 1 has been carried out to specificity and sensitivity Detection, with above-mentioned criterion, judge that whether person to be measured is positive as latency Pulmonary Tuberculosis Infection.

Testing result as shown in Figure 3.Horizontal ordinate false positive rate representative (1-specificity) in Fig. 3, ordinate True Positive Rate represents susceptibility.The specificity that is the best operating point of susceptibility/(1-specificity) the protein-chip auxiliary diagnosis latency Pulmonary Tuberculosis Infection that calculates embodiment 1 according to positive likelihood ratio is 89.4%, susceptibility is 80.6%, is all much higher than the index of latency Pulmonary Tuberculosis Infection diagnosis in prior art.

In 100 parts of latency Pulmonary Tuberculosis Infection patients, 89 parts are detected the positive; In 100 parts of Healthy Peoples, there are 19 parts to be detected the positive.

Claims

1. detect anti-Rv0174 antibody in serum, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, the product of Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and/or anti-Rv3835 antibody horizontal has the application in the product of discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection purposes in preparation.

2. application according to claim 1, is characterized in that:

Described Rv0174 be following a) or b) albumen:

Described Rv2823c is following c) or albumen d):

Described Rv1860 is following e) or albumen f):

Described Rv1984c is following g) or albumen h):

Described Rv2220 is following i) or albumen j):

Described Rv2874 is following k) or albumen l):

Described Rv0002 is following m) or albumen n):

Described Rv0040c is following o) or albumen p):

Described Rv0583c is following q) or albumen r):

Described Rv1899c is following s) or albumen t):

Described Rv3803c is following u) or albumen v):

Described Rv1166 is following w) or albumen x):

Described Rv3835 is following y) or albumen z):

One kind for differentiating, the mark composition of diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection, by anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and anti-Rv3835 antibody form;

Described Rv0174 be following a) or b) albumen:

Described Rv2823c is following c) or albumen d):

Described Rv1860 is following e) or albumen f):

Described Rv1984c is following g) or albumen h):

Described Rv2220 is following i) or albumen j):

Described Rv2874 is following k) or albumen l):

Described Rv0002 is following m) or albumen n):

Described Rv0040c is following o) or albumen p):

Described Rv0583c is following q) or albumen r):

Described Rv1899c is following s) or albumen t):

Described Rv3803c is following u) or albumen v):

Described Rv1166 is following w) or albumen x):

Described Rv3835 is following y) or albumen z):

4. the anti-Rv0174 antibody in serum, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and/or anti-Rv3835 antibody as a token of thing have the application in the product of discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection purposes in exploitation and/or design;

Described Rv0174 be following a) or b) albumen:

Described Rv2823c is following c) or albumen d):

Described Rv1860 is following e) or albumen f):

Described Rv1984c is following g) or albumen h):

Described Rv2220 is following i) or albumen j):

Described Rv2874 is following k) or albumen l):

Described Rv0002 is following m) or albumen n):

Described Rv0040c is following o) or albumen p):

Described Rv0583c is following q) or albumen r):

Described Rv1899c is following s) or albumen t):

Described Rv3803c is following u) or albumen v):

Described Rv1166 is following w) or albumen x):

Described Rv3835 is following y) or albumen z):

One kind for differentiating, the kit of diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection, comprise detection chip, in described detection chip, be connected with at least 7 kinds of albumen in Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and Rv3835 albumen, every kind of albumen is set up separately a check point; Preferably, in described detection chip, be connected with Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and Rv3835 albumen;

Described Rv0174 be following a) or b) albumen:

Described Rv2823c is following c) or albumen d):

Described Rv1860 is following e) or albumen f):

Described Rv1984c is following g) or albumen h):

Described Rv2220 is following i) or albumen j):

Described Rv2874 is following k) or albumen l):

Described Rv0002 is following m) or albumen n):

Described Rv0040c is following o) or albumen p):

Described Rv0583c is following q) or albumen r):

Described Rv1899c is following s) or albumen t):

Described Rv3803c is following u) or albumen v):

Described Rv1166 is following w) or albumen x):

Described Rv3835 is following y) or albumen z):

6. kit according to claim 5, is characterized in that: described detection chip is that the solution point sample that contains respectively Rv0174, Rv2823c, Rv1860, Rv1984c, Rv2220, Rv2874, Rv0002, Rv0040c, Rv0583c, Rv1899c, Rv3803c, Rv1166 and/or Rv3835 albumen is made on carrier slide.

7. according to the kit described in claim 5 or 6, it is characterized in that: described kit also comprises instructions, described instructions is described below content:

Compare with the people who does not normally suffer from any disease, in latency Pulmonary Tuberculosis Infection people, anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, have at least 7 kinds of antibody significantly to raise in Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, anti-Rv1166 antibody and anti-Rv3835 antibody horizontal.

8. according to the arbitrary described kit of claim 5-7, it is characterized in that:

Described anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, in anti-Rv1166 antibody and anti-Rv3835 antibody horizontal, have at least 7 kinds of remarkable risings of antibody to judge as follows: in the testing result of testing sample, anti-Rv0174 antibody, anti-Rv2823c antibody, anti-Rv1860 antibody, anti-Rv1984c antibody, anti-Rv2220 antibody, anti-Rv2874 antibody, anti-Rv0002 antibody, anti-, Rv0040c antibody, anti-Rv0583c antibody, anti-Rv1899c antibody, anti-Rv3803c antibody, in anti-Rv1166 antibody and/or anti-Rv3835 antibody, have at least 7 kinds of antibody to be positive, judge that this testing sample is that latency Pulmonary Tuberculosis Infection is positive, otherwise be that latency Pulmonary Tuberculosis Infection is negative,

9. according to the arbitrary described kit of claim 5-8, it is characterized in that: described kit also comprises the reagent that coordinates detection chip to use together, and described reagent comprises following 1)-4):

1) pH7.4PBS solution, it consists of:

2) the PBST solution of pH7.4, it consists of:

3) contain the pH7.4PBS solution of BSA:

4) fluorescently-labeled anti-human second antibody.

10. the arbitrary described kit of claim 5-9 has the application in the product of discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latency Pulmonary Tuberculosis Infection purposes in preparation.