CN111607521A

CN111607521A - AP2IV-1 gene-deleted toxoplasma gondii attenuated live vaccine and construction method thereof

Info

Publication number: CN111607521A
Application number: CN202010403481.6A
Authority: CN
Inventors: 索勋; 刘贤勇; 王超越; 胡丹丹; 张思新; 汤新明; 马辉明; 王思
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2020-05-13
Filing date: 2020-05-13
Publication date: 2020-09-01
Anticipated expiration: 2040-05-13
Also published as: CN111607521B

Abstract

The invention relates to the technical field of toxoplasma gondii vaccines, in particular to a toxoplasma gondii attenuated live vaccine lacking AP2IV-1 gene and a construction method thereof. The invention provides an AP2IV-1 gene-deleted toxoplasma gondii strain, wherein the amino acid sequence of AP2IV-1 is shown as SEQ ID NO. 1. Compared with a outbreak insect strain, the AP2IV-1 gene deletion insect strain has obviously reduced toxicity, almost no pathogenicity in a mouse body and higher safety to a host. The AP2IV-1 gene-deleted insect strain can provide long-term effective immune protection for acute and chronic re-infection of different types of high-dose toxoplasma gondii, and has the potential of becoming a weak live vaccine for preventing the toxoplasmosis of animals.

Description

AP2IV-1 gene-deleted toxoplasma gondii attenuated live vaccine and construction method thereof

Technical Field

The invention relates to the technical field of toxoplasma gondii vaccines, in particular to a toxoplasma gondii attenuated strain with a deleted AP2IV-1 gene, a construction method thereof and a vaccine containing the attenuated strain.

Background

Toxoplasma Gondii (Toxoplasma Gondii) is a zoonotic obligate parasitic protozoan, which can grow in almost any warm-blooded cell. Humans can be infected with Toxoplasma gondii, but most people present with recessive infection. Toxoplasma gondii infection in pregnant women and immunodeficient persons can have serious consequences. Meanwhile, toxoplasmosis causes huge economic loss to animal husbandry, and the infection of toxoplasmosis easily causes abortion of animals such as pigs, sheep and the like. Currently, toxoplasmosis is still treated mainly by drug therapy, namely, the combination of the hexyl amine pyrimidine and sulfadiazine, however, the drugs are not effective for toxoplasma cyst treatment. Therefore, there is a need to develop toxoplasmosis vaccines. The live toxoplasma vaccine was found to be the most effective way to prevent toxoplasma infection in animals. The only commercial toxoplasma live vaccine at present is S48 strain isolated from dead sheep and attenuated by laboratory passage, however, the toxoplasma live vaccine has the risk of virulence reversion, and the use of the toxoplasma live vaccine is limited. Therefore, the development of the toxoplasma gondii attenuated live vaccine with higher safety and effectiveness is of great significance.

Disclosure of Invention

One of the purposes of the invention is to provide a new function of the toxoplasma AP2IV-1 gene, and the other purpose of the invention is to provide a toxoplasma attenuated strain lacking the AP2IV-1 gene and a vaccine containing the attenuated strain. The invention also provides a construction method of the toxoplasma gondii attenuated strain with the AP2IV-1 gene deletion.

The invention finds that the presumed AP2IV-1 gene in the genome of the Toxoplasma gondii is positioned in the mitochondria of the Toxoplasma gondii and has the function of regulating the proliferation rate and the toxicity of the Toxoplasma gondii. The deletion mutant strain obtained by deleting the AP2IV-1 gene in the toxoplasma gondii can maintain higher immune protection efficacy while obviously reducing the pathogenicity of the toxoplasma gondii, and can be used as an ideal strain of a weak live vaccine.

The amino acid sequence of AP2IV-1 is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO.2, and belongs to the AP2 transcription factor family. The AP2 transcription factor family is widely functional and is involved in almost every stage of the biological life cycle. Toxoplasma AP2 protein is found at present in up to 67.

Specifically, the technical scheme of the invention is as follows:

in a first aspect, the invention provides the use of AP2IV-1 or an inhibitor thereof for modulating the rate of proliferation or virulence of toxoplasma gondii.

In a second aspect, the invention provides the use of AP2IV-1 or an inhibitor thereof in the preparation of a live attenuated toxoplasma vaccine.

Specifically, in the application, the proliferation rate or the toxicity of the Toxoplasma gondii is reduced by influencing the complete or accurate expression of AP2IV-1 in the Toxoplasma gondii or by down-regulating the expression level of AP2 IV-1.

The amino acid sequence of the AP2IV-1 is shown as SEQ ID NO.1, and the coding region sequence of the AP2IV-1 gene is shown as SEQ ID NO. 2.

The inhibitor can inhibit the expression of AP2IV-1 gene, including but not limited to interfering RNA, antisense gene, gRNA and the like.

Specifically, the inhibitor is a gRNA used in cooperation with a CRISPR/Cas9 system. The sequence of the gRNA is shown in SEQ ID NO. 3.

In a third aspect, the invention provides a toxoplasma gondii strain in which AP2IV-1 is not expressed or is expressed in a reduced amount as compared to a starting toxoplasma gondii strain.

AP2IV-1 has high conservation in Toxoplasma gondii, and the starting Toxoplasma gondii strain can be a delta Ku80RH worm strain or any other Toxoplasma gondii strain.

Preferably, the toxoplasma gondii strain lacks the AP2IV-1 gene.

Deletion of the AP2IV-1 gene may be a deletion of a part of or the entire sequence of the AP2IV-1 gene or the like to inactivate the AP2IV-1 gene.

In a fourth aspect, the invention provides a construction method of a toxoplasma gondii attenuated strain, which is constructed by influencing the complete or accurate expression of AP2IV-1 in the toxoplasma gondii or by down-regulating the expression level of AP2 IV-1.

Specifically, the complete or accurate expression of AP2IV-1 in the Toxoplasma gondii is realized by knocking out the AP2IV-1 gene of the Toxoplasma gondii by using a CRISPR/Cas9 system.

The sequence of the gRNA used by the CRISPR/Cas9 system is shown in SEQ ID NO. 3.

The construction method of the toxoplasma gondii attenuated strain lacking the AP2IV-1 gene provided by the invention comprises the following steps:

(1) construction of CRISPR/Cas9 plasmid pSAG1-CAS9-TgU6-sgAP2IV-1 plasmid: replacing gRNA of UPRT gene with gRNA of AP2IV-1 gene (SEQ ID NO.3) by using pSAG1-CAS9-TgU6-sgUPRT plasmid as a template;

(2) constructing a homologous recombination template AP2IV-1-5UTR-DHFR-AP2IV-1-3 UTR: the homologous recombination template is formed by connecting the 5 'homologous arm of the AP2IV-1 gene, the DHFR gene and the 3' homologous arm of the AP2IV-1 gene in sequence;

(3) the pSAG1-CAS9-TgU6-sgAP2IV-1 plasmid and AP2IV-1-5UTR-DHFR-AP2IV-1-3UTR are co-transfected into toxoplasma gondii, and the AP2IV-1 gene deletion monoclonal insect strain is obtained through screening and identification.

In a fifth aspect, the invention provides the use of the toxoplasma facility as a medicament for the prevention or treatment of toxoplasma infection.

In a sixth aspect, the invention provides an application of the toxoplasma gondii attenuated strain in preparation of toxoplasma gondii attenuated live vaccines.

In a seventh aspect, the invention provides a toxoplasma gondii attenuated live vaccine, which contains the toxoplasma gondii attenuated strain.

The invention provides a toxoplasma attenuated live vaccine with AP2IV-1 gene deletion.

When animals are inoculated, the tachyzoite of the toxoplasma gondii attenuated live vaccine is prepared into suspension in PBS or DMEM for injection inoculation.

The invention has the beneficial effects that: compared with a outbreak insect strain, the toxoplasma gondii strain with the AP2IV-1 gene deletion provided by the invention has the advantages that the proliferation speed of the AP2IV-1 gene deletion insect strain in vitro is remarkably reduced, the pathogenicity is remarkably reduced, almost no pathogenicity exists in a mouse body, and the toxoplasma gondii strain has higher safety to a host; after the AP2IV-1 gene-deleted strain is used for immunizing mice, high immune protective efficacy can be provided for different types of high-dose toxoplasma acute (tachyzoite) and chronic (cyst) reinfection, and long-term effective protection can be provided by immunizing once. Therefore, the AP2IV-1 gene-deleted worm strain has the potential of preparing attenuated genetic engineering live vaccines for preventing toxoplasmosis of animals.

Drawings

FIG. 1 is a schematic diagram showing the knock-out and identification of AP2IV-1 gene in example 1 of the present invention.

FIG. 2 is a graph showing the results of PCR identification of the RH. DELTA.AP 2IV-1 insect strain in example 1 of the present invention, wherein RH represents the. DELTA.Ku 80RH insect strain, and Clone13 and Clone18 represent different clones of RH. DELTA.AP 2 IV-1.

FIG. 3 shows the results of intracellular proliferation rate of RH delta AP2IV-1 insect strain in example 2 of the present invention, wherein RH-24 represents that delta Ku80RH insect strain was cultured in HFF cells for 24h, RH-48 represents that delta Ku80RH insect strain was cultured in HFF cells for 48h, AP2IV-1_ KO-24 represents that RH delta AP2IV-1 insect strain was cultured in HFF cells for 24h, AP2IV-1_ KO-48 represents that RH delta AP2IV-1 insect strain was cultured in HFF cells for 48h, 1, 2, 4, 8 and 16 respectively represent that the number of tachyzoites in the vacuolar membrane is 1, 2, 4, 8, or more than 16, the% of vacuoles in ordinate represents the ratio of the number of the vacuolar membranes of different numbers of tachyzoites, 8.165 and > 16 respectively represent the average number of the proliferating strains of delta 80 insect in the HFF cells that RH is 24h and 48h, 1.781 and 4.621 represent the average number of tachyzoites in the vacuolar membranes of 24h and 48h nauplius grown in HFF cells by strain RH. DELTA.AP 2IV-1, respectively.

FIG. 4 is a virulence test in mice for the RH Δ AP2IV-1 insect strain of example 2 of the invention.

FIG. 5 is a schematic diagram of the experimental procedure of the mouse immunoprotection experiment in example 2 of the present invention.

FIG. 6 shows the survival rate of the mouse subjected to challenge and the detection result of encystment in the brain after the RH delta AP2IV-1 insect strain is immunized for 30 days in example 2 of the invention, wherein A is the survival rate of the immunized group and the non-immunized group at different time after challenge of RH, PRU, Me49 and Chinese type 1 tachyzoite; and B is the survival rate of the immune group and the non-immune group at different time after the toxicity counteracting PRU is encapsulated, and C is the intracerebral capsule quantity detection of the immune group and the non-immune group after the toxicity counteracting PRU is encapsulated.

FIG. 7 shows the survival rate of the mouse subjected to challenge and the detection result of encystment in the brain after the RH delta AP2IV-1 insect strain is immunized for 150 days in example 2 of the invention, wherein A is the survival rate of the immunized group and the non-immunized group at different time after challenge of RH, PRU, Me49 and tachyzoite of Chinese type 1; and B is the survival rate of the immune group and the non-immune group at different time after the toxicity counteracting PRU is encapsulated, and C is the intracerebral capsule quantity detection of the immune group and the non-immune group after the toxicity counteracting PRU is encapsulated.

FIG. 8 is the results of the measurement of the level changes of antibodies and cytokines in the serum at different times of the mice immunization in example 3 of the present invention, wherein A is IgG, B is IFN-. gamma., C is IL-10, and D is IL-1.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. The experimental procedures used in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. Toxoplasma delta Ku80RH insect strain is disclosed in (Huynh, M.H. and Carruther, V.B. (2009). Tagging of endogenous genes in a Toxoplasma strain lacking Ku80.Eukaryot Cell 8, 530-539.).

Example 1 construction of Toxoplasma gondii AP2IV-1 Gene-deleted insect Strain

Constructing an AP2IV-1 gene-deleted insect strain by taking delta Ku80RH as a basic insect strain.

Δ Ku80RH is a toxoplasma type I strain that loses the ability to form cysts in animals. AP2IV-1 is conserved in the sequence of toxoplasma gondii of different types, the amino acid sequence is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO. 2.

1. Construction of CRISPR/CAS9 System plasmid pSAG1-CAS9-TgU6-sgAP2IV-1

Using pSAG1-CAS9-TgU6-sgUPRT plasmid as a template, a multi-fragment seamless cloning kit (available from TransGen Biotech Co.) (

Seamless Cloning and Assembly Kit) to replace the gRNA of UPRT gene with the gRNA of AP2IV-1 gene, the specific procedure was as follows:

(1) design of gRNA

A gRNA of AP2IV-1 is designed in ToxoDB (http:// gRNA. ctegd. uga. edu /), and a gRNA with higher comprehensive score is designed at the middle position of a gene coding region because the gene sequence of AP2IV-1 is less than 2000bp, and the nucleotide sequence of the gRNA is shown as SEQ ID NO. 3.

(2) Fragment amplification

The CRISPR/CAS9 skeleton is divided into three fragments for amplification, and the primer sequences are as follows:

fragment one:

an upstream primer: backbone-1Fw GTTTTAGAGCTAGAAATAGCAAG;

a downstream primer: backbone-1Rv: CCTTCTAGACGCATGGTAAA;

fragment two:

an upstream primer: backbone-2 Fw: TTTACCATGCGTCTAGAAGGT, respectively;

a downstream primer: backbone-2 Rv: CTGTCTTGTGTATTGACCCATGT, respectively;

fragment three:

an upstream primer: CCACATGGGTCAATACACAAGACAGCTA for sgRNA-Fw;

a downstream primer: sgAP2IV-1-Rv: TTCTAGCTCTAAAACCCTAAGATCTCAGTCCGAGCAACTTGACATCCC.

All the above DNA fragments were amplified with Q5 high-fidelity DNA polymerase (NEB Co.) (

High-Fidelity DNApolymerase) and the PCR reaction system is shown in Table 1.

TABLE 1 PCR reaction System

The PCR reaction conditions are shown in Table 2.

TABLE 2 PCR reaction conditions

Note: the Q5 high fidelity DNA polymerase extends at least 2kb per minute, so the extension time is determined by the specific amplified fragment length.

After completion of the PCR reaction, the objective fragment was recovered by running the gel, and the gel was purified using a gel recovery kit (available from TransGen Biotech Co.) (see

Quick Gel Extraction Kit) and each DNA fragment was recovered by purification.

(3) Fragment ligation

The purified DNA product was ligated with a multi-fragment seamless cloning kit (TransGen Biotech Co.) (

Seamless Cloning and Assembly Kit). The reaction system is shown in Table 3.

TABLE 3 Multi-fragment ligation reaction conditions

And (3) lightly mixing the reaction system, reacting for 15min at 50 ℃, and cooling on ice after the reaction is finished. The product was transferred to 50. mu.L of Trans1-T1 Competent cells (TransGen Biotech, Trans1-T1 Phage resistant chemical company Cell), gently mixed, placed on ice for 30min, heat-shocked on a metal bath at 42 ℃ for 1min, and immediately thereafter transferred to ice for 2 min. Add 500. mu.L of LB medium and incubate at 37 ℃ for 1h on a shaker at 250 rpm. 100 μ L of the suspension was spread evenly on ampicillin resistant plates. After 24 hours, several single clones were picked for sequencing, and the sequencing primers used to determine one reaction each using the universal primers M13F and M13R. The sequencing result shows that the target sequence is AP2IV-1, no error occurs at the plasmid junction, and the plasmid construction is successful.

(4) Plasmid pSAG1-CAS9-TgU6-sgAP2IV-1 was extracted using PL 14-Large Scale Mass plasmid extraction kit (Aidlab biotechnology CO. Ltd.) for use.

2. Preparation of AP2IV-1-5UTR-DHFR-AP2IV-1-3UTR homologous template

(1) Amplifying 5 'and 3' homologous arms of an AP2IV-1 gene by using Q5 high-fidelity DNA polymerase and an RH insect strain genome as a template, wherein the amplification primer sequences are as follows:

5H-AP2IV-1-Fw：CCATGATTACGCCTACGTAAATACGTCATGCGCAGAGATTG；

5H-AP2IV-1-Rv：cgccctatagtgagtctcGCGATCCCGAAGGCACAGCAAAA；

3H-AP2IV-1-Fw：tgtagcctgccagaacacGCAGGCTGGGGAAACGCGTGGGTG；

3H-AP2IV-1-Rv：TAGGGCGAATTGGATATCTACACTTATTCAACATTATATAT。

(2) the DHFR open reading frame was amplified from pLoxp-DHFR-mCherry plasmid (purchased from Addgene, cat #70147) using Q5 high fidelity DNA polymerase, and the primer sequences were as follows:

DHFR-Fw：GAGACTCACTATAGGGCGAATTG；

DHFR-Rv：GTGTTCTGGCAGGCTACAGTGACA。

(3) the backbone was amplified from the cloning vector pEASY-Blunt (this plasmid is available from TransGenBiotech) using Q5 high fidelity DNA polymerase, and the primer sequences were as follows:

Backbone-3Fw：GATATCCAATTCGCCCTATAGTGA；

Backbone-3Rv：TACGTAGGCGTAATCATGGTCATAG。

(4) after the 5 'and 3' homologous arms of the AP2IV-1 gene, the DHFR open reading frame and the amplification product of the cloning vector skeleton are subjected to gel cutting and purification, the four fragment products are subjected to connection, transformation, plate coating, single clone selection and sample sequencing for identification by using a multi-fragment kit, and the specific steps refer to the preparation process of pSAG1-CAS9-TgU6-sgAP2IV-1 plasmid.

(5) And (3) amplifying by taking the bacterial liquid with correct sequencing as a template and 5H-AP2IV-1-Fw/3H-AP2IV-1-Rv as a primer to obtain the AP2IV-1 homologous recombination template. Amplifying 4 tubes of a 50-microliter reaction system, taking 3 microliter PCR products from each tube, running glue for identification, and carrying out DNA purification on the rest PCR products if a target band is obtained, wherein the operation steps are as follows:

a: adding 10 times volume of absolute ethyl alcohol into the PCR product, and standing at-20 ℃ for more than 1 h;

b: centrifuging at 4 deg.C with centrifuge at 10000rpm for 10min, and removing supernatant;

c: adding 500 μ L75% ethanol, centrifuging at 4 deg.C and 10000rpm for 5min, discarding supernatant, volatilizing ethanol, adding 50 μ L sterile water to dissolve precipitate, and storing at-20 deg.C.

3. Construction of Toxoplasma gondii gene knock-out strain delta AP2IV-1 DHFR

(1) Collection 5 × 10⁶Freshly released Δ Ku80RH tachyzoites were filtered through a 5 μm filter to remove cell debris, centrifuged at 2000rpm for 5min and the supernatant discarded.

(2) 2ml of cytomix buffer (120mM KCl, 0.15mM CaCl) was added₂，10mM K₂HPO₄/KH₂PO₄，25mMHEPES，2mM EGTA，5mM MgCl₂pH 7.6), the pellet was resuspended, centrifuged at 2000rpm for 5min, and the supernatant was discarded.

(3) mu.L of cytomix buffer was taken and added with pSAG1-CAS9-TgU6-sgAP2IV-1 plasmid (50. mu.g) and AP2IV-1 homologous recombination template (10. mu.g) in a volume of about 100. mu.L, mixed well and added to an electric cuvette with a diameter of 4 mm.

(4) Setting an electrotransfer instrument program: voltage 2000V, capacitance 25F, resistance ∞. After transfection, the Toxoplasma gondii was inoculated into HFF cells and cultured, and after 24 hours, the cells were replaced with medium containing 3. mu.M of uracil.

(5) Screening single clones: after the drug screening for three generations, monoclonal screening was performed. One bottle of confluent HFF cells (T25) was digested, added to a 96-well plate (100. mu.L per well volume), the worms were collected, counted on a cell counter plate, diluted to 300 tacchyzoites/ml, 100. mu.L of worms were added to each end of the 96-well plate, diluted in multiple ratios (30, 15, 7.5, 3.75, 1.875, 0.9375) in sequence, and 100. mu.L of medium was supplemented to each well after dilution was completed.

(6) Cultured in a cell incubator (37 ℃, 5% CO)₂) After 15 days, wells with only one plaque were microscopically picked and transferred to 12-well plates filled with HFF cells for further 15 days.

(7) DNA (Tiangen Biochemical technology (Beijing) Co., Ltd., blood/cell/tissue genome DNA extraction kit) is extracted from a part of monoclonal insect strains in a 12-hole plate for identification, and the DNA extraction method refers to a cell DNA extraction method of the kit. The primers were identified as follows:

5’-KO-AP2IV-1-Fw：TGGGTCCTCATCACCGCAAGAG；

5’-KO-AP2IV-1-Rv：tctcagggtgcgtggttagaa(PCR1)；

3’-KO-AP2IV-1-Fw：atcagttgttttagtcgaacc；

3’-KO-AP2IV-1-Rv：CTTACCTTGACGAGACATACA(PCR2)；

AP2IV-1-CDS-Fw：TACAATAGAAGTGTCTCGTGAT；

AP2IV-1-CDS-Rv：TCAAGTTTCGTCCACTGCTCC(PCR3)。

the AP2IV-1 gene knockout and identification strategy is shown in FIG. 1, wherein a knockout insect strain has a purposeful band in PCR1/PCR2, a PCR3 has no purposeful band, a wild insect strain has no purposeful band in PCR1/PCR2, and a PCR3 purposeful band, so that the knockout insect strain is a positive monoclonal insect strain. As shown in FIG. 2, the correctly identified AP2IV-1 gene knock-out strain was designated as RH. DELTA.AP 2IV-1 insect strain as the result of PCR identification.

Example 2 detection of proliferation Rate, virulence and immunoprotection of Toxoplasma gondii AP2IV-1 Gene-deleted insect Strain

1. In vitro proliferation experiment of RH delta AP2IV-1 insect strain

The intracellular proliferation rate of the Toxoplasma gondii AP2IV-1 gene deletion strain RH delta AP2IV-1 constructed in example 1 is detected by the following specific method:

the tachyzoites of the freshly released strain Δ Ku80RH and RH Δ AP2IV-1 were collected and inoculated 10 separately⁵Tachyzoites were plated into 12-well plates (sterile cell slides prior to plating) confluent with HFF cells (human foreskin fibroblasts, purchased from ATCC). After 1h of inoculation, uninvaded insects are washed away, and the culture is continued in an incubator. Culturing for 24h orAfter 48h, the IFA test was carried out by the following specific method:

cells infected with Toxoplasma gondii were fixed in 4% paraformaldehyde at 37 ℃ for 30 min.

② permeabilization in 0.25 percent Triton X-100 for 30min at the temperature of 37 ℃.

③ at 37 ℃, blocking in 3% BSA for 30 min.

Fourth, primary antibody against rabbit-derived Toxoplasma gondii GAP45 protein (Plattner, F., Yarovinsky, F., Romero, S., Didry, D., Carlier, M.F., Sher, A.and Soldat-Favre, D. (2008), Toxoplasma profiler infection for HOST cell induction and TLR11-dependent induction of an interneukin-12 response. CELL HOST MICROBE 3,77-87.) was added, incubated at 37 ℃ for 1h, and washed with PBS 3 times.

Adding secondary antibody FITC/Cy3 labeled goat anti-mouse IgG (H + L) and nuclear dye Hoechst33258 (both purchased from Beijing Meichen science and technology Co., Ltd.), and incubating at 37 deg.C for 1H. PBS was washed 3 times.

Sixthly, 10 mu L of anti-fluorescence quencher mounting patch is added on the flying patch, and the number of the tachyzoites in the nawei insect vacuole is counted under a fluorescence microscope.

The results are shown in FIG. 3, where the average number of tachyzoites in the vacuolar membranes of the Naphlus nauplii of the RH. DELTA.AP 2IV-1 insect strain is reduced by 78.2% compared to the outbreak strain after 24h of growth in HFF cells.

2. Mouse toxicity experiment of RH delta AP2IV-1 insect strain

The toxity of the toxoplasma gondii AP2IV-1 gene-deleted insect strain RH delta AP2IV-1 constructed in the example 1 is detected by the following specific method:

intracellular RH delta AP2IV-1 insect strain was collected and ICR mice (female, 7 weeks) were intraperitoneally inoculated at doses of 10 each⁴、10⁵、5×10⁶Individual tachyzoites, simultaneously inoculated 10⁴Δ Ku80RH tachyzoite was used as a control group of 5 mice each. The 5 groups of mice were individually housed in the same environment, and the survival of the mice was recorded daily for 30 days.

The results are shown in FIG. 4. The results show that mice vaccinated with the Δ Ku80RH strain all died within day 8, whereas mice vaccinated with different doses of the RH Δ AP2IV-1 worm strain all survived and no encapsulation was detected in the mouse brain after 40 days of infection.

3. Mouse immune protection experiment of RH delta AP2IV-1 insect strain

The RH delta AP2IV-1 insect strain is adopted to immunize a mouse, the immune protective efficacy is verified, and the experimental procedures such as immunization, toxicity attacking, detection and the like are schematically shown in figure 5, and the specific method is as follows:

(1) ICR mice (female, 7 weeks) were each immunized 10 times separately⁴RH DELTA AP2IV-1 tachyzoites (immunized group) and non-immunized mice were used as controls (non-immunized group), and the mice in each group were raised under the same conditions. After 30 and 150 days of immunization, mice in partially immunized and non-immunized groups were randomly bled from the orbit (no less than 10 per group), and sera were isolated and stored at-20 ℃ for later use (for humoral and cellular immune monitoring in example 3).

(2) After 30 days and 150 days of immunization, respectively, the immunized and non-immunized groups were challenged with different types of toxoplasma strains: type I insect strains: RH; type II insect strains: PRU, Me 49; PRU capsules (available from ATCC) and Chinese type 1 (Cheng, w., Liu, f., Li, m., Hu, x., Chen, h.and Pappoe, f., et al (2015). Variation detection based on next-generation sequence of type Chinese 1 constructs of Toxoplasma mineral with differential front from china bmc gemomics 16,888.). Mice in the immunized group and the non-immunized group, each of which had a dose of 5 cysts, were sacrificed 40 days after challenge, and the number of brain cysts per mouse was examined. The specific information of toxoplasma gondii strains which were attacked twice respectively and have different types is shown in table 4.

TABLE 4 strains, doses and challenge regimens for 30 days and 150 post-immunization challenge

Specific information for two separate challenges of PRU capsules at different doses is shown in table 5.

TABLE 5 PRU encapsulation dose and challenge regimen for 30 days and 150 post-immunization challenge

The results of the test of challenge of mice 30 days after immunization are shown in FIG. 6. The results show that the immunized mice are not killed when infected with different types of toxoplasma strains; non-immunized mice were infected 10⁵Δ Ku80RH, PRU, Me49, tachyzoite chinese type 1, mice all died during the acute phase. When the dose of the attacking PRU capsule is in the range of 5-100, all mice in the immunization group survive, and the mice do not have any clinical symptoms; in the non-immunized group, mice encapsulated with 5 challenge doses showed no death phenomenon, but showed obvious clinical symptoms, and the number of deaths of the mice increased with the increase of the challenge dose. After 40 days of challenge, the number of encysted brain cells in the mice was counted. The results show that the encysted quantity of the mouse brain of the immune group is obviously reduced compared with that of the non-immune group.

The test results of the mice after 150 days of immunization for virus challenge are shown in fig. 7, and the results are similar to the test results of the virus challenge after 30 days of immunization. The result shows that after the RH delta AP2IV-1 insect strain is used for immunizing a mouse for 150 days, the strain can still play a good protection role on different types of toxoplasma gondii strains and different numbers of PRU cysts.

Example 3 monitoring of humoral and cellular immune responses in hosts immunized with the RH. DELTA.AP 2IV-1 insect Strain

The humoral immunity and cellular immune response of the mice immunized by the RH delta AP2IV-1 insect strain in the example 2 are detected by the following specific method:

(1) antigen coating: whole Toxoplasma gondii antigen was prepared, and 100. mu.L (5. mu.g/ml, PBS) was added to a 96-well plate overnight at 4 ℃.

(2) And (3) sealing: add 300. mu.L PBST per well, let stand for 5min, spin-dry, repeat washing 5 times, block 1% BSA for 1 hour at room temperature.

(3) Primary antibody (mouse serum) was added: after 5 washes in the same step (2), 100. mu.L (1:25 dilution) of mouse serum was added and incubated at 37 ℃ for 1 hour.

(4) Adding a secondary antibody: washing 5 times in the same step (2), adding a secondary HRP-labeled goat anti-mouse IgG antibody, and incubating at 37 ℃ for 1 hour.

(5) Color development: washing 5 times in the same step (2), adding TMB, and developing at 37 deg.C for 15 min.

(6) And (4) terminating: the reaction was stopped by adding 2mol/L sulfuric acid solution and the value of 450nm was immediately read on a microplate reader.

The concentration of cytokines (IFN-. gamma., IL-10, IL-1) in serum was also measured by ELISA, which was referred to above, and IgG and related cytokine antibodies were purchased from Beijing four-arborvitae Biotech Co., Ltd.

The results are shown in fig. 8, the IgG concentration in serum was significantly higher than that in the non-immunized group when the RH Δ AP2IV-1 strain immunized mice for 30 days and 150 days; the concentration of IFN-gamma, IL-10 and IL-12 cytokines in serum is obviously increased after 30 days of immunization, and the cytokine is recovered to be normal after 150 days of immunization. The results show that the RH delta AP2IV-1 insect strain can provide better humoral immunity and cellular immune response for the host after being immunized.

In conclusion, the invention provides a weak live vaccine for preventing toxoplasma infection, which lacks AP2IV-1 gene, and determines safe immunization dose and immunization program. Through mouse experiments, the toxoplasma strain lacking the AP2IV-1 gene can resist the reinfection of different toxoplasma strains with high dose after being immunized, the PRU cysts infecting mice with different doses (5-100) can be effectively protected, and one-time immunization can provide long-term protection effect. Meanwhile, the immune system can stimulate the host to generate good humoral immunity and cellular immune response. Therefore, the AP2IV-1 gene deletion strain has the potential of preparing the genetic engineering vaccine against the toxoplasma gondii.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> toxoplasma gondii attenuated live vaccine lacking AP2IV-1 gene and construction method thereof

<130>KHP201112079.3

<160>23

<170>SIPOSequenceListing 1.0

<210>1

<211>425

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Ala Tyr Gln Arg Arg Arg Ala Ala Ala Cys Thr Ile Glu Val Ser

1 5 10 15

Arg Asp Leu Phe Ser Pro Glu Arg Asn Leu His Asp Asn Phe Ser Ser

20 25 30

Leu Ala Ile Thr Met Ala Phe Arg Thr Val Ser Lys Val Leu Pro Thr

35 40 45

Leu Ser His Cys Phe Pro Gly Pro Leu Ser Val Ala Ala Ser Ser Ser

50 55 60

Leu Pro Gly His Ser Lys Gly Glu Glu Ser Val Pro Cys Arg Val His

65 70 75 80

Arg Ser Phe Arg Leu Ser Pro Val Ala Asp His Glu Ala Glu Ala Leu

85 90 95

Ser Gly Ser Gly Asn Asp Thr Ser Gly Cys Ser Gln Arg Asp Arg Phe

100 105 110

Cys Ala Gly Asn Gly Ser Asp Cys Lys Ala Arg Arg Thr Ser Asp Gly

115 120 125

Asn Gly Ser Pro Pro Thr Asn Ala Arg Met Ser Glu Lys Leu Ser Leu

130 135 140

Phe Lys Asn His Ala Ser Ser Cys Leu Glu Gln Arg Ala Cys Pro Ala

145 150 155 160

Ser Asn Arg Asn Leu Gly Asp Thr Ala Ala Cys Pro Leu Ser Ala Phe

165 170 175

Cys Arg Ser Leu Val Arg Arg Thr Pro Ser Arg Leu Trp Leu Pro Pro

180 185 190

Gln Cys Ser Leu Leu Ser Gly Cys Ser Ala Arg Ser Cys Pro Pro Lys

195 200 205

Ile Ser Val Arg Ala Thr Asn Gly Ala Ser Glu Gln Ala Ser Trp Gln

210 215 220

Asp Phe His Pro Ala Leu Gly Arg Ala Val Val Pro Leu Ser Leu Ser

225 230 235 240

Gly Arg Gly Thr Ala Gly Thr His Leu Val Arg Lys Phe Gly Thr Gln

245 250 255

Arg Val Val Gln Lys Arg Arg His Gln Met Arg Ile Leu His Pro Ala

260 265 270

Gln Thr Ala Tyr Val Pro Val Glu Gln Arg Pro Pro Pro Ile Pro His

275 280 285

Ser Leu Thr Ala Ser Ser Thr Val Lys Arg Leu Leu Asn Asn Asn Thr

290 295 300

Val Ala Ala Lys Glu Ala Ala Lys Arg Ile Asn Trp Gly Ala Tyr Ile

305 310 315 320

Ser His Gln Arg Gly Val Arg Trp His Pro Gln Gly Ala Trp Arg Val

325 330 335

Gln Phe Ser Arg Arg Asn His Glu Arg Asn Phe Phe Val Arg Cys Glu

340 345 350

Cys Tyr Phe Arg Val Gly Thr Tyr Gly Phe Gln Met Ala Lys Asp Leu

355 360 365

Ala Ile Arg Tyr Arg Gln Arg Leu Glu Lys Glu Trp Glu Glu Leu Gln

370 375 380

Glu Gln Trp Thr Lys Leu Asp Ile Leu Glu Ala Glu Gln Arg Ala Lys

385 390 395 400

Tyr Lys Glu Lys Arg Glu Glu His Leu Leu Leu Gly Ala Gly Glu Glu

405 410 415

Pro Glu Leu His Ser Arg Arg Ser Lys

420 425

<210>2

<211>1278

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atggcctatc agaggcggag agcggcagca tgtacaatag aagtgtctcg tgatcttttc 60

tctcctgaaa gaaacttgca tgacaatttt tcgtctctgg cgataacaat ggcattccgc 120

actgtttcca aagttctccc gaccctaagt cactgtttcc caggtcccct gtcggttgct 180

gcgtcgtcgt ctttgccggg tcattctaaa ggggaggagt ctgtcccatg tcgcgttcac 240

cgttcgtttc gactttctcc cgtagcagat cacgaggctg aggcgctgag tggcagcggt 300

aacgacacct caggttgttc tcagagagat cgtttctgcg caggaaacgg gtcagactgc 360

aaggctcgac gcacatctga cggaaacggc tcccctccta ccaatgcacg catgtccgaa 420

aagctttctc tgttcaagaa ccatgcgtct tcctgtctcg agcagcgtgc gtgccccgcg 480

tccaaccgaa atctgggcga cactgctgcc tgccctctct ctgccttttg tcgctcgctg 540

gttcgccgaa caccctcccg gttatggctt ccgccccaat gttctctgct gtcaggctgc 600

tccgctaggt cttgccctcc taagatctca gtccgagcga ctaacggtgc ctctgaacag 660

gcctcctggc aagactttca ccccgcgttg ggccgggctg tcgtgccgct gtccttgtct 720

ggcaggggca ccgcaggcac tcacctagtc agaaagttcg gaactcagcg cgtggttcag 780

aagcgtcgtc accaaatgcg aattcttcac cctgctcaaa cggcgtacgt gccggttgag 840

cagcgcccac cgcccattcc ccactctctt accgcgtcga gcactgtgaa aagactcttg 900

aacaataaca ccgtagcagc caaggaggcc gcgaagcgca tcaactgggg cgcctacatt 960

tcccaccaga gaggtgtgcg gtggcacccc cagggtgcgt ggcgcgtgca gttctctaga 1020

cggaaccacg aacgaaattt tttcgttcgc tgcgagtgtt acttcagggt cggcacctat 1080

ggcttccaga tggcgaaaga cctggccata cggtatcggc agcgtctcga gaaagaatgg 1140

gaagagcttc aggagcagtg gacgaaactt gatattctgg aggctgaaca gcgggcgaag 1200

tacaaggaga agagggagga gcatctcctc ctaggcgccg gcgaggaacc ggagctccac 1260

tctcggagaa gcaaatag 1278

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gctcggactg agatcttagg 20

<210>4

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gttttagagc tagaaatagc aag 23

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ccttctagac gcatggtaaa 20

<210>6

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tttaccatgc gtctagaagg t 21

<210>7

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ctgtcttgtg tattgaccca tgt 23

<210>8

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ccacatgggt caatacacaa gacagcta 28

<210>9

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ttctagctct aaaaccctaa gat 23

<210>10

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ccatgattac gcctacgtaa atacgtcatg cgcagagatt g 41

<210>11

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

cgccctatag tgagtctcgc gatcccgaag gcacagcaaa a 41

<210>12

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

tgtagcctgc cagaacacgc aggctgggga aacgcgtggg tg 42

<210>13

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

tagggcgaat tggatatcta cacttattca acattatata t 41

<210>14

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gagactcact atagggcgaa ttg 23

<210>15

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

gtgttctggc aggctacagt gaca 24

<210>16

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

gatatccaat tcgccctata gtga 24

<210>17

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

tacgtaggcg taatcatggt catag 25

<210>18

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

tgggtcctca tcaccgcaag ag 22

<210>19

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

tctcagggtg cgtggttaga a 21

<210>20

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

atcagttgtt ttagtcgaac c 21

<210>21

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

cttaccttga cgagacatac a 21

<210>22

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

tacaatagaa gtgtctcgtg at 22

<210>23

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

tcaagtttcg tccactgctc c 21

Claims

Use of AP2IV-1 or an inhibitor thereof for modulating the rate of proliferation or virulence of toxoplasma gondii.
Application of AP2IV-1 or an inhibitor thereof in preparing a toxoplasma attenuated live vaccine.
3. The use of claim 1 or 2, wherein the proliferation rate or virulence of Toxoplasma gondii is reduced by affecting the complete or accurate expression of AP2IV-1 in Toxoplasma gondii, or by down-regulating the expression level of AP2 IV-1.
4. A toxoplasma attenuated strain characterized in that AP2IV-1 is not expressed or the expression level is reduced as compared with the starting toxoplasma strain.
5. The toxoplasma lentus strain according to claim 4, which lacks the AP2IV-1 gene.
6. A construction method of a toxoplasma gondii attenuated strain is characterized in that the toxoplasma gondii attenuated strain is constructed by influencing the complete or accurate expression of AP2IV-1 in the toxoplasma gondii or by down-regulating the expression quantity of AP2 IV-1.
7. The construction method according to claim 6, wherein the complete or accurate expression of AP2IV-1 in Toxoplasma gondii is realized by knocking out the AP2IV-1 gene of Toxoplasma gondii by using CRISPR/Cas9 system;

preferably, the nucleotide sequence of the gRNA used by the CRISPR/Cas9 system is shown in SEQ ID No. 3.
8. Use of the toxoplasma lentum strain of claim 4 or 5 in the manufacture of a medicament for the prevention or treatment of toxoplasma infection.
9. Use of the toxoplasma attenuated strain of claim 4 or 5 in the preparation of a live attenuated toxoplasma vaccine.
10. A attenuated live toxoplasma vaccine comprising the attenuated toxoplasma strain of claim 4 or 5.