CN106947766B - Bacillus subtilis DNA fragment with promoter function and application thereof - Google Patents
Bacillus subtilis DNA fragment with promoter function and application thereof Download PDFInfo
- Publication number
- CN106947766B CN106947766B CN201710235662.0A CN201710235662A CN106947766B CN 106947766 B CN106947766 B CN 106947766B CN 201710235662 A CN201710235662 A CN 201710235662A CN 106947766 B CN106947766 B CN 106947766B
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- seq
- bacillus subtilis
- dna fragment
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/34—Vector systems having a special element relevant for transcription being a transcription initiation element
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a DNA fragment of bacillus subtilis with a promoter function and application thereof. The DNA fragment is any one of the following sequences: (a) a nucleotide sequence shown as SEQ ID NO.1 or a complementary sequence thereof; (b) a nucleotide sequence which is obtained by substituting, deleting or adding one or more nucleotides to the nucleotide sequence shown in SEQ ID NO.1 and has the same function as a promoter as the nucleotide sequence shown in SEQ ID NO.1 or a complementary sequence thereof; (c) a sequence in which one or more ribosome binding sites are added to the nucleotide sequence shown in SEQ ID NO. 1. The DNA fragment has the function of a promoter, has strong expression activity, can realize high expression of exogenous genes under the condition of not adding an inducer, can be applied to expression of heat-resistant beta-galactosidase and transglutaminase, and particularly provides an effective element for a bacillus subtilis expression and secretion system.
Description
Technical Field
The invention relates to a DNA fragment, in particular to a DNA fragment of bacillus subtilis with a promoter function and application thereof.
Background
The production of valuable foreign proteins by genetic recombination techniques is one of the hot spots in biotechnology research and development today. Bacteria have the characteristics of fast growth, easy culture, high expression level and simple molecular operation, which makes them widely developed and applied to the expression of heterologous proteins. Among them, Bacillus subtilis is an ideal host cell for industrial use because of its many advantages of safety, innocuity, clear genetic background, high secretion expression level, etc.
Various elements are required for the expression of heterologous proteins in B.subtilis, where the promoter is crucial for the expression level. There are generally two approaches to genetic engineering of promoters: one way is to perform mutation transformation on the promoter of the target gene, so as to improve the activity of the promoter; the other way is to replace the original promoter with other natural or artificially constructed promoters, thereby thoroughly changing the expression profile of downstream genes and realizing the artificial control of the gene transcription level. The promoters which are successfully used in the expression system of the Bacillus subtilis at present mainly comprise P43, PamyQ, Pspac, PxylA and the like, and the promoters have good performance in enrichment medium in a laboratory, but are rarely used for industrial scale-up production of enzyme proteins. Therefore, it is necessary to find a more efficient promoter suitable for industrial medium production expression to meet the requirement of fermentation for higher and higher expression level.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a DNA fragment of bacillus subtilis with a promoter function.
Another purpose of the invention is to provide an application of the DNA fragment of the bacillus subtilis with the promoter function.
The purpose of the invention is realized by the following technical scheme: a DNA fragment of Bacillus subtilis with a promoter function is any one of the following sequences:
(a) a nucleotide sequence shown as SEQ ID NO.1 or a complementary sequence thereof;
(b) a nucleotide sequence which is obtained by substituting, deleting or adding one or more nucleotides to the nucleotide sequence shown in SEQ ID NO.1 and has the same function as a promoter as the nucleotide sequence shown in SEQ ID NO.1 or a complementary sequence thereof;
(c) a sequence in which one or more ribosome binding sites are added to the nucleotide sequence shown in SEQ ID NO. 1.
The sequence of the ribosome binding site is a nucleotide sequence shown as SEQ ID NO. 2.
The application of the DNA fragment of the bacillus subtilis with the promoter function in protein expression.
A vector comprising a nucleotide sequence shown as SEQ ID No.1 and a sequence of ribosome binding site shown as SEQ ID No. 2.
The carrier is preferably a plasmid carrier, and contains a nucleotide sequence shown as SEQ ID NO. 7.
An expression plasmid comprising the above vector and a nucleotide sequence encoding a heterologous protein operably linked to the vector downstream of the DNA fragment having a promoter function.
The heterologous protein nucleotide sequence is a nucleotide sequence of heat-resistant beta-galactosidase coded by Geobacillus kaustophilus or a nucleotide sequence of transglutaminase coded by Streptomyces mobaraensis.
A recombinant engineered cell is a cell strain obtained by transforming or transducing a host cell with the vector or the plasmid.
The host cell is bacillus.
The host cell is bacillus subtilis.
Compared with the prior art, the invention has the following advantages and effects:
1. the invention relates to a method for detecting a whole gene transcriptome of bacillus subtilis in the later logarithmic growth stage by using an RNA-seq technology, screening a high-expression gene and finding a gene with high transcriptional activity in the bacillus subtilis. Cloning a promoter sequence corresponding to the screened high-expression gene, applying the promoter sequence to the expression of a heat-resistant beta-galactosidase gene (bgaB), and testing the activity of the bgaB to prove that the screened promoter has high activity in bacillus subtilis. The expression of transglutaminase (MTG) was performed, and the protein expression was confirmed by SDS-PAGE electrophoresis.
2. The invention provides a DNA fragment, which is a promoter, has strong specific expression activity, can realize high expression of exogenous genes under the condition of not adding an inducer, is applied to the expression of heat-resistant beta-galactosidase and transglutaminase, and particularly provides an effective tool for expressing the exogenous genes by bacillus subtilis.
Drawings
FIG. 1 is an electrophoretogram of total RNA extracted from Bacillus subtilis at late logarithmic growth phase in example 2; lanes 1 and 2 show total RNA extracted from Bacillus subtilis at late logarithmic growth phase.
FIG. 2 is the amplification of P in example 3ydzAElectrophoretogram of the PCR product of (1); wherein lane M is DNA marker, lanes 1 and 2 are PydzAThe PCR amplification product of (1).
FIG. 3 is the expression plasmid pBE-P of example 4ydzASchematic construction of SamyQ-bgaB.
FIG. 4 is the amplification of P in example 5ydzA+ SamyQ fragment electrophoretogram; wherein lane M is DNA marker, lanes 1 and 2 are PydzA+ SamyQ amplification product.
FIG. 5 is the expression plasmid pBE-P of example 5ydzASchematic construction of SamyQ-proMTG.
FIG. 6 is example 6B. subtilis ATCC6051 (pBE-P)ydzASamyQ-proMTG) transformant MTG expression SDS-PAGE gel images; wherein lane M is protein marker, lane 1 is B.subtilis ATCCC 6051 exocytosis protein, lane 2 is B.subtilis ATCC6051 (pBE-P)ydzASamyQ-proMTG) extracellular secretion protein, the arrow indicating the position of the protein of interest MTG.
Detailed Description
The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto.
The techniques of molecular biology experiments used in the following examples include PCR amplification, plasmid extraction, DNA fragmentation, ligation, gel electrophoresis, etc., as described in detail in molecular cloning, A laboratory Manual (third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peyer et al, 2002, Beijing: scientific Press).
Bacterial RNA is extracted from the late logarithmic phase of production of a strain of Bacillus subtilis 168 (purchased from Guangdong province culture Collection of microorganisms). And (3) performing transcriptome sequencing on the bacterial RNA to build a library, removing ribosomal RNA, and performing reverse transcription on mRNA to build a cDNA library. The bacterial whole transcriptome was analyzed, and genes with higher expression level were judged according to the RPKM value representing the gene transcription level, and then the promoter region was analyzed. The selected promoter was ligated into a vector, and the activity of the promoter in Bacillus subtilis was determined.
Example 1
And (3) culturing bacteria: taking out Bacillus subtilis 168 from a glycerol tube at-80 deg.C, streaking on an LB solid plate, culturing at 37 deg.C for 16-24 h, selecting single colony in 10mL LB liquid culture medium containing 1% corn starch at 37 deg.C, and culturing at 200rpm to OD60020 to 25 (spectrophotometer, Hitachi, Japan).
Example 2
Extracting total RNA of bacteria, establishing a transcriptome library and sequencing RNA-Seq: 1mL of the cell culture solution obtained in example 1 was collected and subjected to rapid centrifugation at 8000g for 1min for extraction of bacterial total RNA (see FIG. 1). The specific extraction method is referred to bacterial total RNA extraction kit of omega Bio-tek company. Samples for RNA-Seq sequencing library preparation were qualified by Agilent technologies 2100Bioanalyzer, mixed DNA molecules were treated with DNaseI (RNase free), rRNA, which accounted for the majority of total RNA, was removed using Ribo-Zero (Gram-Positive Bacteria) kit (USA), and the resulting mRNA was purified. The mRNA was first fragmented into fragments of appropriate size, double-stranded cDNA was synthesized using the fragmented mRNA as a template and adding reverse transcriptase and random primers, and then the synthesized cDNA was purified using the QIAquick PCR Purification Kit (Qiagen). The sticky end of the cDNA is filled in and an adenine nucleotide is added to one strand to pair the primary linker sequence containing the overhanging T with this overhanging A. PCR amplification is carried out under the condition that primers capable of respectively matching two ends of a primary joint exist, after multiple cycles, gel electrophoresis is carried out on the PCR result, the rubber tape with a preset size is recovered by cutting rubber, and the obtained library consisting of the sequence added with the secondary joint is subjected to on-machine sequencing (according to patent documents, Panli and the like, a DNA fragment with a promoter function and the application, CN201510074949.0[ P ] 2015. method). Sequencing of RNA-Seq libraries sequencing services were provided by Diao Biotechnology, Inc., Youzhou. In sequencing, 100bp sequence information from both ends toward the center (PE100) was read, and these reads were aligned with the bacterial genome to allow for subsequent bioinformatic analyses such as annotation and expression level calculation.
Example 3
Screening and cloning of promoter fragments: analyzing the structure of a bacillus subtilis transcript by RNA-Seq sequencing data and analyzing a gene containing a transcription starting position by a whole genome, and screening a gene with high expression quantity by RPKM (reverse transcription-polymerase chain reaction) quantification, wherein the nucleotide sequence of the gene is shown as follows:
CGTTCTGTTACAGATGGAGGCGACAGCTTAATTTTTCTGCCTAATTCCCTCATCGACAAACGGCTGTCCTTCTTCAGCTCCTCAATGATATTCAGATCAATCTGGTCAAGTTTCATTTCAACATCCTTCTTTTTTGATTTTGTACACATTATCTCGGGTATTTTTGTAAATGACAAGTACAGTTCCCTAGAAAAGGCATGTAAAAATGAATGTTTTCCGAACATTTTTTGAAAGCTGTCATATGCCCCCCCGGATTGTTTATAGTATAAAATGAAAACGTGTCCACAAGGAGGGCGATTT。
taking genome DNA of a strain Bacillus subtilis 168 as a template and a primer F-PydzA(5'-CGGAATTCCGTTCTGTTACAGATGGAGG-3') and R-PydzA(5'-GGACTAGTAAATCGCCCTCCTTGTGGAC-3') amplification of a DNA fragment of 300bp in size, i.e., PydzAThe promoter fragment (see FIG. 2), is of a size consistent with the product of interest. The restriction sites EcoRI and SpeI were introduced.
Example 4
Construction of the bgaB expression plasmid: the plasmid pBE-rbs-SamyQ-bgaB (Panli et al, patent literature, a DNA fragment with promoter function and its application CN201610430767.7[ P201610430767.7 ]]2016. construction) into an expression plasmid, which was cut into linear plasmids at the cleavage sites with the restriction enzymes EcoRI and SpeI, and the P-plasmid with the cleavage sites EcoRI and SpeI obtained in example 3 was usedydzAThe promoter fragment is inserted into the linear plasmid after enzyme digestion and purification to construct a bgaB gene extracellular expression plasmid pBE-P of the target promoterydzASamyQ-bgaB (see FIG. 3).
Example 5
Construction of MTG expression plasmid: the plasmid pBEp43-proMTG (according to patent literature: Panli et al. a recombinant bacillus subtilis and a method for producing transglutaminase CN201210052578.2[ P201210052578.2 ]]2012) was constructed as an expression plasmid with restriction sites for the restriction enzymes EcoRI and BamHI. With P BE-PydzA-SamyQ-bgaB plasmid as template, primer F-PydzA(5’-CGGAATTCCGTTCTG TTACAGATGGAGG-3 ') and R-SamyQ (5'-AAGGATCCGGCTGATGTTTTTGTAA TCG-3') amplifying about 450bp P with EcoRI enzyme cutting site at 5 ' end and BamHI enzyme cutting site at 3 ' endydzAThe SamyQ fragment (see FIG. 4). Digestion of P with the restriction enzymes EcoRI and BamHIydzARecovering and purifying SamyQ segment, inserting into plasmid pBEp43-proMT G cut by the same endonuclease to obtain extracellular plasmid pBE-P expressed by MTGydzASamyQ-proMTG (see FIG. 5). Wherein: pydzA-the SamyQ nucleotide sequence is:
CGTTCTGTTACAGATGGAGGCGACAGCTTAATTTTTCTGCCTAATTCCCTCATCGACAAACGGCTGTCCTTCTTCAGCTCCTCAATGATATTCAGATCAATCTGGTCAAGTTTCATTTCAACATCCTTCTTTTTTGATTTTGTACACATTATCTCGGGTATTTTTGTAAATGACAAGTACAGTTCCCTAGAAAAGGCATGTAAAAATGAATGTTTTCCGAACATTTTTTGAAAGCTGTCATATGCCCCCCCGGATTGTTTATAGTATAAAATGAAAACGTGTCCACAAGGAGGGCGATTTCAATTATAGGTAAGAGAGGAATGTCGACATGATTCAAAAACGAAAGCGGACAGTTTCGTTCAGACTTGTGCTTATGTGCACGCTGTTATTTGTCAGTTTGCCGATTACAAAAACATCAGCC。
example 6
Detection of promoter expression level: the well-constructed bgaB expression plasmid pBE-P of the target promoterydzASamyQ-bgaB and MTG expression plasmid pBE-PydzASamyQ-proMTG and plasmid pBEp43-proMTG (according to the patent literature: Panli et al. A recombinant Bacillus subtilis strain and a method for producing transglutaminase CN201210052578.2[ P]2012) transforming into Escherichia coli (E.coli JM110) by chemical transformation method to obtain positive clone, sequencing, extracting plasmid, transforming into Bacillus subtilis ATCC6051 by electric transformation method, wherein the method refers to non-patent literature to record Natalia P, Zakataeva, Oksana V et al.A. simple method to integrate plasmid-free genetic modification into natural chromosome of naturally transformed Bacillus amyloliquefaciens strain [ J]Appl Microbiol Biotechnol.2010,85:1201-1209) to obtain the transformed strain B.subtilis ATCC6051 (pBE-P)ydzA-SamyQ-bgaB)、B.subtilis ATCC6051(pBE-PydzASamyQ-proMTG) and B.subtilis ATCC6051(pBEp 43-proMTG).
The resulting transformant B.subtilis ATCC6051 (pBE-P)ydzA-SamyQ-bgaB)、B.subtilisATCC6051(pBE-PydzASamyQ-proMTG) and B.subtilis ATCC6051(pBEp43-proMTG) were cultured in 10mL LB medium (kanamycin 20. mu.g/mL), activated at 37 ℃ for 12h at 200rpm, and the activated seed broth was inoculated into 50mL LB medium (kanamycin 20. mu.g/mL, 1% (w/w) corn starch) in an amount of 1% (volume ratio), fermented at 37 ℃ for 48h at 200rpm, and sampled every 12 hours.
β determination of enzyme Activity of glucosylcalactosidase enzyme 32. mu.L of fermentation supernatant was mixed with 288. mu.L of 0.25% ONPG (o-Nitrophenyl- β -D-Galactopyranoside, o-nitrobenzene β -D-Galactopyranoside), incubated at 55 ℃ for 15min, and 320. mu.L of 10% (w/w) Na was added to terminate the reaction2CO3The control strain B. subtilis ATCC6051(pBE-rbs-SamyQ-bgaB) has no chromogenic reaction, and the absorbance measured at 405nm is almost the same as that of the blank control (LB), and has no β -glucose galactosidase activityydzAβ -glucose galactosidase expression is started, and the highest enzyme activity of 44.3U/mL is achieved within 36 h.
SDS-PAGE: the supernatant was centrifuged at 36h and subjected to SDS-PAGE, which showed a band at 44-46kDa and a band at MTG protein size in comparison with wild type Bacillus subtilis ATCC6051, and the results showed that MTG pro-protease was expressed (see FIG. 6).
Taking 0.2mL of fermentation supernatant, adding 50 mu L of 0.1% trypsin, uniformly mixing the mixture, performing water bath at 37 ℃ for 10min to obtain mature transglutaminase, performing enzyme activity determination by adopting a Crossowicz colorimetric method, taking N- α -CBZ-Gln-Gly as a substrate, uniformly mixing 150 mu L of the substrate and 50 mu L of activated mature enzyme, reacting at 37 ℃ for 10min, quickly adding 200 mu L of a reaction terminator hydrochloric acid-ferric chloride-trichloroacetic acid (3 molL/hydrochloric acid, 12% (v/v) trichloroacetic acid and 5% (w/v) ferric chloride are mixed according to the proportion of 1:1: 1), simultaneously making a standard curve by using L-glutamic acid-gamma-monohydroxyhydroxamic acid, measuring the absorbance of the reaction solution at 525nm by using an enzyme labeling instrument, wherein the enzyme activity unit is defined as that the enzyme activity unit is used for catalyzing N- α -Z-Gln-Gly to generate 1 mu mol L-Gln-Gly at 37 ℃, and the absorbance is obtained by using an enzyme labeling instrumentThe amount of enzyme required for glutamic acid-gamma-monohydroxyhydroxamic acid. Wild strain B.subtilis ATCC6051 has no color reaction, the light absorption value is almost the same as that of a blank control (LB), and the activity of transglutaminase is not existed. The results show that the promoter PydzAThe highest enzyme activity of 82.68U/mL is achieved after the MTG is expressed for 36h, and compared with the enzyme activity 61.59U/mL of the MTG expressed by the traditional strong promoter p43 at 36h, the enzyme activity is 1.3 times higher.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> university of southern China's science
<120> DNA fragment of bacillus subtilis with promoter function and application thereof
<130>1
<160>7
<170>PatentIn version 3.5
<210>1
<211>300
<212>DNA
<213> Bacillus subtilis
<400>1
cgttctgtta cagatggagg cgacagctta atttttctgc ctaattccct catcgacaaa 60
cggctgtcct tcttcagctc ctcaatgata ttcagatcaa tctggtcaag tttcatttca 120
acatccttct tttttgattt tgtacacatt atctcgggta tttttgtaaa tgacaagtac 180
agttccctag aaaaggcatg taaaaatgaa tgttttccga acattttttg aaagctgtca 240
tatgcccccc cggattgttt atagtataaa atgaaaacgt gtccacaagg agggcgattt 300
<210>2
<211>28
<212>DNA
<213>Artificial Sequence
<220>
<223> sequence of ribosome binding site
<400>2
caattatagg taagagagga atgtcgac 28
<210>3
<211>28
<212>DNA
<213>Artificial Sequence
<220>
<223>F-PydzA
<400>3
cggaattccg ttctgttaca gatggagg 28
<210>4
<211>28
<212>DNA
<213>Artificial Sequence
<220>
<223>R-PydzA
<400>4
ggactagtaa atcgccctcc ttgtggac 28
<210>5
<211>28
<212>DNA
<213>Artificial Sequence
<220>
<223>R-SamyQ
<400>5
aaggatccgg ctgatgtttt tgtaatcg 28
<210>6
<211>421
<212>DNA
<213>Artificial Sequence
<220>
<223>PydzA-SamyQ
<400>6
cgttctgtta cagatggagg cgacagctta atttttctgc ctaattccct catcgacaaa 60
cggctgtcct tcttcagctc ctcaatgata ttcagatcaa tctggtcaag tttcatttca 120
acatccttct tttttgattt tgtacacatt atctcgggta tttttgtaaa tgacaagtac 180
agttccctag aaaaggcatg taaaaatgaa tgttttccga acattttttg aaagctgtca 240
tatgcccccc cggattgttt atagtataaa atgaaaacgt gtccacaagg agggcgattt 300
caattatagg taagagagga atgtcgacat gattcaaaaa cgaaagcgga cagtttcgtt 360
cagacttgtg cttatgtgca cgctgttatt tgtcagtttg ccgattacaa aaacatcagc 420
c 421
<210>7
<211>328
<212>DNA
<213>Artificial Sequence
<220>
<223> DNA fragment + ribosome binding sequence
<400>7
cgttctgtta cagatggagg cgacagctta atttttctgc ctaattccct catcgacaaa 60
cggctgtcct tcttcagctc ctcaatgata ttcagatcaa tctggtcaag tttcatttca 120
acatccttct tttttgattt tgtacacatt atctcgggta tttttgtaaa tgacaagtac 180
agttccctag aaaaggcatg taaaaatgaa tgttttccga acattttttg aaagctgtca 240
tatgcccccc cggattgttt atagtataaa atgaaaacgt gtccacaagg agggcgattt 300
caattatagg taagagagga atgtcgac 328
Claims (8)
1. A DNA fragment of Bacillus subtilis with a promoter function is characterized in that the DNA fragment has any one of the following sequences:
(a) a nucleotide sequence shown as SEQ ID NO.1 or a complementary sequence thereof;
(b) a sequence of adding a ribosome binding site to the nucleotide sequence shown as SEQ ID NO.1, wherein the nucleotide sequence is shown as SEQ ID NO. 7.
2. Use of the Bacillus subtilis DNA fragment having promoter function according to claim 1 for protein expression.
3. A carrier, characterized by: comprises a nucleotide sequence shown as SEQ ID NO.1 or a nucleotide sequence shown as SEQ ID NO. 7.
4. An expression plasmid, characterized in that: comprises a nucleotide sequence shown as SEQ ID NO.1 or a nucleotide sequence shown as SEQ ID NO.7 and a nucleotide sequence which is operably connected with the sequence and is positioned at the downstream of the sequence and codes heterologous protein.
5. The expression plasmid of claim 4, wherein: the heterologous protein nucleotide sequence is Bacillus thermohaliotis (A)Geobacillus kaustophilus) Nucleotide sequence encoding a thermotolerant β -galactosidase, or Streptomyces mobaraensis: (Streptomyces mobaraensia) A nucleotide sequence encoding a transglutaminase.
6. A recombinantly engineered cell characterized by: a cell line obtained by transforming or transducing a host cell with the vector of claim 3 or the plasmid of claim 4 or 5.
7. The recombinantly engineered cell of claim 6, wherein: the host cell is bacillus.
8. The recombinantly engineered cell of claim 7, wherein: the host cell is bacillus subtilis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710235662.0A CN106947766B (en) | 2017-04-12 | 2017-04-12 | Bacillus subtilis DNA fragment with promoter function and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710235662.0A CN106947766B (en) | 2017-04-12 | 2017-04-12 | Bacillus subtilis DNA fragment with promoter function and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106947766A CN106947766A (en) | 2017-07-14 |
| CN106947766B true CN106947766B (en) | 2020-08-18 |
Family
ID=59475550
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710235662.0A Active CN106947766B (en) | 2017-04-12 | 2017-04-12 | Bacillus subtilis DNA fragment with promoter function and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106947766B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107698668A (en) * | 2017-10-23 | 2018-02-16 | 华南理工大学 | A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency |
| CN107698670A (en) * | 2017-10-23 | 2018-02-16 | 华南理工大学 | A kind of signal peptide for improving protein secretion efficiency and its application |
| CN107936096A (en) * | 2017-10-23 | 2018-04-20 | 华南理工大学 | A kind of signal peptide that can effectively improve protein secretion efficiency and its application |
| CN107857802A (en) * | 2017-10-23 | 2018-03-30 | 华南理工大学 | A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency |
| CN107698669A (en) * | 2017-10-23 | 2018-02-16 | 华南理工大学 | A kind of signal peptide for improving secernment efficiency and its application |
| CN107759675A (en) * | 2017-10-23 | 2018-03-06 | 华南理工大学 | A kind of signal peptide and its application that secernment efficiency can be improved from bacillus subtilis |
| CN113957071B (en) * | 2021-09-30 | 2023-07-18 | 华南理工大学 | Combined DNA fragment with double promoter and double secretion signal functions and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086025A (en) * | 2016-06-15 | 2016-11-09 | 华南理工大学 | A kind of DNA fragmentation with promoter function and application thereof |
-
2017
- 2017-04-12 CN CN201710235662.0A patent/CN106947766B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086025A (en) * | 2016-06-15 | 2016-11-09 | 华南理工大学 | A kind of DNA fragmentation with promoter function and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Genbank Accession：CP010052.1;《Genbank》;《NCBI》;20141204;全文 * |
| Sigma因子和启动子上游区在苏云金芽胞杆菌杀虫晶体蛋白基因表达调控中的作用;张利莉等;《中国生物工程杂志》;20030331;第23卷(第3期);第50-54页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106947766A (en) | 2017-07-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947766B (en) | Bacillus subtilis DNA fragment with promoter function and application thereof | |
| US20070059768A1 (en) | Broad host range vectors for shotgun and expression library cloning in Gram negative bacteria | |
| CN106086025B (en) | DNA fragment with promoter function and application thereof | |
| US11236363B2 (en) | Hybrid proteins and uses thereof | |
| CN111607613A (en) | Plasmid vector for expressing mRNA of cellular immune vaccine and construction method and application thereof | |
| CN104630229B (en) | A kind of DNA fragmentation and application with promoter function | |
| CN107119051B (en) | Bacillus megaterium DNA fragment with promoter function and application thereof | |
| CN107723287B (en) | Expression system for enhancing production and preparation of silk protein | |
| CN116286931B (en) | Double-plasmid system for rapid gene editing of Ralstonia eutropha and application thereof | |
| CN115605597A (en) | Method for generating constitutive bacterial promoters conferring low to moderate expression | |
| Söderberg et al. | Aliivibrio wodanis as a production host: development of genetic tools for expression of cold-active enzymes | |
| Xin et al. | Development and application of a CRISPR-dCpf1 assisted multiplex gene regulation system in Bacillus amyloliquefaciens LB1ba02 | |
| JP3944577B2 (en) | Method for producing recombinant proteins in Rhodococcus bacteria | |
| EP4114956A1 (en) | Shuttle vector for expression in e. coli and bacilli | |
| CN113278646A (en) | Method for constructing rice polygene editing mutant library and application | |
| TWI567197B (en) | Expression element, expression cassette, and vector containing the same | |
| CN113817736B (en) | Promoter with quorum sensing characteristics and application thereof | |
| CN107857801B (en) | Signal peptide capable of improving secretion efficiency and application thereof | |
| WO2023233996A1 (en) | Modified promoter, expression vector, microorganism, production method for substance, modified cyanobacteria, and manufacturing method for modified promoter | |
| Johansson Söderberg et al. | Aliivibrio wodanis as a production host: development of genetic tools for expression of cold-active enzymes | |
| CN107841510B (en) | Method for controlling expression ratio of different genes horizontally after transcription of prokaryotic cell | |
| CN118308393A (en) | Expression system of escherichia coli without antibiotic resistance marker, construction method and application thereof | |
| CN117683700A (en) | Genetically engineered bacterium for high-expression recombinant collagen and application thereof | |
| KR101161273B1 (en) | Novel pullulanase from uncultured microbial metagenome, and the strains thereof | |
| CN116790648A (en) | Auxiliary P-plasmid for transposase directed evolution, system for transposase directed evolution and Tn5 transposase mutant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |