CN116790648A - Auxiliary P-plasmid for transposase directed evolution, system for transposase directed evolution and Tn5 transposase mutant - Google Patents

Abstract

The application discloses an auxiliary P-plasmid for directed evolution of transposase, which comprises an induced expressed PIII neg gene and is used for expressing antagonistic protein PIII neg; and a transposase specific recognition sequence and effecting association of transposase activity with the level of expression of the phage antagonistic protein PIII neg. Also disclosed are systems, methods, and Tn5 transposase mutants obtained by directed evolution of transposase. The application utilizes the competition relationship of PIII and PIII neg proteins, and adds a transposase specific recognition sequence at the side wing of a PIII neg gene promoter to correlate the activity of transposase with the growth of progeny phage, thereby screening transposase with higher activity.

Description

Auxiliary P-plasmid for transposase directed evolution, system for transposase directed evolution and Tn5 transposase mutant

Technical Field

The application relates to an auxiliary P-plasmid for transposase directed evolution, a system for transposase directed evolution and Tn5 transposase mutants, and belongs to the technical field of biology.

Background

Transposases are widely found in nature and are considered to be one of the important driving forces for genome rearrangement and evolution. Tn5 transposase is a common transposase, is a core protein in one-step enzymatic library construction technology, forms a multi-component complex of Tn5 protein and a linker sequence through in vitro assembly, and adds specific linkers to both ends of each DNA fragment while breaking genomic DNA depending on the "cut and paste" activity of the transposase. The linker sequence is typically composed of three parts, including primer binding sequences for PCR amplification and sequencing of DNA fragments, barcode tags for sample tracing, and ME sequences of 19bp in length specifically recognized by Tn5 transposase (AGATGTGTATAAGAGACAG). The length of the interrupted genome fragment is optimally about 300bp under the restriction of single read length of second-generation sequencing. However, due to the influence of factors such as enzyme activity, an assembly system and the like, the genome cannot be completely broken, and the existence of a large number of overlong fragments seriously damages the quality of enzymatic library construction. Meanwhile, the wild Tn5 transposase protein has certain preference, so that the uniformity and coverage of library construction cannot meet the requirements.

On the other hand, with the rise and wide application of CUT & Tag technology, people put higher demands on the "CUT and paste" activity of Tn5 transposase. In the CUT & Tag technology, the DNA sequence interacting with the target protein is directed to be CUT by Tn5 transposase and a linker is added to achieve directed banking by utilizing the specific recognition and binding of the antibody to the target protein (antigen) and the binding of the non-specific antibody binding protein to the antibody constant region. The binding site of the target protein on the genome can then be identified by sequencing. Compared with the traditional Chip-Seq and other technologies, the method has the advantages that the input amount of the DNA of CUT & Tag is lower, the experimental period is shorter, the specific affinity of antigen and antibody and the specific amplification of linker PCR are added, the signal to noise ratio of sequencing is higher, and the method can be better used for researching the fields of epigenetic science, interactions among macromolecules and the like.

Therefore, it is important to develop an efficient screening method for enzyme activity to obtain transposases with higher enzyme activities.

Disclosure of Invention

The application aims to provide an auxiliary P-plasmid for the directed evolution of transposase, which can assist in rapid screening of transposase with higher enzyme activity.

The application adopts the technical scheme that: an helper P-plasmid for directed evolution of a transposase, the helper P-plasmid comprising an induced expressed PIII neg gene for expression of an antagonistic protein PIII neg; and a transposase specific recognition sequence and effecting association of transposase activity with the level of expression of the phage antagonistic protein PIII neg.

Preferably, the transposase-specific recognition sequence is added flanking the PIII neg gene promoter that is induced to be expressed.

Preferably, the transposase is a Tn5 transposase and the sequence of the transposase-specific recognition sequence is AGATGTGTATAAGAGACAG.

Preferably, the transposase specific recognition sequences are present in pairs, flanking the PIII neg gene promoter that is induced to be expressed.

Preferably, the transposase specific recognition sequence may be in one, two or three pairs of tandem, such as three pairs of tandem, and the structure is MEMEME-promoter-MEME.

Preferably, the PIII neg gene promoter of induced expression comprises a transcription factor binding region and a repressor protein binding region, the transcription factor binding region being P _lac 、P _tet 、P _BAD Or P _trp The repressor binding region is a LacI protein binding sequence, a TetR protein binding sequence, or an AraC protein binding sequence.

The application also discloses a system for directional evolution of transposase, which comprises:

helper p+ plasmids, phage recombinant genomes carrying transposases, host cells, and also helper P-plasmids as described above;

the auxiliary P+ plasmid comprises a gIII gene which is expressed in an induction way and is used for expressing PIII protein of phage capsid protein;

the gIII gene of phage in the phage recombinant genome carrying the transposase is replaced with the coding sequence of the transposase, and the coding sequence of the transposase is under the control of a gIII gene promoter;

the helper p+ plasmid, helper P-plasmid, and phage recombinant genome carrying the transposase are transformed into the host cell. Wherein the PIII neg gene of the auxiliary P-plasmid and the gIII gene of the auxiliary P+ plasmid are induced to express by different substances.

Preferably, the gIII gene in the helper P+ plasmid is expressed by induction of anhydrotetracycline.

Preferably, the phage recombinant genome is a phage recombinant genome library comprising different transposase mutants obtained by error-prone PCR methods.

The application also discloses a Tn5 transposase mutant, which comprises any one or at least two combinations of D11G, I117K, R or I316 on the basis of the amino acid sequence SEQ ID No. 1.

The application also discloses a Tn5 transposase mutant, which has the following amino acid substitution sites in the sequence shown in SEQ ID No. 1: d11G, I117K, R, I316; wherein R210, I316 are any mutations; I117K, D G is a specific mutation.

Preferably, the sequence is shown in SEQ ID No. 2.

A method for directed evolution of a transposase comprising the steps of:

(1) Constructing the auxiliary P+ plasmid and the auxiliary P-plasmid, transforming the auxiliary P+ plasmid and the auxiliary P-plasmid into host cells, and screening positive clones;

(2) Preparing a transposase mutation library; amplifying a genome region of the phage except for the gIII gene, and carrying out homologous recombination with the transposase mutation library to obtain a phage recombination genome carrying transposase;

(3) Taking the positive clone obtained in the step (1) infected by the phage recombinant genome carrying the transposase obtained in the step (2), culturing, and inducing and expressing PIII neg genes and gIII genes in the culturing process;

(4) Collecting phage particles in the supernatant after the culture is finished, infecting positive clones obtained in the step (1), and repeating the steps (3) and (4) for a plurality of times to obtain the evolved transposase.

The transposase may be a Tn5 transposase, mu transposase, tn10 transposase, or an engineered transposase. The evolution method provided by the application is applicable to all transposase types, and the corresponding recognition region sequence needs to be replaced, which is predictable by a person skilled in the art and belongs to the inventive concept of the application.

The application provides a method for directed evolution of transposase, which utilizes the competition relationship of PIII and PIII neg proteins (the latter are proteins which prevent phage growth, and amino acid sequences refer to Carlson JC et al, negative selection and stringency modulation in phage-assisted continuous resolution. Nat Chem biol.2014 Mar;10 (3): 216-22), and associates the activity of transposase with the growth of progeny phage by adding a transposase specific recognition sequence at the side of a PIII neg gene promoter. When the high-activity transposase mutant is expressed in the cell, the expression quantity of the PIII neg protein is reduced due to the deletion of the promoter, and the abundance of the PIII protein in the cell exceeds that of the PIII neg, so that the normal reproduction of the progeny phage is realized. After a certain number of generations of screening, the screening pressure can be increased by decreasing the anhydrotetracycline concentration and increasing the IPTG concentration. At this time, PIII expression is down-regulated, PIII neg expression is up-regulated, and the progeny phage needs a higher activity transposase to ensure the reproduction of the progeny phage, so that the higher activity transposase is screened out. The application also constructs phage library expressing different transposase mutants by means of error-prone PCR method to realize control of amino acid mutation frequency and greatly shorten passage period. By utilizing the directed evolution method, a novel mutant of Tn5 transposase is obtained, and compared with the wild Tn5 transposase, the nuclease activity of the mutant is obviously improved.

Drawings

Fig. 1: schematic diagram of Tn5 transposase evolution principle;

p+ in FIG. 1 represents a plasmid that can induce expression of phage capsid protein PIII, wherein PIII is induced to be expressed by anhydrotetracycline; phage represents the modified Phage genome, tn5 DNA sequence replaces pIII gene sequence and is controlled by gIII promoter; p-represents a plasmid expressing the antagonistic protein PIII neg, the latter having two sequences of Tn5 recognition sequence ME and lac promoter upstream of the expression cassette, and being expressed by IPTG induction. C (C) _PIII C (C) _Neg Represents the concentration of PIII and PIII neg proteins, respectively, in the cell, only if the PIII concentration is greater than PIII neg (i.e.C _PIII >C _Neg ) When the phage can normally reproduce in the cell.

Fig. 2: a transposase expression test;

in FIG. 2, 0, 0.5 and 1.0 represent IPTG induction concentrations 0, 0.5mM and 1.0mM, respectively, for inducing Tn5 expression.

Fig. 3: testing the intracellular activity of the transposase;

Δrfi in fig. 3 represents the absolute value of the difference in fluorescence intensity compared to when not induced; the abscissa represents different final concentrations of L-arabinose; t50 is E.coli expressing the parent transposase (SEQ. NO. 1) and T51 is E.coli expressing the enriched transposase (SEQ. NO. 2).

Fig. 4: affinity purification of T51 transposase;

in FIG. 4, S represents the supernatant after ultrasonic centrifugation, and P represents the pellet after ultrasonic centrifugation; 1-12 represents the eluent collected by 0-100% gradient elution.

Fig. 5: affinity purification of T50 transposase;

in FIG. 5, S represents the supernatant after ultrasonic centrifugation, and P represents the pellet after ultrasonic centrifugation; 1-12 represents the eluent collected by 0-100% gradient elution.

Fig. 6: testing the in vitro activity of the transposase;

in FIG. 6, 0 to 5.0 represents that the amount of transposase added is 0 to 5.0. Mu.L, respectively.

Detailed Description

The following description of the embodiments of the application is further illustrated in the accompanying drawings, but the description of the examples does not limit the scope of the application in any way.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs, and the terms used herein in this description of the application are for the purpose of describing particular embodiments only and are not intended to be limiting of the application.

The materials or instruments used in the following examples, if not specifically described, were available from conventional commercial sources.

Example 1:

1. helper plasmids (P+ plasmids and P-plasmids) were constructed as shown in FIG. 1 (plasmid templates may be Miller SM et al, phase-assisted continuous and non-continuous evolution. Nat Protoc.2020 Dec;15 (12): 4101-4127. Published templates), where P+ represents a plasmid that induces expression of phage capsid protein PIII, and P+ contains a tetracycline promoter, inducing expression of phage capsid protein PIII. P-represents a plasmid capable of expressing antagonistic protein PIII neg, the P-plasmid comprises Tn5 transposase recognition region ME with a sequence of AGATGTGTATAAGAGACAG (SEQ ID No. 3), and the association of transposase activity and phage antagonistic protein PIII neg expression level is realized;

2. simultaneously transforming helper plasmids (P+ plasmid and P-plasmid) in the step 1 into host escherichia coli cells, and coating the host escherichia coli cells on chloramphenicol and carbenicillin double-antibody LB plates;

3. two pairs of primers are used for respectively amplifying an M13 phage genome region (primer M13 g-F/R) except the PIII gene and a Tn5 protein coding region (primer PT51/PT 52), wherein 0.1mM manganese chloride (other divalent metal ion competition reagent can be added during PCR amplification of the Tn5 fragment to improve the mismatch rate, and finally a random mutation library with 1-5 amino acid mutations on a single sequence is formed. The Tn5 fragment PCR reaction system is as follows:

PT51:GGAAAAAAAAAATGATCACGAGTGCCTTACATCGC(SEQ ID No.4)

PT52:CTCCTTCTAGATTAGATTTTGATACCCTGGGCCAT(SEQ ID No.5)

M13g-F:GGGTATCAAAATCTAATCTAGAAGGAGATTTTCAACATG(SEQ ID No.6)

M13g-R:GGCACTCGTGATCATTTTTTTTTTCCTTTACTCCAAAAA(SEQ ID No.7)

4. after the PCR product is recovered, reference is made to Hieff of the next holy organismPlus One Step Cloning Kit the kit operating manual performs homologous recombination, and the recombinant product is transformed into Escherichia coli containing P+ and P-plasmids and induces PIII expression, and is cultured overnight at 37 ℃ and 200 rpm;

5. separating the supernatant after centrifugation at 15000rpm for 10min at 4 ℃ to obtain a phage library containing Tn5 mutants, and directly infecting escherichia coli;

6. inoculating the transformant of the step 2 into 4mL of liquid culture medium containing corresponding antibiotics, adding 50 mu L of the supernatant of the step 5, and culturing at 37 ℃ and 200rpm for 3 hours;

7. centrifuging the culture solution at 4 ℃ and 15000rpm for 10min, separating supernatant, and inoculating 50 mu L of supernatant into fresh culture solution to culture at 37 ℃ and 200rpm for 3h;

8. simultaneously taking 10 mu L of supernatant, fully mixing with fresh bacterial liquid and semisolid culture medium, pouring the mixture into the upper layer of a solid flat plate, and carrying out inversion culture at 37 ℃ after solidification for overnight;

9. plaque on the double-layer plate is counted and used for estimating phage titer in culture fluid in the passage process;

10. respectively picking a proper amount of plaque by using a gun head, soaking the plaque in a prepared PCR reaction Buffer for more than 20s, adding Taq DNA polymerase, amplifying a Tn5 ORF region in a PCR instrument, and sequencing;

11. carrying out enrichment analysis on the sequencing result, and counting the frequency change of each mutation point;

12. the steps 7-11 are repeated for more than 5 times until the enrichment degree of mutation sites exceeds 80%, the screening pressure in the passage process is the concentration of anhydrotetracycline for inducing the expression of capsid protein PIII, the concentration of anhydrotetracycline (aTc) is smaller and smaller, and the concentration change is shown in the following table:

13. and outputting the amino acid sequence of the dominant mutant according to sequencing information, wherein the amino acid sequence is shown as SEQ ID No. 2.

Example 2:

1. amplifying the sequence of the Tn5 mutant by taking the phage genome with the highest abundance as a template, and connecting the product between NdeI/XhoI cleavage sites of the pET21b (+) plasmid;

the primers were as follows: 21-F: AGGGCATGATCACGAGTGCCTTACATCGC (SEQ ID No. 8)

21-R：GTGGTGGTGGTGCTCGAGTTAGATTTTGATACCC(SEQ ID No.9)

2. The linker was transformed into competent cells of E.coli BL21 (DE 3), and positive transformants were picked for sequence testing to ensure correct amino acid sequence. The positive transformant comprises a target plasmid pET21b-T51;

3. inoculating target clone, culturing at 37 deg.C and 200rpm overnight;

4. and (3) a proper amount of bacterial liquid is coated on a solid culture medium, and 3 clones are randomly selected for protein expression test the next day. As shown in FIG. 2, 0, 0.5 and 1.0 in FIG. 2 represent IPTG induction concentrations 0, 0.5mM and 1.0mM, respectively, for inducing Tn5 expression. The expression level of the target protein after the 3# clone is induced for 4 hours at 37 ℃ is superior to that of other clones, wherein the IPTG concentration is 0.5mM or 1.0mM, and the expression level is not obviously influenced;

5. based on the results of the expression test, optimal induction conditions were selected as shown in the following table. Selecting 3# clone and evolutionary female parent, namely an expression strain of wild Tn5 transposase (the sequence of the wild Tn5 transposase is shown as SEQ ID No. 1), inoculating, and fermenting according to 200mL specification;

6. after the induction, OD value was measured and the cells were collected by centrifugation at 5000rpm at 4℃for 20 min.

Example 3:

1. transforming the constructed pET21b-T51 capable of expressing Tn5 transposase mutant T51 and pET21b-T50 plasmid capable of expressing wild Tn5 transposase T50 with EGFP reporter plasmid into competent cells of escherichia coli BL21 (DE 3), coating the competent cells, and inversely culturing overnight;

2. respectively picking monoclonal to carry out colony PCR identification;

3. inoculating 3 positive clones into fresh 4mL liquid culture medium, and culturing at 37 ℃ and 200rpm overnight;

4. respectively taking 3 cloned cultures according to the proportion of 1%, inoculating the cultures into 5 pieces of 4mL fresh liquid culture medium, and culturing at 37 ℃ and 200rpm until OD ₆₀₀ Adding 0.5mM IPTG to induce transposase expression at a final concentration of about 0.5, and adding arabinose with gradient concentration (final concentration: 1#:0;2#: 0.05%o; 3#: 0.10%o; 4#: 0.15%o; 5#: 0.20%o) to induce EGFP expression after 1 h;

5. culturing for 3h, measuring bacterial liquid concentration, taking bacterial liquid containing 0.1OD bacterial cells into 1.5mL centrifuge tubes, centrifuging at 4 ℃ and 5000rpm for 5min, and removing supernatant;

6. adding 500 μl of 1 x PBS to the precipitate to allow the bacteria to re-suspend, centrifuging at 4deg.C and 5000rpm for 5min, and removing supernatant;

7. repeating the step 5 once;

8. the cells were resuspended with 100 μl of 1 x pbs, the cell fluorescence signal was detected by setting the parameters Ex/em=488 nm/507nm, and the fluorescence intensity at each gradient was subtracted from the fluorescence intensity of the first group (1 # tube). As shown in fig. 3, Δrfi in fig. 3 represents the absolute value of the difference in fluorescence intensity compared to when not induced; the abscissa represents different final concentrations of L-arabinose; t50 is E.coli expressing the parent transposase (SEQ ID No. 1), and T51 is E.coli expressing the enriched transposase (SEQ ID No. 2). The difference of the signals of T51 under different induction gradients compared with the signals under non-induction conditions is larger than T50, which shows that the cleavage activity of the transposase mutant in vivo is obviously higher than that of the parent transposase. Specific methods can be found in the ZL 202210500786.8 patent.

Example 4:

1. respectively transforming the constructed pET21b-T51 capable of expressing Tn5 mutant and pET21b-T50 plasmid capable of expressing parent Tn5 into competent cells of escherichia coli BL21 (DE 3), coating the competent cells with a flat plate, and culturing the competent cells upside down;

2. selecting a monoclonal and inoculating the monoclonal into 4mL of fresh LB culture medium for overnight culture;

3. inoculating the cultured bacterial liquid into 800mL of 2 XYT culture liquid according to the inoculation amount of 1%, and adding IPTG with the final concentration of 0.5mM to induce the expression of transposase when the bacterial liquid is cultured to an OD600 value of about 0.5 at 37 ℃ and 200 rpm;

4. measuring the concentration of the bacterial liquid after 4 hours, centrifuging the bacterial liquid at 4 ℃ and 5000rpm for 20 minutes, and collecting bacterial cells;

5. because the pET21b vector contains a 6 XHis tag and a TEV protease cleavage site, the purification of the transposase can be applied to the procedures of nickel column purification, in vitro digestion and collection flow-through. The specific purification steps are as follows:

a) Adding a purification buffer solution into thalli according to the proportion of 10g/100mL, and carrying out ultrasonic treatment for 2s in an ice-water bath and suspending 2s for 30min to completely crush the thalli;

b) Centrifuging at 15000rpm at 4deg.C for 30min, and collecting supernatant;

c) After balancing and stabilizing the purification device, enabling the supernatant to slowly flow through a nickel column, collecting the flowing-through liquid and storing in a refrigerator at 4 ℃;

d) Setting a gradient elution program, judging whether the protein is eluted according to a peak diagram in the equipment, and collecting an eluent (marked as eluent A);

e) Adding a proper amount of recombinant TEV protease into the eluent according to a kit system, and standing in a refrigerator at 4 ℃ for reaction overnight;

f) Centrifuging at 15000rpm at 4deg.C for 30min, and collecting supernatant;

g) After balancing and stabilizing the purification device, enabling the supernatant to slowly flow through the nickel column, and collecting all flowing-through liquid;

h) Selecting high-concentration solution to wash the chromatographic column, and concentrating by using a 30K ultrafiltration tube;

i) Determining the protein concentration and determining the protein purity by SDS-PAGE;

6. as shown in fig. 4 to 5, S in fig. 4 represents supernatant after ultrasonic centrifugation, and P represents sediment after ultrasonic centrifugation; 1-12 represents the eluent collected in stages during the gradient elution process of 0-100%. In FIG. 5, S represents the supernatant after ultrasonic centrifugation, and P represents the pellet after ultrasonic centrifugation; 1-12 represents the eluent collected by 0-100% gradient elution. The purified protein meets the requirements of subsequent tests.

Example 5:

1. the adaptor primer containing the 19bp transposon sequence comprises a transposase recognition sequence ME, a first adaptor sequence and a second adaptor sequence, and the sequences are as follows; annealing the transposase recognition sequence and the linker sequence respectively, and uniformly mixing the sequences in an equal volume for later use;

transposase recognition sequence: AGATGTGTATAAGAGACAG (SEQ ID No. 3)

A first linker sequence: TCGTCGGCAGCGTCCTGTCTCTTATACACATCT (SEQ ID No. 10)

A second linker sequence: GTCTCGTGGGCTCGGCTGTCTCTTATACACATCT (SEQ ID No. 11)

2. Incubating the Tn5 transposase and the adaptor primer containing the transposon sequence at 25 ℃ for 60min according to a certain proportion to obtain a transposon complex;

3. taking a certain amount of nucleic acid DNA, preparing a transposase enzyme digestion reaction system, flushing, uniformly mixing, centrifuging for a short time, and then placing the mixture in a PCR instrument for incubation for 10min at 55 ℃;

4. adding a stopping solution into the reaction system, and continuously incubating for 10min to stop the reaction;

5. adding a certain volume of (0.8X/1.0X) magnetic beads into the enzyme-cut product, shaking and mixing uniformly, standing at room temperature for more than 5min, and putting into a magnetic rack to separate the magnetic beads and the liquid. After the mixed solution is clarified, removing the supernatant, rinsing the magnetic beads for 2 times by using an 80% ethanol water solution, uncovering and naturally drying. Adding ddH2O, uniformly mixing, standing on a magnetic frame, and removing a supernatant;

6. mixing the fragmented product with an amplification primer, an amplification enzyme and an amplification reaction buffer solution, and carrying out a strand displacement reaction and library amplification to obtain enriched DNA fragments. Detailed procedure and reagent reference HieffFast Tagment DNA Library Prep Kit for Illumina method.

7. Repeating the step 4;

8. the constructed library can be subjected to quality evaluation through concentration detection and length distribution detection. As shown in FIG. 6, the amount of transposase added is 0 to 5.0. Mu.L in FIG. 6, respectively, as shown in FIG. 6. The cleavage efficiency of transposase mutant T51 is higher under the same conditions, which is consistent with the in vivo results of FIG. 3.

Claims (12)

1. An helper P-plasmid for directed evolution of a transposase, characterized in that the helper P-plasmid comprises an induced expressed PIII neg gene for expression of a phage antagonistic protein PIII neg; and a transposase specific recognition sequence and effecting association of transposase activity with the level of expression of the phage antagonistic protein PIII neg.

2. Helper P-plasmid according to claim 1, characterized in that the transposase specific recognition sequence is added flanking the PIII neg gene promoter which is induced to be expressed.

3. Helper P-plasmid according to claim 2, characterized in that the transposase is a Tn5 transposase and the sequence of the transposase specific recognition sequence is AGATGTGTATAAGAGACAG.

4. The helper P-plasmid according to claim 3, wherein said transposase specific recognition sequences are present in pairs flanking the PIII neg gene promoter which is induced to be expressed.

5. According to claim 2Characterized in that the PIII neg gene promoter induced to express comprises a transcription factor binding region and a repressor protein binding region, the transcription factor binding region is P _lac 、P _tet 、P _BAD Or P _trp The repressor binding region is a LacI protein binding sequence, a TetR protein binding sequence, or an AraC protein binding sequence.

6. A system for directed evolution of a transposase comprising:

an helper p+ plasmid, a phage recombinant genome carrying a transposase, a host cell, further comprising the helper P-plasmid of any of claims 1-5;

the auxiliary P+ plasmid comprises a gIII gene which is expressed in an induction way and is used for expressing PIII protein of phage capsid protein;

the gIII gene of phage in the phage recombinant genome carrying the transposase is replaced with the coding sequence of the transposase, and the coding sequence of the transposase is under the control of a gIII gene promoter;

the helper p+ plasmid, helper P-plasmid, and phage recombinant genome carrying the transposase are transformed into the host cell.

7. The system for directed evolution of transposase as claimed in claim 6, wherein the gIII gene in the helper P+ plasmid is expressed by induction of anhydrotetracycline.

8. A system for directed evolution of a transposase as claimed in claim 6 or 7, characterized in that the phage recombinant genome carrying the transposase is a phage recombinant genome library comprising different transposase mutants obtained by error-prone PCR methods.

9. A Tn5 transposase mutant is characterized in that the mutant comprises any one or at least two of D11G, I117K, R or I316 point mutation on the basis of an amino acid sequence SEQ ID No. 1.

10. A Tn5 transposase mutant characterized as having the following amino acid substitutions in SEQ ID No. 1: d11G, I117K, R, I316; wherein R210, I316 are any mutations; I117K, D G is a specific mutation.

11. The Tn5 transposase mutant as claimed in claim 10 wherein the sequence is as set forth in SEQ ID No. 2.

12. A method for directed evolution of a transposase, comprising the steps of:

(1) Constructing the helper P+ plasmid of claim 6 and the helper P-plasmid of any of claims 1-5, transforming into host cells, and screening positive clones;

(2) Preparing a transposase mutation library; amplifying a genome region of the phage except for the gIII gene, and carrying out homologous recombination with the transposase mutation library to obtain a phage recombination genome carrying transposase;

(3) Taking the positive clone obtained in the step (1) infected by the phage recombinant genome carrying the transposase obtained in the step (2), culturing, and inducing and expressing PIIIneg genes and gIII genes in the culturing process;

(4) Collecting phage particles in the supernatant after the culture is finished, infecting positive clones obtained in the step (1), and repeating the steps (3) and (4) for a plurality of times to obtain the evolved transposase.