CN106947766A - A kind of bacillus subtilis has DNA fragmentation and its application of promoter function - Google Patents
A kind of bacillus subtilis has DNA fragmentation and its application of promoter function Download PDFInfo
- Publication number
- CN106947766A CN106947766A CN201710235662.0A CN201710235662A CN106947766A CN 106947766 A CN106947766 A CN 106947766A CN 201710235662 A CN201710235662 A CN 201710235662A CN 106947766 A CN106947766 A CN 106947766A
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- seq
- dna fragmentation
- bacillus subtilis
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/34—Vector systems having a special element relevant for transcription being a transcription initiation element
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses DNA fragmentation and its application that a kind of bacillus subtilis has promoter function.The DNA fragmentation is following any sequence：(a) nucleotide sequence or its complementary series as shown in SEQ ID NO.1；(b) carry out what one or more nucleotides substitutions, missing or addition were obtained to the nucleotide sequence shown in SEQ ID NO.1, with being used as the nucleotide sequence of promoter function or its complementary series with the nucleotide sequence identical shown in SEQ ID NO.1；(c) sequence of one or more ribosome bind sites is added to the nucleotide sequence shown in SEQ ID NO.1.The DNA fragmentation of the present invention has the function of promoter, there is very strong expression activity simultaneously, the high expression of foreign gene can be realized under conditions of it need not add inducer, the expression of heat-resisting beta galactosidase and transglutaminase can be applied to, effective element is provided especially for bacillus subtilis expression excretory system.
Description
Technical field
The present invention relates to a kind of DNA fragmentation, more particularly to a kind of bacillus subtilis has the DNA fragmentation of promoter function
And its application.
Background technology
It is current biotechnology research and the focus of exploitation to produce valuable exogenous proteins by gene recombination technology
One of.The characteristics of bacterium has fast growth, easy culture, high expression quantity and simple molecule manipulation, this causes them widely
Development and application are in the expression of heterologous protein.Wherein, bacillus subtilis is because its safety non-toxic, genetic background are clear, secretion
Many advantages, such as expression is high, and as industrial preferable host cell.
Expressing heterologous albumen needs various elements in bacillus subtilis, wherein promoter for expression influence extremely
Close important.Generally there are two kinds of thinkings to carry out the genetic modification of promoter：A kind of mode is that the promoter of target gene in itself is entered
Row mutation transformation, so as to improve the activity of promoter；Another way be by original promoter be substituted for it is other natural or
Artificial constructed promoter, so as to thoroughly change the express spectra of downstream gene, realizes the manual control to gene transcription level.Mesh
Before be used successfully to the promoter of bacillus subtilis expression system and mainly have P43, PamyQ, Pspac, PxylA etc., these startups
Son shows good in the enriched medium in laboratory, but it is rarely seen they be used for the industry's enlarging production of zymoprotein.Therefore, have
Necessity finds promoter that is more efficient, being suitable for industrial culture medium production expression, to adapt to ferment to expression increasingly
High requirement.
The content of the invention
Primary and foremost purpose of the invention is that the shortcoming and deficiency for overcoming prior art have there is provided a kind of bacillus subtilis
The DNA fragmentation of promoter function.
Another object of the present invention is to provide answering for the DNA fragmentation that the bacillus subtilis has promoter function
With.
The purpose of the present invention is achieved through the following technical solutions：A kind of bacillus subtilis has the DNA of promoter function
Fragment, the DNA fragmentation is following any sequence：
(a) nucleotide sequence or its complementary series as shown in SEQ ID NO.1；
(b) one or more nucleotides substitutions, missing are carried out to the nucleotide sequence as shown in SEQ ID NO.1 or is added
Obtained, with the nucleotide sequence identical shown in SEQ ID NO.1 as the nucleotide sequence of promoter function or
Its complementary series of person；
(c) sequence of one or more ribosome bind sites is added to the nucleotide sequence as shown in SEQ ID NO.1.
The sequence of described ribosome bind site is the nucleotide sequence as shown in SEQ ID NO.2.
Described bacillus subtilis has application of the DNA fragmentation of promoter function in protein expression.
A kind of carrier, includes the nucleotide sequence as shown in SEQ ID NO.1 and the ribosomes as shown in SEQ ID NO.2
The sequence of binding site.
Described carrier is preferably plasmid vector, contains the nucleotide sequence as shown in SEQ ID NO.7.
A kind of expression plasmid, described has promoter work(comprising above-mentioned carrier and with being located at of being operatively connected of the carrier
The DNA fragmentation downstream encoding heterologous protein nucleotide sequence of energy.
Described heterologous protein nucleotide sequence preferably thermally bacillus (Geobacillus kaustophilus)
The nucleotide sequence of the thermostable beta-galactosidase of coding, or compiled for streptomyces mobaraensis (Streptomyces mobaraensia)
The nucleotide sequence of the transglutaminase of code.
A kind of recombined engineering cell, is the cell that above-mentioned carrier or the conversion of above-mentioned plasmid or transduction host cell are obtained
Strain.
Described host cell is bacillus.
Described host cell is bacillus subtilis.
The present invention has the following advantages and effect relative to prior art：
1st, the present invention relates to determine full genome transcription of the bacillus subtilis in the logarithmic growth later stage with RNA-seq technologies
Group, the gene of the high expression of screening, finds a high gene of transcriptional activity in bacillus subtilis.Clone the high table screened
Up to the corresponding promoter sequence of gene, and applied to the expression of thermostable beta-galactosidase gene (bgaB), by determining bgaB
Activity, it was demonstrated that the promoter of screening in bacillus subtilis have high activity.Table applied to transglutaminase (MTG)
Reach, its protein expression is verified by SDS-PAGE.
2nd, the invention provides a kind of DNA fragmentation, the DNA is a promoter, with very strong specifically expressing activity, not
Need that under conditions of addition inducer the high expression of foreign gene can be realized, applied to thermostable beta-galactosidase and turned
The expression of glutaminase, effective instrument is provided especially for bacillus subtilis expression alien gene.
Brief description of the drawings
Fig. 1 is that the bacillus subtilis of growth late log phase in embodiment 2 extracts total serum IgE electrophoretogram；Wherein, swimming lane 1 and 2
The bacillus subtilis of respectively growth late log phase extracts total serum IgE.
Fig. 2 is to expand P in embodiment 3ydzAPCR primer electrophoretogram；Wherein, swimming lane M is DNA marker, swimming lane 1 and 2
For PydzAPcr amplification product.
Fig. 3 is the expression plasmid pBE-P of embodiment 4ydzA- SamyQ-bgaB structure schematic diagram.
Fig. 4 is to expand P in embodiment 5ydzA+ SamyQ fragment electrophoretic figures；Wherein, swimming lane M is DNA marker, the He of swimming lane 1
2 be PydzA+ SamyQ amplified productions.
Fig. 5 is the expression plasmid pBE-P of embodiment 5ydzA- SamyQ-proMTG structure schematic diagram.
Fig. 6 is embodiment 6B.subtilis ATCC6051 (pBE-PydzA- SamyQ-proMTG) transformant MTG expression
SDS-PAGE running gel figures；Wherein, swimming lane M is albumen marker, and swimming lane 1 is bacillus subtilis B.subtilis
ATCC6051 exocytosis albumen, swimming lane 2 is B.subtilis ATCC6051 (pBE-PydzA- SamyQ-proMTG) extracellular point
Albumen is secreted, arrow represents destination protein MTG position.
Embodiment
With reference to embodiment, the present invention is described in further detail, but embodiments of the present invention not limited to this.
Molecular biology experiment technology employed in following examples includes PCR amplifications, plasmid extraction, DNA fragmentation enzyme
Cut, connect, gel electrophoresis etc. referring specifically to《Molecular Cloning:A Laboratory guide》(third edition) (Sambrook J, Russell DW,
Janssen K, Argentine J. Huang Peitangs etc. are translated, 2002, Beijing：Science Press).
From a bacillus subtilis, (Bacillus subtilis 168 are purchased from Guangdong Province's Microbiological Culture Collection
The heart) culture the production late log phase stage extract bacteria RNA.Transcript profile sequencing is carried out to bacteria RNA and builds storehouse, removes ribosomes
RNA, carries out reverse transcription to mRNA and sets up cDNA library.The full transcript profile of bacterium is analyzed, according to representing gene transcription level
RPKM values judge the higher gene of its expression quantity level, then analyze its promoter region.Selected promoter is accessed into carrier,
Determine activity of the promoter in bacillus subtilis.
Embodiment 1
The culture of bacterium：Bacillus subtilis (Bacillus subtilis 168) is taken out into line from -80 DEG C of glycerol tubes
In 37 DEG C of 16~24h of culture on LB solid plates, picking single bacterium falls within the LB Liquid Cultures of 10mL 1% final concentration cornstarch
Base, 37 DEG C, 200rpm is cultivated to OD60020~25 (spectrophotometer, Japanese Hitachi companies).
Embodiment 2
Extraction, the foundation in transcript profile library and the RNA-Seq sequencings of bacterium total serum IgE：Collect the cell training that embodiment 1 is obtained
Nutrient solution 1mL quickly centrifuges 1min in 8000g, for extracting bacterium total serum IgE (see Fig. 1).Specific extracting method refers to Omega
The bacterium total RNA extraction reagent box of Bio-tek companies.Sample for the preparation of RNA-Seq sequencing libraries is through Agilent
Technologies 2100Bioanalyzer detections are qualified, and the DNA molecular being mixed into is handled by DNaseI (RNase Free),
Removed with Ribo-Zero (Gram-Positive Bacteria) kit (USA) and account for the most of rRNA of total serum IgE, purifying is obtained
MRNA.MRNA is first interrupted for the fragment of suitable size, using the mRNA of fragmentation as template, add reverse transcriptase and with power traction
Then thing, synthetic double chain cDNA purifies synthesis with kit QIAquick PCR Purification Kit (Qiagen)
cDNA.Filling-in cDNA cohesive end, is then matched on a chain plus an adenylic acid with the A of this protrusion
One-level joint sequence containing prominent T.Enter performing PCR under conditions of the primer that can match one-level joint two ends respectively is present to expand
Increase, by repeatedly circulation, PCR results are carried out to the adhesive tape of gel electrophoresis and gel extraction predefined size, what is at this moment obtained adds
The library of the sequence composition of secondary joint carries out upper machine sequencing and (presses patent document：The such as Pan Li are a kind of with promoter function
DNA fragmentation and application .CN201510074949.0 [P] .2015. methods).The sequencing in RNA-Seq libraries is given birth to by Guangzhou base Christian Dior
Thing Science and Technology Ltd. provides sequencing service.Two ends are read to the 100bp at center sequence information respectively during sequencing
(PE100), referred to as reads, these reads are compared onto bacterial genomes and be can be carried out after annotation and expression quantity calculating etc.
Continuous bioinformatic analysis.
Embodiment 3
Screen and cloning promoter fragment：By RNA-Seq sequencing datas analyze bacillus subtilis transcript structures and
Whole genome analysis contains the gene of positions transcription initiation, is quantified by RPKM, the high gene of one plant of expression quantity of screening, its nucleosides
Acid sequence is as follows：
CGTTCTGTTACAGATGGAGGCGACAGCTTAATTTTTCTGCCTAATTCCCTCATCGACAAACGGCTGTCCTTCTTCAG
CTCCTCAATGATATTCAGATCAATCTGGTCAAGTTTCATTTCAACATCCTTCTTTTTTGATTTTGTACACATTATCT
CGGGTATTTTTGTAAATGACAAGTACAGTTCCCTAGAAAAGGCATGTAAAAATGAATGTTTTCCGAACATTTTTTGA
AAGCTGTCATATGCCCCCCCGGATTGTTTATAGTATAAAATGAAAACGTGTCCACAAGGAGGGCGATTT。
Genomic DNA using Strains B. subtilis (Bacillus subtilis 168) is template, primers F-PydzA
(5 '-CGGAATTCCGTTCTGTTACAGATGGAGG-3 ') and R-PydzA(5’-GGACTAGTAAATCGCCCTCCTTGTGGAC-
3 ') DNA fragmentation of amplification 300bp sizes, i.e. P are carried outydzAPromoter fragment (see Fig. 2), is consistent with purpose product size.Introduce
Restriction enzyme site EcoRI, SpeI.
Embodiment 4
Build bgaB expression plasmids：Patent document (is pressed with plasmid pBE-rbs-SamyQ-bgaB：The one kind such as Pan Li has
The DNA fragmentation of promoter function and its application .CN201610430767.7 [P] .2016. are built) it is expression plasmid, with restricted
Restriction endonuclease EcoRI and SpeI are cut into linear plasmid in restriction enzyme site, and band EcoRI, SpeI restriction enzyme sites will be obtained in embodiment 3
PydzAPromoter fragment by digestion, insert after purification the linear plasmid build obtain purpose promoter bgaB genes it is extracellular
Expression plasmid pBE-PydzA- SamyQ-bgaB (see Fig. 3).
Embodiment 5
Build MTG expression plasmids：Patent document (is pressed with plasmid pBEp43-proMTG：The withered grass of the plant weight groups of the such as Pan Li mono-
Bacillus and its method .CN201210052578.2 [P] .2012. structures for producing transglutaminase) it is expression plasmid,
With restriction enzyme EcoR I and BamH I restriction enzyme site.With p BE-PydzA- SamyQ-bgaB plasmids be template, primers F-
PydzA(5’-CGGAATTCCGTTCTG TTACAGATGGAGG-3’)、R-SamyQ(5’-
AAGGATCCGGCTGATGTTTTTGTAA TCG-3 ') end of amplification 5 ' is with the restriction enzyme sites of EcoR I, and 3 ' ends carry the digestions of BamH I
The about 450bp P in siteydzA- SamyQ fragments (see Fig. 4).With restriction enzyme EcoR I and BamH I digestion PydzA- SamyQ pieces
Section, is reclaimed, and the insertion plasmid pBEp43-proMT G of identical endonuclease digestion position, build and obtain MTG expression born of the same parents after purification
Outer plasmid pBE-PydzA- SamyQ-proMTG (see Fig. 5).Wherein：PydzA- SamyQ nucleotides sequences are classified as：
CGTTCTGTTACAGATGGAGGCGACAGCTTAATTTTTCTGCCTAATTCCCTCATCGACAAACGGCTGTCCTTCTTCAG
CTCCTCAATGATATTCAGATCAATCTGGTCAAGTTTCATTTCAACATCCTTCTTTTTTGATTTTGTACACATTATCT
CGGGTATTTTTGTAAATGACAAGTACAGTTCCCTAGAAAAGGCATGTAAAAATGAATGTTTTCCGAACATTTTTTGA
AAGCTGTCATATGCCCCCCCGGATTGTTTATAGTATAAAATGAAAACGTGTCCACAAGGAGGGCGATTTCAATTATA
GGTAAGAGAGGAATGTCGACATGATTCAAAAACGAAAGCGGACAGTTTCGTTCAGACTTGTGCTTATGTGCACGCTG
TTATTTGTCAGTTTGCCGATTACAAAAACATCAGCC。
Embodiment 6
The detection of promoter expression：By the bgaB expression plasmids pBE-P of the purpose promoter builtydzA-
SamyQ-bgaB and MTG expression plasmids pBE-PydzA- SamyQ-proMTG and plasmid pBEp43-proMTG (press patent document：
The bacillus subtilis of the plant weight groups of the such as Pan Li mono- and its method .CN201210052578.2 [P] for producing transglutaminase
.2012. build) first converted with chemical transformation to Escherichia coli (E.coli JM110), positive clone molecule is obtained, after sequencing
Plasmid is extracted, the method for electricity consumption conversion is converted to bacillus subtilis B.subtilis ATCC6051, and specific method is with reference to non-special
Sharp document record Natalia P, Zakataeva, Oksana V et al.A simple method to introduce
marker-free genetic modification into chromosome of naturally
nontransformable Bacillus amyloliquefaciens strains[J].Appl Microbiol
Biotechnol.2010,85:1201-1209), bacterial strain B.subtilis ATCC6051 (pBE-P must be convertedydzA-SamyQ-
bgaB)、B.subtilis ATCC6051(pBE-PydzA- SamyQ-proMTG) and B.subtilis ATCC6051 (pBEp43-
proMTG)。
By obtained transformant B.subtilis ATCC6051 (pBE-PydzA-SamyQ-bgaB)、B.subtilis
ATCC6051(pBE-PydzA- SamyQ-proMTG) and B.subtilis ATCC6051 (pBEp43-proMTG) be incubated at 10mL
In LB culture mediums (the μ g/mL of kanamycins 20), 37 DEG C, the seed liquor of activation is inoculated in 50mL LB trainings by 200rpm activation 12h
Support in base (the μ g/mL of kanamycins 20,1% (w/w) cornstarch), inoculum concentration is 1% (volume ratio), and 37 DEG C, 200rpm is always sent out
Ferment 48h, was sampled every 12 hours.
The measure of β-glucose galactose glycosides enzyme enzyme activity：By 32 μ L fermented supernatant fluids and 288 μ L 0.25%ONPG (o-
Nitrophenyl- β-D-Galactopyranoside, ortho-nitrophenyl β-D- synthesis) mix, incubated at 55 DEG C
15min, reaction terminating adds 320 μ L 10% (w/w) Na2CO3.Reaction is in chromogenic reaction, and extinction is determined under 405nm wavelength
Value.Control strain B.subtilis ATCC6051 (pBE-rbs-SamyQ-bgaB) are surveyed without chromogenic reaction under 405nm wavelength
Determine light absorption value similar with blank control (LB), no β-glucose galactose glycosides enzymatic activity.As a result promoter P is shownydzAStart
β-glucose galactose glycosides expression of enzymes, 36h reach highest enzyme activity 44.3U/mL.
SDS-PAGE：By 36h zymotic fluid centrifuging and taking supernatants, supernatant runs SDS-PAGE electrophoresis, with wild type B gemma
Bacillus B.subtilis ATCC6051 are as control, and protein adhesive figure, which is shown in 44-46KDa, band and MTG albumen size one
Cause, and wild type control in this magnitude range without band, experimental result illustrates that MTG pepsinogens are expressed (see Fig. 6).
The measure of MTG enzyme activity：0.2mL fermented supernatant fluids are taken, 50 μ L 0.1% trypsase, 37 DEG C of water after mixing is added
10min is bathed, that is, obtains the transglutaminase of maturation.Enzyme activity determination uses Crossowicz colorimetric methods, with N- α-CBZ-Gln-
Gly is as substrate, and 37 DEG C of reaction 10min, are then rapidly added after the maturase after 150 μ L substrate and 50 μ L activation is mixed
200 μ L reaction terminating agent hydrochloric acid-iron chloride-trichloroacetic acid (3molL/ hydrochloric acid, 12% (v/v) trichloroacetic acid and 5% (w/
V) iron chloride presses 1:1:1 ratio mixing.), while making standard curve with Pidolidone-γ-mono- hydroximic acid, surveyed with ELIASA
Light absorption value of the quantitative response liquid under 525nm.Enzyme activity unit is defined as：1min is catalyzed N- α-CBZ-Gln-Gly generations 1 at 37 DEG C
Enzyme amount required for μm ol Pidolidones-γ-mono- hydroximic acid.Wild strain B.subtilis ATCC6051 without chromogenic reaction,
Light absorption value is similar with blank control (LB), without trans glutaminase active.As a result promoter P is shownydzAExpress MTG, 36h
Highest enzyme activity 82.68U/mL is reached, it is high by 1.3 in 36h enzyme activity 61.59U/mL to express MTG compared to traditional strong promoter p43
Times.
Above-described embodiment is preferably embodiment, but embodiments of the present invention are not by above-described embodiment of the invention
Limitation, other any Spirit Essences without departing from the present invention and the change made under principle, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>South China Science ＆ Engineering University
<120>A kind of bacillus subtilis has DNA fragmentation and its application of promoter function
<130> 1
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 300
<212> DNA
<213>Bacillus subtilis（Bacillus subtilis）
<400> 1
cgttctgtta cagatggagg cgacagctta atttttctgc ctaattccct catcgacaaa 60
cggctgtcct tcttcagctc ctcaatgata ttcagatcaa tctggtcaag tttcatttca 120
acatccttct tttttgattt tgtacacatt atctcgggta tttttgtaaa tgacaagtac 180
agttccctag aaaaggcatg taaaaatgaa tgttttccga acattttttg aaagctgtca 240
tatgcccccc cggattgttt atagtataaa atgaaaacgt gtccacaagg agggcgattt 300
<210> 2
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223>The sequence of ribosome bind site
<400> 2
caattatagg taagagagga atgtcgac 28
<210> 3
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> F-PydzA
<400> 3
cggaattccg ttctgttaca gatggagg 28
<210> 4
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> R-PydzA
<400> 4
ggactagtaa atcgccctcc ttgtggac 28
<210> 5
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> R-SamyQ
<400> 5
aaggatccgg ctgatgtttt tgtaatcg 28
<210> 6
<211> 421
<212> DNA
<213> Artificial Sequence
<220>
<223> PydzA-SamyQ
<400> 6
cgttctgtta cagatggagg cgacagctta atttttctgc ctaattccct catcgacaaa 60
cggctgtcct tcttcagctc ctcaatgata ttcagatcaa tctggtcaag tttcatttca 120
acatccttct tttttgattt tgtacacatt atctcgggta tttttgtaaa tgacaagtac 180
agttccctag aaaaggcatg taaaaatgaa tgttttccga acattttttg aaagctgtca 240
tatgcccccc cggattgttt atagtataaa atgaaaacgt gtccacaagg agggcgattt 300
caattatagg taagagagga atgtcgacat gattcaaaaa cgaaagcgga cagtttcgtt 360
cagacttgtg cttatgtgca cgctgttatt tgtcagtttg ccgattacaa aaacatcagc 420
c 421
<210> 7
<211> 328
<212> DNA
<213> Artificial Sequence
<220>
<223>DNA fragmentation+ribosome binding sequence
<400> 7
cgttctgtta cagatggagg cgacagctta atttttctgc ctaattccct catcgacaaa 60
cggctgtcct tcttcagctc ctcaatgata ttcagatcaa tctggtcaag tttcatttca 120
acatccttct tttttgattt tgtacacatt atctcgggta tttttgtaaa tgacaagtac 180
agttccctag aaaaggcatg taaaaatgaa tgttttccga acattttttg aaagctgtca 240
tatgcccccc cggattgttt atagtataaa atgaaaacgt gtccacaagg agggcgattt 300
caattatagg taagagagga atgtcgac 328
Claims (10)
1. a kind of bacillus subtilis has the DNA fragmentation of promoter function, it is characterised in that the DNA fragmentation is appointed to be following
One sequence：
(a) nucleotide sequence or its complementary series as shown in SEQ ID NO.1；
(b) one or more nucleotides substitutions, missing or addition is carried out to the nucleotide sequence as shown in SEQ ID NO.1 to obtain
, with the nucleotide sequence identical shown in SEQ ID NO.1 as the nucleotide sequence of promoter function or its
Complementary series；
(c) sequence of one or more ribosome bind sites is added to the nucleotide sequence as shown in SEQ ID NO.1.
2. bacillus subtilis according to claim 1 has the DNA fragmentation of promoter function, it is characterised in that：It is described
The sequence of ribosome bind site is the nucleotide sequence as shown in SEQ ID NO.2.
3. the bacillus subtilis described in claim 1 or 2 has the DNA fragmentation of promoter function answering in protein expression
With.
4. a kind of carrier, it is characterised in that：Comprising the nucleotide sequence as shown in SEQ ID NO.1 and such as SEQ ID NO.2 institutes
The sequence of the ribosome bind site shown.
5. carrier according to claim 4, it is characterised in that：Described carrier contains the nucleosides as shown in SEQ IDNO.7
Acid sequence.
6. a kind of expression plasmid, it is characterised in that：Comprising the carrier described in claim 4 or 5 and with the operable company of the carrier
What is connect is located at the DNA fragmentation downstream encoding heterologous protein nucleotide sequence with promoter function.
7. expression plasmid according to claim 6, it is characterised in that：Described heterologous protein nucleotide sequence is preferably warm
The nucleotide sequence of the thermostable beta-galactosidase of ground bacillus (Geobacillus kaustophilus) coding, or be cyclopentadienyl
The nucleotide sequence of the transglutaminase of former streptomycete (Streptomyces mobaraensia) coding.
8. a kind of recombined engineering cell, it is characterised in that：For the carrier described in claim 4 or 5 or the institute of claim 6 or 7
The cell line that the plasmid conversion or transduction host cell stated are obtained.
9. recombined engineering cell according to claim 8, it is characterised in that：Described host cell is bacillus.
10. recombined engineering cell according to claim 9, it is characterised in that：Described host cell is bacillus subtilis
Bacterium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710235662.0A CN106947766B (en) | 2017-04-12 | 2017-04-12 | Bacillus subtilis DNA fragment with promoter function and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710235662.0A CN106947766B (en) | 2017-04-12 | 2017-04-12 | Bacillus subtilis DNA fragment with promoter function and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106947766A true CN106947766A (en) | 2017-07-14 |
| CN106947766B CN106947766B (en) | 2020-08-18 |
Family
ID=59475550
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710235662.0A Active CN106947766B (en) | 2017-04-12 | 2017-04-12 | Bacillus subtilis DNA fragment with promoter function and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106947766B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107698670A (en) * | 2017-10-23 | 2018-02-16 | 华南理工大学 | A kind of signal peptide for improving protein secretion efficiency and its application |
| CN107698668A (en) * | 2017-10-23 | 2018-02-16 | 华南理工大学 | A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency |
| CN107698669A (en) * | 2017-10-23 | 2018-02-16 | 华南理工大学 | A kind of signal peptide for improving secernment efficiency and its application |
| CN107759675A (en) * | 2017-10-23 | 2018-03-06 | 华南理工大学 | A kind of signal peptide and its application that secernment efficiency can be improved from bacillus subtilis |
| CN107857802A (en) * | 2017-10-23 | 2018-03-30 | 华南理工大学 | A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency |
| CN107936096A (en) * | 2017-10-23 | 2018-04-20 | 华南理工大学 | A kind of signal peptide that can effectively improve protein secretion efficiency and its application |
| CN113957071A (en) * | 2021-09-30 | 2022-01-21 | 华南理工大学 | Combined DNA fragment with double promoters and double secretion signal functions and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086025A (en) * | 2016-06-15 | 2016-11-09 | 华南理工大学 | A kind of DNA fragmentation with promoter function and application thereof |
-
2017
- 2017-04-12 CN CN201710235662.0A patent/CN106947766B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086025A (en) * | 2016-06-15 | 2016-11-09 | 华南理工大学 | A kind of DNA fragmentation with promoter function and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 《GENBANK》: "Genbank Accession：CP010052.1", 《NCBI》 * |
| 张利莉等: "Sigma因子和启动子上游区在苏云金芽胞杆菌杀虫晶体蛋白基因表达调控中的作用", 《中国生物工程杂志》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107698670A (en) * | 2017-10-23 | 2018-02-16 | 华南理工大学 | A kind of signal peptide for improving protein secretion efficiency and its application |
| CN107698668A (en) * | 2017-10-23 | 2018-02-16 | 华南理工大学 | A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency |
| CN107698669A (en) * | 2017-10-23 | 2018-02-16 | 华南理工大学 | A kind of signal peptide for improving secernment efficiency and its application |
| CN107759675A (en) * | 2017-10-23 | 2018-03-06 | 华南理工大学 | A kind of signal peptide and its application that secernment efficiency can be improved from bacillus subtilis |
| CN107857802A (en) * | 2017-10-23 | 2018-03-30 | 华南理工大学 | A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency |
| CN107936096A (en) * | 2017-10-23 | 2018-04-20 | 华南理工大学 | A kind of signal peptide that can effectively improve protein secretion efficiency and its application |
| CN113957071A (en) * | 2021-09-30 | 2022-01-21 | 华南理工大学 | Combined DNA fragment with double promoters and double secretion signal functions and application thereof |
| CN113957071B (en) * | 2021-09-30 | 2023-07-18 | 华南理工大学 | Combined DNA fragment with double promoter and double secretion signal functions and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106947766B (en) | 2020-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947766A (en) | A kind of bacillus subtilis has DNA fragmentation and its application of promoter function | |
| Wang et al. | Bacterial genome editing with CRISPR-Cas9: deletion, integration, single nucleotide modification, and desirable “clean” mutant selection in Clostridium beijerinckii as an example | |
| Vester et al. | Improved cultivation and metagenomics as new tools for bioprospecting in cold environments | |
| CN110352241A (en) | Heat-staple Cas9 nuclease | |
| Lee et al. | Sequence analysis of two cryptic plasmids from Bifidobacterium longum DJO10A and construction of a shuttle cloning vector | |
| Lin et al. | Knockdown of PsbO leads to induction of HydA and production of photobiological H2 in the green alga Chlorella sp. DT | |
| CN106755037A (en) | A kind of Virginia streptomycete IBL14 type I B sv14 type CAS gene editing systems | |
| CN106086025B (en) | DNA fragment with promoter function and application thereof | |
| CN105647943A (en) | Saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof | |
| CN104630229B (en) | A kind of DNA fragmentation and application with promoter function | |
| Aliu et al. | CRISPR RNA‐guided integrase enables high‐efficiency targeted genome engineering in Agrobacterium tumefaciens | |
| US20150232578A1 (en) | Hybrid proteins and uses thereof | |
| Yamada et al. | Retrieval of entire genes from environmental DNA by inverse PCR with pre‐amplification of target genes using primers containing locked nucleic acids | |
| CN107602707A (en) | The dcas9 ω fusion proteins of one species specificity regulation bacillus subtilis exogenous gene expression and its application | |
| CN106676125A (en) | Maltose promoter-containing carrier and maltose promoter mutant | |
| CN107119051A (en) | A kind of bacillus megaterium has DNA fragmentation and its application of promoter function | |
| CN111004813A (en) | Super-large plasmid construction kit, super-large plasmid construction method and application thereof | |
| Reimann et al. | Specificities and functional coordination between the two Cas6 maturation endonucleases in Anabaena sp. PCC 7120 assign orphan CRISPR arrays to three groups | |
| Wadley et al. | Nanopore sequencing for detection and characterization of phosphorothioate modifications in native DNA sequences | |
| CN113278646A (en) | Method for constructing rice polygene editing mutant library and application | |
| CN107760697A (en) | For the screening technique for the protection bacterial strain that methylates for expressing restriction enzyme FspI | |
| CN109321583B (en) | Method for constructing reversed genetic system of muscovy duck reovirus | |
| CN104513830A (en) | Gene expression vector applicable to gluconobacter oxydans and application of gene expression vector | |
| Wang et al. | Transcriptional activation of virulence genes of Rhizobium etli | |
| CN106480031B (en) | Bacillus expresses promoter and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |