CN106086025A - A kind of DNA fragmentation with promoter function and application thereof - Google Patents

A kind of DNA fragmentation with promoter function and application thereof Download PDF

Info

Publication number
CN106086025A
CN106086025A CN201610430767.7A CN201610430767A CN106086025A CN 106086025 A CN106086025 A CN 106086025A CN 201610430767 A CN201610430767 A CN 201610430767A CN 106086025 A CN106086025 A CN 106086025A
Authority
CN
China
Prior art keywords
nucleotide sequence
seq
sequence
dna fragmentation
carrier
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610430767.7A
Other languages
Chinese (zh)
Other versions
CN106086025B (en
Inventor
潘力
刘欣
王斌
廖瑜玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China University of Technology SCUT
Original Assignee
South China University of Technology SCUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China University of Technology SCUT filed Critical South China University of Technology SCUT
Priority to CN201610430767.7A priority Critical patent/CN106086025B/en
Publication of CN106086025A publication Critical patent/CN106086025A/en
Application granted granted Critical
Publication of CN106086025B publication Critical patent/CN106086025B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/104—Aminoacyltransferases (2.3.2)
    • C12N9/1044—Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • C12N9/2471—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/02—Aminoacyltransferases (2.3.2)
    • C12Y203/02013—Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01023—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of DNA fragmentation with promoter function and application thereof.This DNA fragmentation is following any sequence: (a) nucleotide sequence as shown in SEQ ID NO.1 or its complementary series；B () carry out one or more nucleotide replacement to the nucleotide sequence as shown in SEQ ID NO.1, lack or add and obtained, and has the nucleotide sequence as promoter function identical with the nucleotide sequence as shown in SEQ ID NO.1 or its complementary series；C nucleotide sequence as shown in SEQ ID NO.1 is added the sequence of one or more ribosome binding sites by ().This DNA fragmentation has the function of promoter, has the strongest specifically expressing activity, can realize the high expressed of exogenous gene, provide effective element especially for bacillus subtilis expression alien gene under conditions of need not add inducer.

Description

A kind of DNA fragmentation with promoter function and application thereof
Technical field
The present invention relates to a kind of DNA fragmentation, be specifically related to a kind of DNA fragmentation with promoter function and application thereof.
Background technology
Protein expression system is the important research content of modern biotechnology, is widely used in food, pharmacy, detergent life The fields such as product.Wherein, it is fast that prokaryotic expression system has growth, easily cultivates, and expression is high, and genetic background understands and molecule manipulation Simple feature, and it is appropriate to the significant advantages such as engineered strain transformation, it is widely used in the expression of heterologous protein.Mesh The prokaryotic expression system of front comparative maturity has escherichia coli and bud pole bacterium.Due to escherichia coli, to be not suitable as host extensive Expressing heterologous albumen, and bud pole bacterium is the common system of large-scale production industrial enzyme preparation.The advantage of bud pole bacterium host is: The safe bacterial strain generally acknowledged, secreting, expressing, without obvious codon bias.
In genetic engineering, often need to build the carrier of high expressed heterologous protein, the expression of exogenous gene is had by promoter Extreme influence, is the important component of gene engineering expression carrier.Promoter is that RNA polymerase combination starts to transcribe synthesis The place of mRNA, promoter is the key affecting enzyme gene expression with the joint efficiency of RNA polymerase.Research shows hay Pseudomonas Containing abundant sigma factor (12 kinds), RNA polymerase and the specific binding of promoter depend on sigma factor, therefore spore Pseudomonas The efficient promoter of middle search is more difficult.Report expresses the three class promoteres that have of recombiant protein for spore Pseudomonas at present, first Being inducible promoter, need to add different inducers, its weakness is that starting efficiency is relatively low；Next to that it is relevant to growth stage Promoter and enhancer, be activated in different growth stage, start intensity high, but can not continuous expression；It is finally that self-induction opens Mover.Therefore, research promoter function is for understanding biological growth and development, inquiring into the mechanism of biological adaptation environment and realize external source The high efficient expressions of gene etc. are the most significant.
Summary of the invention
The primary and foremost purpose of the present invention is to overcome the shortcoming of prior art with not enough, it is provided that a kind of have promoter function DNA fragmentation.
Another object of the present invention is to provide the purposes of described DNA fragmentation.
The purpose of the present invention is achieved through the following technical solutions: a kind of DNA fragmentation with promoter function, described DNA Fragment is following any sequence:
(a) nucleotide sequence as shown in SEQ ID NO.1 or its complementary series；
B () carries out one or more nucleotide replacement, lacks or add the nucleotide sequence as shown in SEQ ID NO.1 Obtained, be there is the nucleotide sequence as promoter function identical with the nucleotide sequence as shown in SEQ ID NO.1 Or its complementary series；
C nucleotide sequence as shown in SEQ ID NO.1 is added the sequence of one or more ribosome binding sites by ().
The sequence of described ribosome binding site is the nucleotide sequence as shown in SEQ ID NO.2.
The application in protein expression of the described DNA fragmentation with promoter function.
A kind of carrier, comprises the nucleotide sequence as shown in SEQ ID NO.1 and the ribosome as shown in SEQ ID NO.2 The sequence of binding site
Described carrier, containing the nucleotide sequence as shown in SEQ ID NO.10.
A kind of expression plasmid, comprise above-mentioned carrier and with this carrier be operatively connected to be positioned at this carrier downstream coding different Source protein matter nucleotide sequence.
Described heterologous protein nucleotide sequence the most thermally bacillus cereus (Geobacillus kaustophilus) is compiled The nucleotide sequence of the thermostable beta-galactosidase of code, or be streptomyces mobaraensis (Streptomyces mobaraensia) coding The nucleotide sequence of T-5398.
A kind of recombined engineering cell, the cell obtained for above-mentioned carrier or above-mentioned Plastid transformation or transduction host cell Strain.
Described host cell is bacillus cereus.
Described host cell is bacillus subtilis.
The present invention has such advantages as relative to prior art and effect:
The present invention relates to use the RNA-seq technical measurement Bacillus licheniformis full genome in the logarithmic growth later stage to transcribe Group, the gene of screening high expressed, finds the gene that a transcriptional activity is high in Bacillus licheniformis.The high table that clone is screened Reach the promoter sequence that gene pairs is answered, and be applied to the expression of thermostable beta-galactosidase gene (bgaB), by measuring bgaB Activity, it was demonstrated that the promoter of screening has high activity in bacillus subtilis.It is applied to the table of T-5398 (MTG) Reach, verify its protein expression by SDS-PAGE.
That is, the invention provides a kind of DNA fragmentation, this DNA fragmentation has the function of promoter, has the strongest specifically expressing Activity, can realize the high expressed of exogenous gene, especially for bacillus subtilis under conditions of need not add inducer Expression alien gene provides effective element.
Accompanying drawing explanation
Fig. 1 is that the Bacillus licheniformis growing late log phase in embodiment 2 extracts total serum IgE electrophoretogram；Wherein, swimming lane 1 and 2 The bacillus amyloliquefaciens being respectively growth late log phase extracts total serum IgE.
Fig. 2 is amplification P in embodiment 3glvAPCR primer electrophoretogram；Wherein, swimming lane M is DNA Marker；Swimming lane 1 is PglvAPcr amplification product.
Fig. 3 is the PCR primer electrophoretogram expanding SamyQ signal peptide in embodiment 4；Wherein, swimming lane M is DNA Marker, Swimming lane 1 is SamyQ signal peptide pcr amplification product.
Fig. 4 is the structure schematic diagram of embodiment 4 plasmid pBE-rbs-SamyQ-bgaB.
Fig. 5 is embodiment 4 expression plasmid pBE-PglvAThe structure schematic diagram of-SamyQ-bgaB.
Fig. 6 is amplification P in embodiment 5glvA-samyQ fragment electrophoretic figure；Wherein, swimming lane M is DNA Marker, and swimming lane 1 is PglvA-samyQ amplified production.
Fig. 7 is embodiment 5 expression plasmid pBE-PglvAThe structure schematic diagram of-SamyQ-proMTG.
Fig. 8 is embodiment 6B.subtilis ATCC6051 (pBE-PglvA-SamyQ-bgaB) transformant bgaB enzyme live Curve chart.
Fig. 9 is embodiment 6B.subtilis ATCC6051 (pBE-PglvA-SamyQ-proMTG) expression of transformant MTG SDS-PAGE running gel figure.
Detailed description of the invention
Below in conjunction with embodiment, the present invention is described in further detail, but embodiments of the present invention are not limited to this.
Molecular biology experiment technology employed in following example includes PCR amplification, plasmid extraction, DNA fragmentation enzyme Cut, connect, gel electrophoresis etc. referring specifically to " Molecular Cloning: A Laboratory guide " (third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang training hall etc. is translated, and 2002, Beijing: Science Press).
From a bacillus licheniformis, (Bacillus licheniformis ATCC14580, is purchased from NBRC, and article No. is NBRC12200) the production late log phase stage cultivated extracts bacteria RNA.Bacteria RNA is carried out transcript profile order-checking and builds storehouse, remove Ribosomal RNA, carries out reverse transcription to mRNA and sets up cDNA library.Transcript profile complete to antibacterial is analyzed, and turns according to representing gene The standardized data RPKM value of record level judges the gene that its expression level is higher, then analyzes its promoter region.By selected Promoter access carrier, measure promoter bacillus subtilis, (B.subtilis ATCC6051, is purchased from NBRC, and article No. is NBRC13719) activity in.
Embodiment 1
(1) cultivation of antibacterial: the taking-up of Bacillus licheniformis ATCC14580 (-80 DEG C) glycerol pipe is lined LB solid and puts down Cultivating 16h for 37 DEG C on plate, picking list bacterium colony is in the LB fluid medium containing 1% final concentration starch of 10mL, and 37 DEG C, 200rpm trains Support to OD60020～25 (spectrophotometer, Hitachi companies of Japan).
(2) extraction and the RNA-Seq of antibacterial total serum IgE checks order: the cell culture fluid 1mL that collection step (1) obtains is in 8000g The most centrifugal 1min, is used for extracting antibacterial total serum IgE (see Fig. 1).Concrete extracting method is thin with reference to Omega Bio-tek company Born of the same parents' antibacterial total RNA extraction reagent box.The sample prepared for RNA-Seq sequencing library is through Agilent Technologies 2100Bioanalyzer detection is qualified, processes the DNA molecular being mixed into through DNaseI (RNase Free), uses Ribo-Zero (Gram-Positive Bacteria) kit (USA) removes and accounts for the most of rRNA of total serum IgE, the mRNA that purification obtains.Will MRNA first interrupts the fragment into suitable size, with the mRNA of fragmentation as template, adds reverse transcription and random primer, and synthesis is double Chain cDNA, then with the cDNA of test kit QIAquick PCR Purification Kit (Qiagen) purification synthesis.Filling-in The sticky end of cDNA, then plus an adenylic acid on a chain, with this prominent A pairing containing prominent The one-level joint sequence of T.PCR amplification is carried out, through too much matching respectively under conditions of the primer at one-level joint two ends exists Secondary circulation, carry out PCR result gel electrophoresis and cut glue and reclaim the adhesive tape of predefined size, at this moment obtain plus secondary joint The library of sequence composition carry out upper machine order-checking (by patent documentation: Pan Li etc. a kind of DNA fragmentation with promoter function with should By .CN201510074949.0 [P] .2015. method).The order-checking in RNA-Seq library is by the Guangzhou limited public affairs of Ji Diao biotechnology Department provides order-checking service.Respectively two ends are read (PE100), referred to as reads to the sequence information of the 100bp at center during order-checking, The subsequent bio bioinformatics analysis such as annotation and expression calculating will be can be carried out in these reads comparisons to bacterial genomes.
(3) screening cloning promoter fragment: analyze Bacillus licheniformis transcript structures by RNA-Seq sequencing data And Whole genome analysis contains the gene of positions transcription initiation, quantified by RPKM, screen the gene that a strain expression is high, its core Nucleotide sequence is as follows:
agccctccggccaacccgtaccacaatggtttggattccctcagccacagccatacgagatagccgcccgcgatttc agccaaacccgccagtaaaaataaaccgattgcgatcatcatcaacaacacactccaattcacgtgaattgtctcta ttctacacgacataaaacggccgggaaagttcccgtttttcgggaaaataaacagaacgcgagtataggaactgtct cccccgaacctgttggaacggctccttcagcatgatataagtaaattgtaaacgcttataagggggctt。
With the genomic DNA of Bacillus licheniformis (Bacillus licheniformis ATCC14580) as template, draw Thing F-PglvA(5 '-cggaattcagccctccggccaacccgt-3 ') and R-PglvA(5’- Ggactagtaagcccccttataagcgttt-3 ') carry out expanding the DNA fragmentation of 300bp size, i.e. PglvAPromoter fragment (see Fig. 2), is consistent with purpose product size.Introduce restriction enzyme site EcoRI, SpeI.
(4) bgaB extracellular expression plasmid is built
With plasmid pBE-rbs-biobrick-bgaB (by patent documentation: Pan Li etc. a kind of DNA with promoter function Fragment builds with application .CN201510074949.0 [P] .2015.) it is expression plasmid, with restricted enzyme SalI at enzyme action Site is cut into linear plasmid, with F-rbs-SamyQ (5 '- Aactgcaggtaagagaggaatgtcgacatgattcaaaaacgaaagcg-3 ') and R-rbs-SamyQ (5 '- Attgaggataacacattcatggctgatgtttttgtaatcg-3 ') amplified signal peptide SamyQ is (such as SEQ ID NO.7 institute Show) PCR primer (see Fig. 3) of about 150bp size, containing nucleotide sequence: caattataggtaagagaggaatgtcgac, for The sequence of ribosome binding site.By In-fusion method, (concrete operation method is shown in the HiFi DNA of NEBuilder company Assembly Master Mix) signal peptide and plasmid are connected, obtain pBE-rbs-SamyQ-bgaB plasmid (see Fig. 4).
Step (3) obtains band EcoRI, the P of SpeI restriction enzyme siteglvAPromoter fragment is through enzyme action, insert after purification The above-mentioned pBE-rbs-SamyQ-bgaB plasmid construction cut with identical restricted enzyme EcoRI and SpeI obtains purpose and starts The bgaB gene extracellular expression plasmid pBE-P of songlvA-SamyQ-bgaB (see Fig. 5).
(5) MTG extracellular expression plasmid is built
With plasmid pBEp43-proMTG (by patent documentation: Pan Li etc. the bacillus subtilis of a plant weight group and production thereof Method .CN201210052578.2 [P] .2012. of T-5398 builds) it is expression plasmid, use restricted enzyme The restriction enzyme site of EcoR I and BamH I.With pBE-PglvA-SamyQ-bgaB plasmid is template, primers F-PglvA(5’- Cggaattcagccctccggccaacccgt-3 '), R-SamyQ (5 '-aaggatccggctgatgtttttgtaatcg-3 ') expands Increasing 5 ' to hold with EcoR I restriction enzyme site, 3 ' ends are with the about 450bp P of BamH I restriction enzyme siteglvA-SamyQ fragment (see Fig. 6). P is digested with restricted enzyme EcoR I and BamH IglvA-SamyQ fragment, reclaims, and inserts after purification and uses identical endonuclease digestion The plasmid pBEp43-proMTG of position (patent documentation: Pan Li etc. bacillus subtilis and the production thereof of a plant weight group turn paddy ammonia Method .CN201210052578.2 [P] .2012. of amidase), build and obtain MTG expression periplasm grain pBE-PglvA- SamyQ-proMTG (see Fig. 7).Wherein: PglvA-SamyQ nucleotides sequence is classified as: agccctccggccaacccgtaccacaatggtttggattccctcagccacagccatacgagatagccgcccgcgatttc agccaaacccgccagtaaaaataaaccgattgcgatcatcatcaacaacacactccaattcacgtgaattgtctcta ttctacacgacataaaacggccgggaaagttcccgtttttcgggaaaataaacagaacgcgagtataggaactgtct cccccgaacctgttggaacggctccttcagcatgatataagtaaattgtaaacgcttataagggggcttcaattata ggtaagagaggaatgtcgacatgattcaaaaacgaaagcggacagtttcgttcagacttgtgcttatgtgcacgctg ttatttgtcagtttgccgattacaaaaacatcagcc。
(6) detection of promoter expression level
The bgaB expression plasmid pBE-P of purpose promoter that will buildglvA-SamyQ-bgaB and MTG expression plasmid pBE-PglvA-SamyQ-proMTG first converts to escherichia coli (E.coli JM110) with chemical transformation, obtains positive colony Son, extracts plasmid after order-checking, and the method that electricity consumption converts converts to bacillus subtilis B.subtilis ATCC6051, specifically Method is with reference to non-patent literature record Natalia P, Zakataeva, Oksana V et al.A simple method to introduce marker-free genetic modification into chromosome of naturally nontransformable Bacillus amyloliquefaciens strains[J].Appl Microbiol Biotechnol.2010,85:1201-1209), bacterial strain B.subtilis ATCC6051 (pBE-P must be convertedglvA-SamyQ- And B.subtilis ATCC6051 (pBE-P bgaB)glvA-SamyQ-proMTG)。
The transformant B.subtilis ATCC6051 (pBE-P that will obtainglvA-SamyQ-bgaB) and B.subtilis ATCC6051(pBE-PglvA-SamyQ-proMTG) it is incubated in 10mL LB culture medium (kanamycin 20 μ g/mL), 37 DEG C, 200rpm activates 12h, and the seed liquor of activation is inoculated in 50mL LB culture medium (kanamycin 20 μ g/mL, 1% glucose) Inoculum concentration was 1% (volume ratio), 37 DEG C, and 200rpm always ferments 48h, every sampling in 6 hours.
The mensuration that β-glucose galactose glycosides enzyme enzyme is lived: by 32 μ L fermented supernatant fluids and 288 μ L 0.25%ONPG (o- Nitrophenyl-β-D-Galactopyranoside, ortho-nitrophenyl β-D-synthesis) mixing, incubation at 55 DEG C 15min, reaction terminating adds the 10%Na of 320 μ L2CO3.Reaction, in chromogenic reaction, measures light absorption value under 405nm wavelength.Right According to bacterial strain B.subtilis ATCC6051 (pBE-rbs-SamyQ-bgaB) without chromogenic reaction, under 405nm wavelength, measure extinction Value is similar with blank (LB), without β-glucose galactose glycosides enzymatic activity.Result shows promoter PglvAStart β-Fructus Vitis viniferae Sugar galactoside expression of enzymes, enzyme work is the highest in the expression of 30-48h, and wherein 48h reaches the highest enzyme 13.09U/mL (see Fig. 8) alive.
SDS-PAGE: by 48h fermentation liquid centrifuging and taking supernatant, supernatant runs SDS-PAGE electrophoresis, with wild type B spore Bacillus B.subtilis ATCC6051 is as comparison, and albumin glue figure shows have band and MTG albumen size one at 44-46KDa Cause, and wild type control in this magnitude range without band, experimental result illustrates that MTG pepsinogen is expressed (see Fig. 9).
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not by above-described embodiment Limit, the change made under other any spirit without departing from the present invention and principle, modify, substitute, combine, simplify, All should be the substitute mode of equivalence, within being included in protection scope of the present invention.

Claims (10)

1. a DNA fragmentation with promoter function, it is characterised in that: described DNA fragmentation is following any sequence:
(a) nucleotide sequence as shown in SEQ ID NO.1 or its complementary series；
B () carry out one or more nucleotide replacement to the nucleotide sequence as shown in SEQ ID NO.1, lack or add obtain , have the nucleotide sequence as promoter function identical with the nucleotide sequence as shown in SEQ ID NO.1 or Its complementary series；
C nucleotide sequence as shown in SEQ ID NO.1 is added the sequence of one or more ribosome binding sites by ().
The most according to claim 1, there is the DNA fragmentation of promoter function, it is characterised in that: described ribosome binding site Sequence be the nucleotide sequence as shown in SEQ ID NO.2.
3. there is described in claim 1 or 2 application in protein expression of the DNA fragmentation of promoter function.
4. a carrier, it is characterised in that: comprise the nucleotide sequence as shown in SEQ ID NO.1 and such as SEQ ID NO.2 institute The sequence of the ribosome binding site shown.
Carrier the most according to claim 4, it is characterised in that: containing the nucleotide sequence as shown in SEQ ID NO.10.
6. an expression plasmid, it is characterised in that: comprise the carrier described in claim 4 or 5 and company operable with this carrier Connect is positioned at this carrier downstream encoding heterologous protein nucleotide sequence.
Expression plasmid the most according to claim 6, it is characterised in that: described heterologous protein nucleotide sequence is the most thermally The nucleotide sequence of the thermostable beta-galactosidase that bacillus cereus (Geobacillus kaustophilus) encodes, or be that cyclopentadienyl is former The nucleotide sequence of the T-5398 that streptomycete (Streptomyces mobaraensia) encodes.
8. a recombined engineering cell, it is characterised in that: for the carrier described in claim 4 or 5 or claim 6 or 7 institute The cell strain that the Plastid transformation stated or transduction host cell obtain.
Recombined engineering cell the most according to claim 8, it is characterised in that: described host cell is bacillus cereus.
Recombined engineering cell the most according to claim 9, it is characterised in that: described host cell is bacillus subtilis Bacterium.
CN201610430767.7A 2016-06-15 2016-06-15 DNA fragment with promoter function and application thereof Active CN106086025B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610430767.7A CN106086025B (en) 2016-06-15 2016-06-15 DNA fragment with promoter function and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610430767.7A CN106086025B (en) 2016-06-15 2016-06-15 DNA fragment with promoter function and application thereof

Publications (2)

Publication Number Publication Date
CN106086025A true CN106086025A (en) 2016-11-09
CN106086025B CN106086025B (en) 2020-02-18

Family

ID=57236139

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610430767.7A Active CN106086025B (en) 2016-06-15 2016-06-15 DNA fragment with promoter function and application thereof

Country Status (1)

Country Link
CN (1) CN106086025B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106480036A (en) * 2016-11-30 2017-03-08 华南理工大学 A kind of DNA fragmentation with promoter function and its application
CN106947766A (en) * 2017-04-12 2017-07-14 华南理工大学 A kind of bacillus subtilis has DNA fragmentation and its application of promoter function
CN107119051A (en) * 2017-04-12 2017-09-01 华南理工大学 A kind of bacillus megaterium has DNA fragmentation and its application of promoter function
CN107698668A (en) * 2017-10-23 2018-02-16 华南理工大学 A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104630229A (en) * 2015-02-11 2015-05-20 华南理工大学 DNA fragment with promoter function and application

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104630229A (en) * 2015-02-11 2015-05-20 华南理工大学 DNA fragment with promoter function and application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
WWW.NCBI.NLM.NIH.GOV/GENBANK: "Genbank Accession：CP000002.3", 《WWW.NCBI.NLM.NIH.GOV/GENBANK》 *
余志强: "枯草芽孢杆菌麦芽糖启动子P△glvA整合表达载体的构建及启动子功能的初步探讨", 《中国优秀硕士学位论文全文数据库工程科技I辑》 *
张辉 等: "《细胞生物学理论及发展研究》", 31 August 2015, 中国水利水电出版社 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106480036A (en) * 2016-11-30 2017-03-08 华南理工大学 A kind of DNA fragmentation with promoter function and its application
CN106480036B (en) * 2016-11-30 2019-04-09 华南理工大学 A kind of DNA fragmentation and its application with promoter function
CN106947766A (en) * 2017-04-12 2017-07-14 华南理工大学 A kind of bacillus subtilis has DNA fragmentation and its application of promoter function
CN107119051A (en) * 2017-04-12 2017-09-01 华南理工大学 A kind of bacillus megaterium has DNA fragmentation and its application of promoter function
CN106947766B (en) * 2017-04-12 2020-08-18 华南理工大学 Bacillus subtilis DNA fragment with promoter function and application thereof
CN107119051B (en) * 2017-04-12 2020-09-22 华南理工大学 Bacillus megaterium DNA fragment with promoter function and application thereof
CN107698668A (en) * 2017-10-23 2018-02-16 华南理工大学 A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency

Also Published As

Publication number Publication date
CN106086025B (en) 2020-02-18

Similar Documents

Publication Publication Date Title
Vester et al. Improved cultivation and metagenomics as new tools for bioprospecting in cold environments
Yao et al. Multiple gene repression in cyanobacteria using CRISPRi
Wang et al. Bacterial genome editing with CRISPR-Cas9: deletion, integration, single nucleotide modification, and desirable “clean” mutant selection in Clostridium beijerinckii as an example
Iqbal et al. Biocatalysts and small molecule products from metagenomic studies
Vercruysse et al. Stress response regulators identified through genome-wide transcriptome analysis of the (p) ppGpp-dependent response in Rhizobium etli
CN106947766A (en) A kind of bacillus subtilis has DNA fragmentation and its application of promoter function
Maus et al. Complete genome sequence of the strain Defluviitoga tunisiensis L3, isolated from a thermophilic, production-scale biogas plant
Golanowska et al. Comparison of highly and weakly virulent Dickeya solani strains, with a view on the pangenome and panregulon of this species
CN106086025A (en) A kind of DNA fragmentation with promoter function and application thereof
Specht et al. Synthetic oligonucleotide libraries reveal novel regulatory elements in Chlamydomonas chloroplast mRNAs
Zhan et al. Complete genome sequence of Maribacter sp. T28, a polysaccharide-degrading marine flavobacteria
CN100439506C (en) Escherichia coli self-cracking method and its dedicated carrier and application
CN104630229B (en) A kind of DNA fragmentation and application with promoter function
Yamada et al. Retrieval of entire genes from environmental DNA by inverse PCR with pre‐amplification of target genes using primers containing locked nucleic acids
Kimura Novel biological resources screened from uncultured bacteria by a metagenomic method
Cebolla et al. Improvement of recombinant protein yield by a combination of transcriptional amplification and stabilization of gene expression
Baroncelli et al. Genome evolution and transcriptome plasticity associated with adaptation to monocot and eudicot plants in Colletotrichum fungi
Yin et al. The hybrid strategy of Thermoactinospora rubra YIM 77501T for utilizing cellulose as a carbon source at different temperatures
Ren et al. Construction of a Stable Expression System Based on the Endogenous hbpB/hbpC Toxin–Antitoxin System of Halomonas bluephagenesis
Söderberg et al. Aliivibrio wodanis as a production host: development of genetic tools for expression of cold-active enzymes
Quixley et al. Construction of a reporter gene vector for Clostridium beijerinckii using a Clostridium endoglucanase gene
Reimann et al. Specificities and functional coordination between the two Cas6 maturation endonucleases in Anabaena sp. PCC 7120 assign orphan CRISPR arrays to three groups
CN104789564B (en) A kind of method of promoter and recombinant expression carrier and application thereof and expression foreign protein
CN107119051B (en) Bacillus megaterium DNA fragment with promoter function and application thereof
Nemr et al. Culture media based on leaf strips/root segments create compatible host/organ setup for in vitro cultivation of plant Microbiota

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant