CN106086025B

CN106086025B - DNA fragment with promoter function and application thereof

Info

Publication number: CN106086025B
Application number: CN201610430767.7A
Authority: CN
Inventors: 潘力; 刘欣; 王斌; 廖瑜玲
Original assignee: South China University of Technology SCUT
Current assignee: South China University of Technology SCUT
Priority date: 2016-06-15
Filing date: 2016-06-15
Publication date: 2020-02-18
Anticipated expiration: 2036-06-15
Also published as: CN106086025A

Abstract

The invention discloses a DNA fragment with a promoter function and application thereof. The DNA fragment is any one of the following sequences: (a) a nucleotide sequence shown as SEQ ID NO.1 or a complementary sequence thereof; (b) a nucleotide sequence which is obtained by substituting, deleting or adding one or more nucleotides into the nucleotide sequence shown in SEQ ID NO.1 and has the same function as a promoter as the nucleotide sequence shown in SEQ ID NO.1 or a complementary sequence thereof; (c) a sequence in which one or more ribosome binding sites are added to the nucleotide sequence shown in SEQ ID NO. 1. The DNA fragment has the function of a promoter, has strong specific expression activity, can realize high expression of the exogenous gene under the condition of not adding an inducer, and particularly provides an effective element for expressing the exogenous gene by using the bacillus subtilis.

Description

DNA fragment with promoter function and application thereof

Technical Field

The invention relates to a DNA fragment, in particular to a DNA fragment with a promoter function and application thereof.

Background

The protein expression system is an important research content of modern biotechnology and is widely applied to the fields of food, pharmacy, detergent production and the like. The prokaryotic expression system has the characteristics of fast growth, easy culture, high expression quantity, clear genetic background and simple molecular operation, is suitable for engineering strain modification and the like, and is widely applied to the expression of heterologous proteins. Currently, more mature prokaryotic expression systems include Escherichia coli and Bacillus subtilis. Since E.coli is not suitable as a host for large-scale expression of heterologous proteins, while B.burgundi is a commonly used system for large-scale production of industrial enzyme preparations. The Bacillus subtilis host has the advantages that: the well-known safe strain has secretion expression and no obvious codon preference.

In genetic engineering, a vector for highly expressing heterologous proteins is often required to be constructed, and a promoter has great influence on the expression level of foreign genes and is an important component element of a genetic engineering expression vector. The promoter is where RNA polymerase binds to begin transcription to synthesize mRNA, and the efficiency of binding of the promoter to RNA polymerase is critical for affecting the expression of the enzyme gene. Research shows that the bacillus contains abundant sigma factors (12 types), and the specific binding of RNA polymerase and a promoter depends on the sigma factors, so that efficient promoters are difficult to search in the bacillus. At present, three types of promoters are reported for expressing recombinant proteins by bacillus, namely an inducible promoter, different inducers are required to be added, and the weak point is that the starting efficiency is low; secondly, the promoter type related to the growth stage is activated in different growth stages, has high starting intensity and can not continuously express; finally, a self-inducible promoter. Therefore, the research on the functions of the promoter has important significance for understanding the growth and development of organisms, discussing the mechanism of the biological adaptive environment, realizing the high-efficiency expression of exogenous genes and the like.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a DNA fragment with the function of a promoter.

Another object of the present invention is to provide a use of the DNA fragment.

The purpose of the invention is realized by the following technical scheme: a DNA fragment with promoter function, wherein the DNA fragment has any one of the following sequences:

(a) a nucleotide sequence shown as SEQ ID NO.1 or a complementary sequence thereof;

(b) a nucleotide sequence which is obtained by substituting, deleting or adding one or more nucleotides into the nucleotide sequence shown in SEQ ID NO.1 and has the same function as a promoter as the nucleotide sequence shown in SEQ ID NO.1 or a complementary sequence thereof;

(c) a sequence in which one or more ribosome binding sites are added to the nucleotide sequence shown in SEQ ID NO. 1.

The sequence of the ribosome binding site is a nucleotide sequence shown as SEQ ID NO. 2.

The application of the DNA segment with the promoter function in protein expression.

A vector comprises a nucleotide sequence shown as SEQ ID NO.1 and a sequence of ribosome binding site shown as SEQ ID NO.2

The carrier contains a nucleotide sequence shown as SEQ ID NO. 10.

An expression plasmid comprising the above vector and, operably linked to the vector, a nucleotide sequence encoding a heterologous protein located downstream of the vector.

The nucleotide sequence of the heterologous protein is a nucleotide sequence of heat-resistant β -galactosidase coded by Geobacillus kaustophilus (Geobacillus kaustophilus) or a nucleotide sequence of transglutaminase coded by Streptomyces mobaraensis (Streptomyces mobaraensis).

A recombinant engineered cell is a cell strain obtained by transforming or transducing a host cell with the vector or the plasmid.

The host cell is bacillus.

The host cell is bacillus subtilis.

Compared with the prior art, the invention has the following advantages and effects:

the invention relates to a method for determining a whole gene transcriptome of bacillus licheniformis in the late logarithmic growth phase by using an RNA-seq technology, screening a high-expression gene, finding a gene with high transcriptional activity in the bacillus licheniformis, cloning a promoter sequence corresponding to the screened high-expression gene, applying the promoter sequence to the expression of a heat-resistant β -galactosidase gene (bgaB), proving that the screened promoter has high activity in the bacillus subtilis by determining the activity of the bgaB, applying the promoter sequence to the expression of transglutaminase (MTG), and verifying the protein expression of the bacillus licheniformis by an SDS-PAGE electrophoresis chart.

That is, the present invention provides a DNA fragment having a promoter function, having a strong specific expression activity, capable of realizing high expression of a foreign gene without adding an inducer, and particularly providing an effective element for Bacillus subtilis to express a foreign gene.

Drawings

FIG. 1 is an electrophoretogram of total RNA extracted from Bacillus licheniformis in late log phase growth in example 2;

lanes

1 and 2, among others, extract total RNA from Bacillus amyloliquefaciens in late log growth phase, respectively.

FIG. 2 is the amplification of P in example 3_glvAElectrophoretogram of the PCR product of (1); wherein, Lane M is DNA Marker; lane 1 is P_glvAThe PCR amplification product of (1).

FIG. 3 is an electrophoretogram of PCR products for amplification of the SamyQ signal peptide in example 4; wherein lane M is DNA Marker and lane 1 is the PCR amplification product of SamyQ signal peptide.

FIG. 4 is a schematic diagram of the construction of the plasmid pBE-rbs-SamyQ-bgaB of example 4.

FIG. 5 is the expression plasmid pBE-P of example 4_glvASchematic construction of SamyQ-bgaB.

FIG. 6 is the amplification of P in example 5_glvA-a samyQ fragment electropherogram; wherein lane M is a DNA Marker, lane 1 is P_glvA-samyQ amplification product.

FIG. 7 is the expression plasmid pBE-P of example 5_glvASchematic construction of SamyQ-proMTG.

FIG. 8 is example 6B. subtilis ATCC6051 (pBE-P)_glvA-SamyQ-bgaB) transformant.

FIG. 9 is example 6B. subtilis ATCC6051 (pBE-P)_glvASamyQ-proMTG) transformant MTG expression SDS-PAGE gel.

Detailed Description

The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto.

The techniques of molecular biology experiments used in the following examples include PCR amplification, plasmid extraction, DNA fragmentation, ligation, gel electrophoresis, etc., as described in detail in molecular cloning, A laboratory Manual (third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peyer et al, 2002, Beijing: scientific Press).

Bacterial RNA was extracted from the late logarithmic phase of production by culturing a strain of Bacillus licheniformis (ATCC 14580, available from NBRC under the accession number NBRC 12200). And (3) performing transcriptome sequencing on the bacterial RNA to build a library, removing ribosomal RNA, and performing reverse transcription on mRNA to build a cDNA library. The bacterial whole transcriptome was analyzed, genes with higher expression levels were judged from the normalized RPKM values representing the gene transcription levels, and then the promoter regions were analyzed. The selected promoter was ligated into a vector, and the activity of the promoter in Bacillus subtilis ATCC6051 (purchased from NBRC, cat. NBRC13719) was determined.

Example 1

(1) And (3) culturing bacteria: taking out Bacillus licheniformis ATCC14580(-80 deg.C) glycerol tube, streaking on LB solid plate, culturing at 37 deg.C for 16h, picking single colony in 10mL LB liquid culture medium containing 1% final concentration starch, culturing at 37 deg.C and 200rpm to OD ₆₀₀20 to 25 (spectrophotometer, Hitachi, Japan).

(2) Extraction of bacterial total RNA and RNA-Seq sequencing: 1mL of the cell culture solution obtained in step (1) was collected and subjected to rapid centrifugation at 8000g for 1min for extraction of bacterial total RNA (see FIG. 1). The specific extraction method refers to the extraction kit of total RNA of cell bacteria from Omega Bio-tek company. Samples for RNA-Seq sequencing library preparation were qualified by Agilent Technologies2100Bioanalyzer, mixed DNA molecules were treated with DNaseI (RNase free), rRNA, which accounted for the majority of total RNA, was removed using Ribo-Zero (Gram-Positive Bacteria) kit (USA), and the resulting mRNA was purified. The mRNA was first fragmented into fragments of appropriate size, double-stranded cDNA was synthesized using the fragmented mRNA as a template and adding reverse transcriptase and random primers, and then the synthesized cDNA was purified using the QIAquick PCR Purification Kit (Qiagen). The sticky end of the cDNA is filled in and an adenine nucleotide is added to one strand to pair the primary linker sequence containing the overhanging T with this overhanging A. PCR amplification is carried out under the condition that primers capable of respectively matching two ends of a primary joint exist, after multiple cycles, gel electrophoresis is carried out on the PCR result, the rubber tape with a preset size is recovered by cutting rubber, and the obtained library consisting of the sequence added with the secondary joint is subjected to on-machine sequencing (according to patent documents, Panli and the like, a DNA fragment with a promoter function and the application, CN201510074949.0[ P ] 2015. method). Sequencing of RNA-Seq libraries sequencing services were provided by Diao Biotechnology, Inc., Youzhou. In sequencing, 100bp sequence information from both ends toward the center (PE100) was read, and these reads were aligned with the bacterial genome to allow for subsequent bioinformatic analyses such as annotation and expression level calculation.

(3) Screening and cloning of promoter fragments: analyzing the structure of a bacillus licheniformis transcript by RNA-Seq sequencing data and analyzing a gene containing a transcription starting position by a whole genome, and screening a gene with high expression quantity by RPKM (reverse transcription-polymerase chain reaction) quantification, wherein the nucleotide sequence of the gene is shown as follows:

agccctccggccaacccgtaccacaatggtttggattccctcagccacagccatacgagatagccgcccgcgatttcagccaaacccgccagtaaaaataaaccgattgcgatcatcatcaacaacacactccaattcacgtgaattgtctctattctacacgacataaaacggccgggaaagttcccgtttttcgggaaaataaacagaacgcgagtataggaactgtctcccccgaacctgttggaacggctccttcagcatgatataagtaaattgtaaacgcttataagggggctt。

the primer F-P takes the genome DNA of Bacillus licheniformis (Bacillus licheniformis ATCC14580) as a template_glvA(5'-cggaattcagccctccggccaacccgt-3') and R-P_glvA(5'-ggactagtaagcccccttataagcgttt-3') amplification of a DNA fragment of 300bp in size, i.e., P_glvAThe promoter fragment (see FIG. 2), is of a size consistent with the product of interest. The restriction sites EcoRI and SpeI were introduced.

(4) Construction of a bgaB extracellular expression plasmid

A plasmid pBE-rbs-biobrick-bgaB (constructed according to the patent document: Panli et al. a DNA fragment with promoter function and application. CN201510074949.0[ P ]. 2015.) is used as an expression plasmid, a restriction enzyme SalI is used for cutting at an enzyme cutting site to form a linear plasmid, F-rbs-SamyQ (5'-aactgcaggtaagagaggaatgtcgacatgattcaaaaacgaaagcg-3') and R-rbs-SamyQ (5'-attgaggataacacattcatggctgatgtttttgtaatcg-3') are used for amplifying a PCR product with a signal peptide SamyQ (shown as SEQ ID NO. 7) of about 150bp (shown in figure 3) and contains nucleotide sequences: caattataggtaagagaggaatgtcgac, is the sequence of the ribosome binding site. The signal peptide was ligated to the plasmid by In-fusion (see HiFi DNA Assembly Master Mix of NEBuilder Co., Ltd.) to obtain pBE-rbs-SamyQ-bgaB plasmid (see FIG. 4).

Obtaining P with EcoRI and SpeI enzyme cutting sites in the step (3)_glvAThe promoter fragment is inserted into the pBE-rbs-SamyQ-bgaB plasmid which is cut by the same restriction enzymes EcoRI and SpeI after enzyme digestion and purification to construct the bgaB gene extracellular expression plasmid pBE-P of the target promoter_glvASamyQ-bgaB (see FIG. 5).

(5) Construction of MTG extracellular expression plasmid

The plasmid pBEp43-proMTG (according to patent literature: Panli et al. a recombinant bacillus subtilis and a method for producing transglutaminase CN201210052578.2[ P201210052578.2 ]]2012) was constructed as an expression plasmid with restriction sites for the restriction enzymes EcoRI and BamHI. With pBE-P_glvA-SamyQ-bgaB plasmid as template, primer F-P_glvA(5'-cggaattcagccctccggccaacccgt-3') and R-SamyQ (5'-aaggatccggctgatgtttttgtaatcg-3') amplifying about 450bp P with EcoRI enzyme cutting site at 5 'end and BamHI enzyme cutting site at 3' end_glvAThe SamyQ fragment (see FIG. 6). Digestion of P with the restriction enzymes EcoRI and BamHI_glvAThe SamyQ fragment was recovered, purified and inserted into the plasmid pBEp43-proMTG digested with the same endonuclease (patent document: Panli et al. A recombinant Bacillus subtilis strain and a process for producing transglutaminase CN201210052578.2[ P ]]2012.), construction to obtain MTG expression extracellular plasmid pBE-P_glvASamyQ-proMTG (see FIG. 7). Wherein: p_glvA-the SamyQ nucleotide sequence is: agccctccggccaacccgtaccacaatggtttggattccctcagccacagccatacgagatagccgcccgcgatttcagccaaacccgccagtaaaaataaaccgattgcgatcatcatcaacaacacactccaattcacgtgaattgtctctattctacacgacataaaacggccgggaaagttcccgtttttcgggaaaataaacagaacgcgagtataggaactgtctcccccgaacctgttggaacggctccttcagcatgatataagtaaattgtaaacgcttataagggggcttcaattataggtaagagaggaatgtcgacatgattcaaaaacgaaagcggacagtttcgttcagacttgtgcttatgtgcacgctgttatttgtcagtttgccgattacaaaaacatcagcc。

(6) Detection of promoter expression levels

The well-constructed bgaB expression plasmid pBE-P of the target promoter_glvASamyQ-bgaB and MTG expression plasmid pBE-P_glvAFirstly, SamyQ-proMTG is transformed into escherichia coli (E.coli JM110) by a chemical transformation method to obtain positive clones, plasmids are extracted after sequencing, and the positive clones are transformed into Bacillus subtilis ATCC6051 by an electrical transformation method, wherein the specific method refers to a non-patent document record of Natali P, Zakataeva, Oksana V et al.A. simple method of toxin marker-free genetic modification in vitro chromosome of naturally transformed Bacillus amyloliquefaciens strain [ J]Appl Microbiol Biotechnol.2010,85:1201-1209) to obtain the transformed strain B.subtilis ATCC6051 (pBE-P)_glvASamyQ-bgaB) and B.subtilis ATCC6051 (pBE-P)_glvA-SamyQ-proMTG)。

The resulting transformant B.subtilis ATCC6051 (pBE-P)_glvASamyQ-bgaB) and B.subtilisaTCC6051 (pBE-P)_glvASamyQ-proMTG) was cultured in 10mL of LB medium (kanamycin 20. mu.g/mL), activated at 37 ℃ for 12 hours at 200rpm, and the activated seed solution was inoculated into 50mL of LB medium (kanamycin 20. mu.g/mL, 1% glucose) in an inoculum size of 1% (by volume), fermented at 37 ℃ at 200rpm for 48 hours in total, and sampled every 6 hours.

β determination of enzyme Activity of glucosylcalactosidase enzyme, 32. mu.L of fermentation supernatant was mixed with 288. mu.L of 0.25% ONPG (o-Nitrophenyl- β -D-Galactopyranoside, o-nitrobenzene β -D-Galactopyranoside), incubated at 55 deg.C for 15min, and 320. mu.L of 10% Na was added after termination of the reaction₂CO₃The control strain B. subtilis ATCC6051(pBE-rbs-SamyQ-bgaB) has no chromogenic reaction, and the absorbance measured at 405nm is almost the same as that of the blank control (LB), and has no β -glucose galactosidase activity_glvAβ -glucosylcalactoside expression is started, the enzyme activity is highest in 30-48h, wherein the highest enzyme activity is reached in 48h, and 13.09U/mL (see figure 8).

SDS-PAGE: the supernatant obtained by centrifuging the 48h fermentation liquor was subjected to SDS-PAGE electrophoresis, and compared with wild type Bacillus subtilis ATCC6051, the protein gel image showed that the band was identical to the MTG protein size at 44-46kDa, while the wild type control showed no band at this size, indicating that MTG zymogen was expressed (see FIG. 9).

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Claims

1. A DNA fragment having a promoter function, characterized in that: the DNA segment is shown as SEQ ID NO. 10.

2. Use of the DNA fragment having a promoter function according to claim 1 for protein expression.

3. A carrier, characterized by: a sequence comprising the nucleotide sequence shown as SEQ ID NO. 10.

4. An expression plasmid, characterized in that: comprising the sequence of claim 3 comprising the nucleotide sequence set forth in SEQ ID No.10 operably linked to a nucleotide sequence encoding a heterologous protein downstream of the sequence.

5. The expression plasmid of claim 4, wherein: the nucleotide sequence of the heterologous protein is Bacillus thermohaliotis (A)Geobacillus kaustophilus) Nucleotide sequence encoding a thermotolerant β -galactosidase, or Streptomyces mobaraensis: (Streptomyces mobaraensia) A nucleotide sequence encoding a transglutaminase.

6. A recombinantly engineered cell characterized by: a cell line obtained by transforming or transducing a host cell with the vector of claim 3 or the plasmid of claim 4 or 5.

7. The recombinantly engineered cell of claim 6, wherein: the host cell is bacillus.

8. The recombinantly engineered cell of claim 7, wherein: the host cell is bacillus subtilis.