CN107857802A - A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency - Google Patents

A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency Download PDF

Info

Publication number
CN107857802A
CN107857802A CN201710990142.0A CN201710990142A CN107857802A CN 107857802 A CN107857802 A CN 107857802A CN 201710990142 A CN201710990142 A CN 201710990142A CN 107857802 A CN107857802 A CN 107857802A
Authority
CN
China
Prior art keywords
signal peptide
bacillus subtilis
nucleotide sequence
seq
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710990142.0A
Other languages
Chinese (zh)
Inventor
潘力
刘欣
叶燕锐
王斌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China University of Technology SCUT
Original Assignee
South China University of Technology SCUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China University of Technology SCUT filed Critical South China University of Technology SCUT
Priority to CN201710990142.0A priority Critical patent/CN107857802A/en
Publication of CN107857802A publication Critical patent/CN107857802A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/104—Aminoacyltransferases (2.3.2)
    • C12N9/1044—Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • C12N9/2471—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/02—Aminoacyltransferases (2.3.2)
    • C12Y203/02013—Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01023—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses signal peptide and its application that a kind of bacillus subtilis can improve secernment efficiency.The amino acid sequence of the signal peptide is as shown in SEQ ID NO.1.The nucleotide sequence for encoding the signal peptide is selected from following any sequence：(a) nucleotide sequence or its complementary series as shown in SEQ ID NO.2；(b) carry out what one or more nucleotides substitution, missing or additions were obtained to the nucleotide sequence shown in SEQ ID NO.2, have and nucleotide sequence or its complementary series of the nucleotide sequence identical shown in SEQ ID NO.2 as signal peptide function.The present invention can make the increase of beta galactosidase secretory volume by merging signal peptide, and enzyme activity is further enhanced.The present invention realizes transglutaminase proenzyme secreting, expressing by merging signal peptide.

Description

A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency
Technical field
The invention belongs to gene engineering technology field, more particularly to a kind of bacillus subtilis can improve the letter of secernment efficiency Number peptide and its application.
Background technology
Bacillus subtillis (Bacillus subttlis) is to be only second to Escherichia coli in prokaryotes research field The important model bacterium of (Escherichia coli), it is the comparatively ideal place of secreting, expressing foreign protein in current prokaryotic expression system It is main.The advantages of host is：Generally acknowledged safe bacterial strain, secreting, expressing, without obvious codon bias；Growth is fast, easily culture, table It is high up to amount, the characteristics of genetic background understands and molecule manipulation is simple, and it is appropriate for the significant advantages such as engineered strain transformation.
Signal peptide has extreme influence to the expression of foreign gene, is the important composition for realizing heterologous protein secretion expression Element.Signal peptide is a kind of polypeptide with 15-60 amino acid, is generally located at the N-terminal of secretory protein.Usually will coding The gene order of destination protein is cloned into the C-terminal of signal peptide, so as to realize that target gene and signal peptide sequence exist in Host Strains The horizontal fusion of transcription and translation.Signal peptide guides whole polypeptide chain and intracellular molecular chaperones or secretion signal recognition site phase With reference to, and then transmembrane transport is to extracellular.Therefore, study different types of signal peptide for realize foreign gene high efficient expression and Mechanism of secretion etc. is significant.
The content of the invention
The shortcomings that primary and foremost purpose of the present invention is to overcome prior art and deficiency, there is provided a kind of bacillus subtilis can carry The signal peptide of hypersecretion efficiency.
The coding that can improve the signal peptide of secernment efficiency another object of the present invention is to provide the bacillus subtilis Gene.
A further object of the present invention is the application for providing the signal peptide that the bacillus subtilis can improve secernment efficiency.
The purpose of the present invention is achieved through the following technical solutions：A kind of bacillus subtilis can improve the signal of secernment efficiency Peptide, its amino acid sequence is as shown in SEQ ID NO.1.
The gene of signal peptide of secernment efficiency can be improved by encoding the bacillus subtilis, and its nucleotide sequence is selected from as follows Any sequence：
(a) nucleotide sequence or its complementary series as shown in SEQ ID NO.2；
(b) one or more nucleotides substitutions, missing or addition institute are carried out to the nucleotide sequence shown in SEQ ID NO.2 Obtain, have with the nucleotide sequence identical shown in SEQ ID NO.2 as the nucleotide sequence of signal peptide function or Its complementary series.
Can be improved containing any of the above-described bacillus subtilis the gene of the signal peptide of secernment efficiency recombinant expression carrier, Recombination engineering bacteria, transgenic cell line or expression cassette fall within protection scope of the present invention.
Described recombination engineering bacteria is the signal that any of the above-described bacillus subtilis can be improved to secernment efficiency The Gene Fusion of peptide makes the N-terminal fusion of the albumen of the gene code after fusion have corresponding signal to the N-terminal for needing expressing gene Peptide；The genetic engineering bacterium that beta galactosidase ability improves preferably is secreted, or is the gene work that can secrete transglutaminase Journey bacterium；More preferably Bacillus subtilis genes engineering bacteria.
Described bacillus subtilis can improve the signal peptide of secernment efficiency answering in destination protein secreting, expressing is improved With.
Described destination protein is thermostable beta-galactosidase or transglutaminase.
Described protein secretion is expressed as the secreting, expressing in prokaryotic expression system.
Described prokaryotic expression system is preferably bacillus subtilis；More preferably bacillus subtilis ATCC6051 (B.subtilis ATCC6051)。
The present invention is had the following advantages relative to prior art and effect：
1st, the present invention is by from bacillus subtilis homologous protein signal peptide storehouse, building various signal peptides and beta galactose The expression vector that glycosides enzyme coding gene is combined, with reference to high-throughout screening technique, beta galactosidase point can be improved by filtering out The signal peptide secreted.The expression vector that the signal peptide is combined with transglutaminase proenzyme encoding gene is built simultaneously, is realized The secreting, expressing of transglutaminase proenzyme.
2nd, the invention provides a kind of amino acid fragment, there is the signal peptide of very strong secreting, expressing activity, can realize outer The high expression of source gene, effective element is provided especially for bacillus subtilis expression alien gene.
3rd, the present invention can make the increase of beta galactosidase secretory volume by merging signal peptide, and enzyme activity is further carried It is high.
4th, the present invention realizes transglutaminase proenzyme secreting, expressing by merging signal peptide.
Brief description of the drawings
Fig. 1 is the PCR primer electrophoretogram that biobrick is expanded in embodiment 1；Wherein, swimming lane M is marker DNA, swimming lane 1 is biobrick pcr amplification product.
Fig. 2 is plasmid pBEp43s-biobrick-bgaB and plasmid pBEp43-SP-bgaB structures signal in embodiment 1 Figure.
Fig. 3 is amplification SPexoA fragment electrophoretic figures in embodiment 2；Wherein, swimming lane M：marker DNA；Swimming lane 1 is SPexoA fragments.
Fig. 4 is the structure schematic diagram of expression plasmid pBEp43-SPexoA-proMTG in embodiment 2.
Fig. 5 is the SDS-PAGE that B.subtilis ATCC6051 (pBEp43-SPexoA-proMTG) are expressed in embodiment 2 Running gel figure；Wherein, swimming lane M：marker；Swimming lane 1 is B.subtilis ATCC6051；Swimming lane 2 is B.subtilis ATCC6051(pBEp43-SPexoA–proMTG；Arrow represents destination protein MTG position.
Embodiment
With reference to embodiment, the present invention is described in further detail, but the implementation of the present invention is not limited to this.
Molecular biology experiment technology employed in following examples includes PCR amplifications, plasmid extraction, DNA fragmentation enzyme Cut, connect, gel electrophoresis etc. referring specifically to《Molecular Cloning:A Laboratory guide》(third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peitangs etc. are translated, and 2002, Beijing:Science Press).
The screening of the signal peptide of the beta galactosidase efficient secretory expression of embodiment 1
With reference to the method for (Christian Degering et.Al, 2010), by from bacillus subtilis homologous protein In signal peptide storehouse, the expression vector that various signal peptides are combined with beta galactosidase encoding gene (bgaB) is built, with reference to height The screening technique of flux, the signal peptide for improving beta galactosidase secretion effect in various degree is obtained from clone, is specifically included Following steps：
(1) pBEp43-biobrick-bgaB carriers are built：With two sections of artificial synthesized fragment SEQ ID NO.3, SEQ ID The PCR fragment for the biobrick (biological building blocks) that NO.4 annealing extensions obtain carries restriction enzyme site Kpn I and Xho I, and use is restricted The PCR primer (such as Fig. 1) of endonuclease digestion and the 100bp sizes purified insertion plasmid pBE-P43-bgaB (presses patent document：Pan A kind of DNA fragmentations with promoter function of the such as power and application .CN201510074949.0 [P] .2015. are built) identical inscribe Enzyme position, obtain pBEp43s-biobrick-bgaB plasmids (such as Fig. 2), the biobrick of design PCR fragment such as SEQ ID Shown in NO.5.The PCR fragment base sequence of amplification is sequenced by Sanger to be confirmed.
(2) pBEp43-SP (signal peptide database)-bgaB carriers are built：Extract bacillus subtilis (Bacillus subttlis168, being purchased from Guangdong Province's Culture Collection) genomic DNA (Omega bacterial genomes DNA extraction agents box), use corresponding primer (F-SpexoA：5′- GAGAGGAATGTCGACATGAATAATAATAAACTATTGCTGG-3′；R-SpexoA：5′- CGTTGTCCATCTCGAGAGCCGTGGCAAAAAAGGCCCGGAA-3 ') expanded, PCR primer is reclaimed into (Omega DNA Gel reclaims kit), inserted by Cloning Transformation in the above-mentioned pBEp43-biobrick-bgaB carriers built, use enzyme Enzyme site is Kpn I and Xho I, is built into pBEp43-SP-bgaB carriers (such as Fig. 2).
(3) the pBEp43-SP-bgaB carriers built are passed through into electricity going to Bacillus subtillis B.subtilis ATCC6051, specific method is with reference to non-patent literature record (Natalia P, Zakataeva, Oksana V et al.A simple method to introduce marker-free genetic modification into chromosome of naturally nontransformable Bacillus amyloliquefaciens strains[J].Appl Microbiol Biotechnol.2010,85:1201-1209), cloned in resistant panel (the μ g/mL of kanamycins 20) Son.
(4) picked clones uses 96 orifice plate cultures, by determining β-glucose galactose glycosides enzyme enzyme activity, it is determined that secretion is excellent The clone of change.The measure of β-glucose galactose glycosides enzyme enzyme activity：By 32 μ L nutrient solutions and 288 μ L 0.25%ONPG (o- Nitrophenyl- β-D-Galactopyranoside, ortho-nitrophenyl β-D- synthesis) mix, incubated at 55 DEG C 15min, reaction terminating add 320 μ L (w/w) Na2CO3.Reaction is in chromogenic reaction, and light absorption value is determined under 405nm wavelength.
(5) secretion optimization clone is sequenced, determines whether signal peptide is changed.Screen and obtain by above-mentioned steps The signal peptide of beta galactosidase secretion effect can be improved, is the signal peptide of exoA genes, amino acid sequence after NCBI verifications For：MNNNKLLLVDGMALLFRAFFATA (SEQ ID NO.1), the nucleotides sequence for encoding the amino acid sequence is classified as： ATGAATAATAATAAACTATTGCTGGTTGACGGCATGGCTCTTTTATTCCGGGCCTTTTTTGCCACGGCT(SEQ ID NO.2)。
The detection of the signal peptide expression of embodiment 2
(1) MTG (transglutaminase) extracellular expression plasmid is built：Patent document (is pressed with plasmid pBEp43-proMTG： The bacillus subtilis of the plant weight groups of the such as Pan Li mono- and its method .CN201210052578.2 [P] for producing transglutaminase .2012. build) be expression plasmid, the pBEp43-SPexoA-bgaB plasmids obtained using above-described embodiment 1 as template, primers F- SPexoA(5′-GAGAGGAATGTCGACATGAATAATAATAAACTATTGCTGG-3′)、R-SPexoA(5′- CGTTGTCCATCTCGAGAGCCGTGGCAAAAAAGGCCCGGAA-3 ') amplification about 100bp SPexoA fragments (see Fig. 3).With In-fusion methods (concrete operation method is shown in the HiFi DNA Assembly Master Mix of NEBuilder companies) will be believed Number peptide (SPexoA fragments) and plasmid (pBEp43-proMTG) connection, structure obtain MTG and express extracellular plasmid pBEp43- SPexoA-proMTG (see Fig. 4).First converted with chemical transformation to Escherichia coli (E.coli JM110), obtain positive colony Son, extracts plasmid after sequencing, and the method for electricity consumption conversion is converted to bacillus subtilis B.subtilis ATCC6051.
(2) the transformant B.subtilis ATCC6051 (pBEp43-SPexoA-bgaB) and B.subtilis that will be obtained ATCC6051 (pBEp43-SPexoA-proMTG) is incubated in 10mL LB culture mediums (the μ g/mL of kanamycins 20), 37 DEG C, 200rpm activates 12h, and the seed liquor of activation is inoculated in 50mL LB culture mediums into (the μ g/mL of kanamycins 20,1% (w/w) Portugal Grape sugar) inoculum concentration be 1% (volume ratio), 37 DEG C, 200rpm always fermented 48h, every sampling in 6 hours.
(3) measure of β-glucose galactose glycosides enzyme enzyme activity：As a result β-glucose half of signal peptide SPexoA secretions is shown Lactoside expression of enzymes, for enzyme activity in 30~48h expression highest, wherein 36h reaches highest enzyme activity 10.08U/mL.
(4)SDS-PAGE：B.subtilis ATCC6051 (pBEp43-SPexoA-proMTG) have been cultivated to 36h hair Zymotic fluid centrifuging and taking supernatant, supernatant run SDS-PAGE electrophoresis, make with wild-type B. subtilis B.subtilis ATCC6051 For control, protein adhesive figure, which is shown in 44-46KDa, that band and MTG albumen are in the same size, and wild type control is in this magnitude range Interior no band, experimental result illustrate that MTG pepsinogens are expressed (see Fig. 5).Illustrate that SPexoA can be used as useful signal peptide to make For bacillus subtilis.
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification, Equivalent substitute mode is should be, is included within protection scope of the present invention.
Sequence table
<110>South China Science ＆ Engineering University
<120>A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Signal peptide
<400> 1
Met Asn Asn Asn Lys Leu Leu Leu Val Asp Gly Met Ala Leu Leu Phe
1 5 10 15
Arg Ala Phe Phe Ala Thr Ala
20
<210> 2
<211> 69
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>The encoding gene of signal peptide
<400> 2
atgaataata ataaactatt gctggttgac ggcatggctc ttttattccg ggcctttttt 60
gccacggct 69
<210> 3
<211> 51
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ggtaccatgg cgttcagcaa catgtctgcg caggctgcgg ccggtgcaca t 51
<210> 4
<211> 51
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
atggagctcg gatccgaatt caagcttgtc gacctgcagt ctagactcga g 51
<210> 5
<211> 102
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ggtaccatgg cgttcagcaa catgtctgcg caggctgcgg ccggtgcaca tatggagctc 60
ggatccgaat tcaagcttgt cgacctgcag tctagactcg ag 102
<210> 6
<211> 40
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223> F-SpexoA
<400> 6
gagaggaatg tcgacatgaa taataataaa ctattgctgg 40
<210> 7
<211> 40
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223> R-SpexoA
<400> 7
cgttgtccat ctcgagagcc gtggcaaaaa aggcccggaa 40

Claims (10)

1. a kind of bacillus subtilis can improve the signal peptide of secernment efficiency, it is characterised in that：Its amino acid sequence such as SEQ ID Shown in NO.1.
2. the bacillus subtilis described in coding claim 1 can improve the gene of the signal peptide of secernment efficiency, it is characterised in that Its nucleotide sequence is selected from following any sequence：
(a) nucleotide sequence or its complementary series as shown in SEQ ID NO.2；
(b) one or more nucleotides substitutions, missing or addition is carried out to the nucleotide sequence shown in SEQ ID NO.2 to be obtained , have and the nucleotide sequence identical shown in SEQ ID NO.2 is as the nucleotide sequence of signal peptide function or its is mutual Complementary series.
3. the recombination expression that the gene of the signal peptide of secernment efficiency can be improved containing the bacillus subtilis described in claim 2 carries Body, recombination engineering bacteria, transgenic cell line or expression cassette.
A kind of 4. recombination engineering bacteria, it is characterised in that：Bacillus subtilis described in claim 2 can be improved into secretion The Gene Fusion of the signal peptide of efficiency is to the N-terminal for needing expressing gene.
5. recombination engineering bacteria according to claim 4, it is characterised in that：Described recombination engineering bacteria is secretion The genetic engineering bacterium that beta galactosidase ability improves, or be the genetic engineering bacterium that can secrete transglutaminase.
6. the signal peptide that the bacillus subtilis described in claim 1 can improve secernment efficiency is improving destination protein secreting, expressing In application.
7. application according to claim 6, it is characterised in that：Described destination protein is thermostable beta-galactosidase or turned Glutaminase.
8. application according to claim 6, it is characterised in that：Described protein secretion is expressed as in prokaryotic expression system Secreting, expressing.
9. application according to claim 8, it is characterised in that：Described prokaryotic expression system is bacillus subtilis.
10. application according to claim 8, it is characterised in that：Described prokaryotic expression system is bacillus subtilis ATCC6051。
CN201710990142.0A 2017-10-23 2017-10-23 A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency Pending CN107857802A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710990142.0A CN107857802A (en) 2017-10-23 2017-10-23 A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710990142.0A CN107857802A (en) 2017-10-23 2017-10-23 A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency

Publications (1)

Publication Number Publication Date
CN107857802A true CN107857802A (en) 2018-03-30

Family

ID=61697781

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710990142.0A Pending CN107857802A (en) 2017-10-23 2017-10-23 A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency

Country Status (1)

Country Link
CN (1) CN107857802A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102120978A (en) * 2010-12-10 2011-07-13 江南大学 Escherichia coli secreting transglutaminase zymogen and application thereof
US20120135498A1 (en) * 2009-08-03 2012-05-31 C-Lecta Gmbh Method for Producing Nucleases of a Gram Negative Bacterium While Using a Gram Positive Expression Host
CN103709236A (en) * 2013-12-23 2014-04-09 江南大学 Signal peptide capable of improving secretion efficiency, and applications thereof
CN106947766A (en) * 2017-04-12 2017-07-14 华南理工大学 A kind of bacillus subtilis has DNA fragmentation and its application of promoter function

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120135498A1 (en) * 2009-08-03 2012-05-31 C-Lecta Gmbh Method for Producing Nucleases of a Gram Negative Bacterium While Using a Gram Positive Expression Host
CN102120978A (en) * 2010-12-10 2011-07-13 江南大学 Escherichia coli secreting transglutaminase zymogen and application thereof
CN103709236A (en) * 2013-12-23 2014-04-09 江南大学 Signal peptide capable of improving secretion efficiency, and applications thereof
CN106947766A (en) * 2017-04-12 2017-07-14 华南理工大学 A kind of bacillus subtilis has DNA fragmentation and its application of promoter function

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
XIN LIU: "Identification of strong promoters based on the transcriptome of Bacillus licheniformis", 《BIOTECHNOL LETT》 *
祝发明: "枯草芽孢杆菌AmyX基因信号肽性能优化研究", 《西北农林科技大学学报(自然科学版)》 *
罗宁: "转谷氨酰胺酶酶原在枯草芽孢杆菌WB800 中的表达", 《现代食品科技》 *

Similar Documents

Publication Publication Date Title
CN107759675A (en) A kind of signal peptide and its application that secernment efficiency can be improved from bacillus subtilis
CN105601720B (en) A kind of signal peptide effectively improving protein secretion expression efficiency and its application
CN104611317B (en) A kind of method for improving L-ASP secreting, expressing
AU2016260738B2 (en) IrrE protein functional domain for improving anti-oxidation capability of cell and application thereof
CN106497897A (en) A kind of engineered strain construction method for improving Heparinase I activity
CN107674119A (en) A kind of bacillus subtilis can effectively improve signal peptide and its application of secretion
CN104402975B (en) Anti-aging small peptide and preparation method thereof
CN107936096A (en) A kind of signal peptide that can effectively improve protein secretion efficiency and its application
CN107200772A (en) A kind of signal peptide for optimizing keratinase Ker efficient secretory expressions and its application
EP2206788A1 (en) Recombinant microorganism
CN106701813A (en) Expression vector as well as construction method and application thereof
CN104195157A (en) High-efficiency recombination expression and purification method of biological active peptide in prokaryotic cells
CN111808834B (en) Method for efficiently expressing high-temperature resistant alpha-amylase in bacillus subtilis, recombinant promoter and application
CN107698668A (en) A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency
CN107602707A (en) The dcas9 ω fusion proteins of one species specificity regulation bacillus subtilis exogenous gene expression and its application
CN104031913B (en) A kind of expression equipment for being used for the secreting, expressing foreign protein in bacillus subtilis
CN110283797B (en) Tyrosinase, gene, engineering bacterium and preparation method thereof
CN107698667A (en) A kind of bacillus subtilis can be used for signal peptide and its application for improving secernment efficiency
CN105505931B (en) A kind of strong promoter and its application in raising Nattokinase expression
CN107857802A (en) A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency
CN102399796A (en) Bacillus megaterium ALA2 cytochrome P450 enzyme gene and methods of recombinant plasmid construction and enzyme purification
CN107698669A (en) A kind of signal peptide for improving secernment efficiency and its application
CN110004101A (en) Method for constructing optimal Validase TSP Concentrate II loss of expression host for target protein amount body
CN107698666A (en) A kind of signal peptide for effectively improving secretion and its application
CN105018407A (en) Bacillus subtilis of secretory expression proline aminopeptidase and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20180330

RJ01 Rejection of invention patent application after publication