CN111607613A

CN111607613A - Plasmid vector for expressing mRNA of cellular immune vaccine and construction method and application thereof

Info

Publication number: CN111607613A
Application number: CN202010426681.3A
Authority: CN
Inventors: 潘有东; 宋麒; 肖安; 万季; 王奕; 刘刚; 文颖
Original assignee: Shenzhen Neocura Biotechnology Corp
Current assignee: Shenzhen Neocura Biotechnology Corp
Priority date: 2020-05-19
Filing date: 2020-05-19
Publication date: 2020-09-01

Abstract

The invention discloses a plasmid vector for expressing mRNA of a cellular immune vaccine, a construction method and application thereof. The plasmid vector comprises a plasmid vector which can be inserted into the front 5' -end of a cell immune vaccine site (T antigen epitope) peptide fragment gene to be expressed: the 5' -untranslated region of the hemoglobin beta subunit gene (HBB), the human leukocyte antigen histocompatibility complex B gene (HLAB) protein signal peptide sequence; and 3' -end of the rear part of the gene: HLAB protein MITD domain coding sequence, 3' -untranslated region of HBB gene, and poly (da) tail sequence of length 60. The plasmid vector for in vitro expression of mRNA constructed by the invention can directly insert T antigen epitope sites into expression target protein genes, and the expressed mRNA carries poly (A) tail sequences with the length of 60 and can be directly and efficiently translated into T antigen epitopes which can be expressed and positioned on the surfaces of cells in vivo or in vitro cultured cells of mammals.

Description

Plasmid vector for expressing mRNA of cellular immune vaccine and construction method and application thereof

Technical Field

The invention relates to the technical fields of molecular biology technology, cell culture, immunobiology, image analysis and the like. Specifically, the method comprises the steps of replacing original replaceable segments in the existing expression plasmids with key elements required by T7 RNA polymerase binding sites, translation expression and cell surface positioning in a manner of enzyme digestion, connection and the like to construct a plasmid vector pNeoCura-TVac capable of expressing mRNA in cells cultured in vivo or in vitro of mammals; constructing 5 cellular immune vaccine antigen sites (T antigen epitope for short) into gene segments at intervals by using a linker sequence, inserting the gene segments into the vector to form an example plasmid, transforming the example plasmid into a proper escherichia coli strain, culturing, extracting the plasmid, performing enzyme digestion linearization in vitro, and transcribing to obtain example mRNA; and the concentration and purity of this example mRNA were tested to assess the ability of such vectors to express mRNA.

Background

In vaccine site screening and vaccine pharmaceutical technology, nucleic acid vaccines, particularly mRNA vaccines, are among the most recently developed fields of molecular vaccines. The mRNA vaccine has the characteristics of unified physicochemical properties, convenient use of unified scheme flow preparation and large-scale high-throughput screening of effective vaccine antigenic sites, and presents the advantages of being more convenient and efficient than the development flows of the traditional vaccines (inactivated vaccines, attenuated vaccines and subunit vaccines) and other modern molecular vaccines (recombinant protein vaccines and virus vector vaccines). The antigen site of the cellular immune vaccine (T antigen epitope for short) which can activate the specific immune response of human T cells can adopt a strategy of integrating up to 5T antigen epitopes and related linker sequences into an mRNA expression vector and carrying out immune activity detection and screening at one time.

Messenger ribonucleic acid (mRNA) is an important loop for eukaryotic gene expression and is centrally important in the central laws of DNA- (transcription) -mRNA, mRNA- (translation) protein. Mature mRNA consists of a 5 '-cap, a 5' -untranslated region (5 '-UTR), a protein coding sequence (CDS), a 3' -untranslated region (3 '-UTR), and a 3' -poly (A) nucleic acid tail. Among them, 5 '-UTR and 3' -UTR play an important role in the stability of mRNA in vivo or in cultured cell lines, while specific signal peptides and related domains and the like in CDS play a determining role in the subcellular localization of proteins translated from mRNA. T epitopes need to be mapped to the cell surface after translation expression into the corresponding peptide fragments in order to elicit a cellular immune response.

Currently, in the field of molecular biology, there is a lack of suitable academic or commercial plasmid vectors for expressing T epitopes on mammalian cell surfaces.

Disclosure of Invention

Proper in vitro transcription expression vectors are required for screening target sites of mRNA molecular vaccines, including T antigen epitope screening. No such vectors are currently in widespread use. The invention aims to transform an expression vector which can obtain mRNA with in vivo or intracellular stability and translation expression capability into a plasmid vector which can be transcribed and simultaneously added with a cell surface positioning sequence required by a T antigen epitope and can maintain the mRNA stability and translation expression capability, and determine that the corresponding mRNA with high concentration and high purity can be obtained through in vitro transcription.

Specifically, the present invention uses restriction enzymes XbaI and XhoI to remove a replaceable segment of length 30 from pNeoCura-Exp060 vector, and inserts a sequence carrying a cohesive end of XbaI site, a T7 RNA polymerase recognition fragment, a 5 '-untranslated region (5' -UTR) sequence from hemoglobin β subunit (HBB) gene, a signal peptide sequence of human leukocyte antigen histocompatibility Complex B (HLAB) protein, a sequence encoding a linker peptide segment (GGSGG) and in which exactly BamHI site encoding two consecutive amino acids of GS, a removable sequence encoding 3xFLAG-HA tag, a sequence encoding a linker peptide segment (GGSGG) and in which exactly BspEI site encoding two consecutive amino acids of SG, an MITD domain of HLAB protein, a 3 '-untranslated region (3' -UTR) sequence from HBB, an artificially synthesized sequence of cohesive end of XhoI site, constructing the pNeoCura-TVac plasmid vector.

The first aspect of the present invention provides a plasmid vector for expressing mRNA of cellular immune vaccine, which comprises segments of T antigen epitope expression and required element positioning and a poly A segment of poly A-DNA with the length of more than 30.

In some embodiments of the invention, the segment of the T epitope expressing, locating the desired element comprises the XbaI site cohesive end, the T7 RNA polymerase recognition fragment, the 5 '-UTR from the HBB gene, the signal peptide sequence of the HLAB protein, the sequence encoding the linker peptide segment and including a BamHI site, the removable sequence encoding the 3xFLAG-HA tag, the sequence encoding the linker peptide segment and including a BspEI site, the MITD domain coding sequence of the HLAB protein, the 3' -UTR sequence from the HBB, the XhoI site cohesive end.

In some embodiments of the invention, sequences other than the 30-long replaceable segment and the sequence between Xhol and Xbal in the pNeoCura-Exp060 vector are also included.

In some embodiments of the invention, a promoter sequence is also included.

In some embodiments of the invention, the promoter sequence is T7. :

the second aspect of the present invention provides the method for constructing the plasmid vector for expressing mRNA of a cellular immune vaccine according to the first aspect, comprising the following steps:

s01, removing a segment of length 30 in pNeoCura-Exp060 vector using restriction enzymes XbaI and XhoI;

s02, inserting a cohesive end of XbaI site, a T7 RNA polymerase recognition fragment, a 5 '-UTR from HBB gene, a signal peptide sequence of HLAB protein, a sequence coding a linker peptide segment (GGSGG) and including a BamHI site, a removable sequence coding a 3xFLAG-HA tag, a sequence coding a linker peptide segment (GGSGG) and including a BspEI site, an MITD structure domain coding sequence of HLAB protein, a 3' -UTR sequence from HBB, and an artificially synthesized sequence of cohesive end of XhoI site, and constructing pNeoCura-TVac plasmid vector.

In some embodiments of the invention, the method comprises the following steps:

s11, carrying out enzyme digestion on the pNeoCura-Exp060 plasmid and recovering a long fragment;

s12, synthesizing a sequence carrying a specific insert of the pNeoCura-TVac vector;

s13, and connecting into pNeoCura-TVac vector.

In some embodiments of the invention, in S11, the pNeoCura-Exp060 plasmid is mixed with XbaI, XhoI endonuclease, CutSmart Buffer, water in the following proportions:

pNeoCura-Exp060 100ng

XbaI 0.5μL

XhoI 0.5μL

CutSmart Buffer 1μL

supplementing water to 10 μ L

The mixture was left at 37 ℃ for 4 hours, followed by electrophoretic separation on a 1.5% agarose gel, and fragments of about 4000bp in length were recovered using a DNA gel recovery kit and dissolved in 20. mu.L of Tris-HCl buffer.

In some embodiments of the invention, in S12, sequence 1 or sequence 1 recovered from a blank vector comprising sequence 1, and T4 ligase, T4 Buffer in the T4 ligase kit are mixed in the following ratio:

pNeoCura-Exp060 digestion to recover 0.5. mu.L of long fragment

TVac fragment 8. mu.L

T4 ligase 0.5. mu.L

T4 Buffer 1μL

The mixture was left at 16 ℃ for 1 hour; the sequence 1 is:

5’-TCTAGATAATACGACTCACTATAGGGACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCTCTCGGCGGCCCTGGCCCTGACCGAGACCTGGGCCGGTGGATCCGGGGGCGATTACAAGGATCACGATGGTGATTACAAGGATCACGATATAGACTATAAAGACGATGATGACAAAGGGGGTTACCCGTATGACGTACCCGACTATGCTGGGGGCTCCGGAGGTATCGTGGGCATTGTTGCTGGCCTGGCTGTCCTAGCAGTTGTGGTCATCGGAGCTGTGGTCGCTGCTGTGATGTGTAGGAGGAAGAGTTCAGGTGGAAAAGGAGGGAGCTACTCTCAGGCTGCGTGCAGCGACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCTCGAG-3’。

the third aspect of the present invention provides the use of the plasmid vector for expressing cellular immune vaccine mRNA of the first aspect in the in vitro expression of cellular immune vaccine antigenic site mRNA.

The invention has the beneficial effects that:

the plasmid vector for in vitro mRNA expression constructed by the invention comprises an expression vector which comprises a plurality of T antigen epitopes and related element sequences which are expressed in mammalian in vivo or in vitro culture cells and are related to cell location, and the tail part of the expression vector is provided with 60 poly (A), and the expressed mRNA directly has all elements and poly (A) and can be used for cell transfection and the like.

The plasmid vector for in vitro expression of mRNA constructed by the invention can directly insert T antigen epitope sites into expression target protein genes, and the expressed mRNA carries poly (A) tail sequences with the length of 60 and can be directly and efficiently translated into T antigen epitopes which can be expressed and positioned on the surfaces of cells in vivo or in vitro cultured cells of mammals.

Drawings

FIG. 1 is a process of ligation into pNeoCura-TVac vector using pNeoCura-Exp060 plasmid and TVac fragment;

FIG. 2 is a process of ligating a pNeoCura-BVac-neoAg1 plasmid using a pNeoCura-TVac vector plasmid and a T-epitope fragment;

FIG. 3 shows spectrophotometric measurements of mRNA obtained by in vitro transcription of pNeoCura-BVac-neoAg1 plasmid.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Example 1

(I) constructing in vitro transcription expression vector pNeoCura-TVac

In order to overcome the defects that a carrier for in vitro transcription of mRNA (messenger ribonucleic acid) of a cellular immune vaccine antigen site (T antigen epitope for short) positioned on the surface of a high-stability and high-translation expression cell in a cultured cell in vivo or in vitro of a mammal is lacked in the market, and the large-scale development of T antigen epitope immune reaction and vaccine screening and research and development work is difficult to carry out, the invention adopts the mode that a replaceable segment in a pNeoCura-Exp060 carrier is replaced by a specific segment for protecting auxiliary T antigen expression and subcellular positioning. In particular, the vector can incorporate up to 5T epitopes separated by linker peptide segments (GGSGGGGSGG), flanked by identical linker peptide segments separating the insert from the rest of the coding sequence. By introducing a part of the flanking linker peptide fragments into pNeoCura-TVac in advance and designing two specific restriction enzyme sites therein respectively, the subsequent ligation insertion of coding sequences of up to 5T epitopes can be facilitated.

(II) construction of in vitro transcription expression exemplary plasmid pNeoCura-TVac-neoAg1

The present invention uses BamHI and BspEI restriction enzymes to remove a 150bp long fragment from pNeoCura-TVac, followed by ligation insertion of exactly BamHI sites with a sequence encoding a linker peptide segment (GSGGGGSGG) and encoding two consecutive amino acids at the front GS, 5 specific T epitope coding sequences of 75bp in length, each of which is separated from each other by 4 sequences encoding a linker peptide segment (GGSGGGGSGG), a sequence encoding a linker peptide segment (GGSGGGGSG) and exactly BspEI sites encoding two consecutive amino acids at the rear SG, constructed as an exemplary plasmid for in vitro transcriptional expression of pNeoCura-TVac-neoAg 1.

The method comprises the steps of fully cloning pNeoCura-TVac-neoAg1 plasmid in Escherichia coli, extracting and purifying the plasmid, linearizing the plasmid by using MluI restriction endonuclease, transcribing the plasmid in vitro into mRNA carrying 5T antigen epitope coding sequences and a 3' -poly (A) tail part with the length of 60 by using a T7 Ultra in vitro transcription kit, and measuring the concentration and the purity of the mRNA by using a spectrophotometer.

(I) Primary reagents and instruments

The invention relates toReagent	Suppliers of goods
		XbaI restriction enzyme	New England Biolabs
XhoI restriction enzyme	New England Biolabs
		BamHI restriction enzyme	New England Biolabs
BspEI restriction enzyme	New England Biolabs
		MluI-HF restriction enzyme	New England Biolabs
CutSmart restriction endonuclease buffer	New England Biolabs
		NEB 3.1 restriction Endonuclease buffer	New England Biolabs
Agarose (agarose)	New England Biolabs
		Tris-HCl buffer (pH 8.0)	New England Biolabs
DNA gel recovery kit	Qiagen
		DNA plasmid extraction kit	Qiagen
T4 DNA ligation kit	New England Biolabs
		top10 E.coli chemical competent cell kit	New England Biolabs
Prefabricated powder of LB liquid culture medium	Thermo Fisher Scientific
		Pre-prepared powder of LB-agar solid culture medium	Thermo Fisher Scientific
mMessager mMachine T7 Ultra in vitro transcription kit	Thermo Fisher Scientific
		RNA recovery purification kit	Qiagen

The invention relates to the main instrument	Suppliers of goods
		Gel electrophoresis apparatus	New England Biolabs
16 ℃ incubator	New England Biolabs
		37 ℃ cell culture box	New England Biolabs
-20 ℃ refrigerator	Midicinal Mitsubishi
		Refrigerator at 4 DEG C	Midicinal Mitsubishi

(II) Experimental method

1. Construction of in vitro transcription expression vector pNeoCura-TVac

1.1 cleavage of pNeoCura-Exp060 plasmid and recovery of the long fragment

pNeoCura-Exp060 plasmid was mixed with XbaI, XhoI endonuclease, CutSmart Buffer, and water in the following proportions:

pNeoCura-Exp060 100ng

XbaI 0.5μL

XhoI 0.5μL

CutSmart Buffer 1μL

supplementing water to 10 μ L

The mixture was left at 37 ℃ for 4 hours. The subsequent electrophoretic separation was performed on a 1.5% agarose gel, and fragments of about 4000bp in length were recovered using a DNA gel recovery kit and dissolved in 20. mu.L of Tris-HCl buffer.

1.2 Synthesis of a sequence carrying a specific insert of pNeoCura-TVac vector (hereinafter referred to as "TVac fragment")

A714 bp DNA fragment (SEQ ID NO: 1) was synthesized by a third party supplier and ligated into a blank vector supplied by the supplier. This fragment carries the XbaI site, the T7 promoter recognition sequence, the HBB gene 5 '-UTR, the HLAB protein signal peptide coding sequence, the linker coding sequence containing the BamHI site coding for GGSGG (the coding sequence of two consecutive amino acids GS is exactly the BamHI site), a removable replacement 3xFLAG-HA tag coding sequence, the HLAB gene MITD domain coding sequence, the partial linker coding sequence of GGSGG containing the BspEI site (the coding sequence of two consecutive amino acids SG is exactly the BspEI site), the HBB gene 3' -UTR, the XhoI site.

Sequence 1:

714bp DNA was recovered after treatment with SacI-HF, EcoRI-HF endonuclease using a sequence from the supplier in a manner similar to that in step 1.1 and dissolved in 20. mu.L Tris-HCl buffer.

1.3 ligation into pNeoCura-TVac vector, amplification and validation

The above fragments were mixed with T4 ligase and T4 Buffer in T4 ligase kit according to the following ratio:

pNeoCura-Exp060 digestion to recover 0.5. mu.L of long fragment

TVac fragment 8. mu.L

T4 ligase 0.5. mu.L

T4 Buffer 1μL

The mixture was left at 16 ℃ for 1 hour. The ligated plasmid was subsequently transformed into TOP10 E.coli competent cells according to third party supplier standard instructions. The appropriate transformed cells were spread on LB solid medium plates and cultured at 37 ℃ for 14-16 hours.

8 single colonies were picked and placed in 5mL LB liquid medium and cultured at 37 ℃ for 14-16 hours. Then, the plasmids are respectively extracted by using a DNA plasmid extraction kit, sent to a third-party sequencing company for sequencing by using SP6 primers, and the plasmids with correct sequences are selected for storage. Thus obtaining the pNeoCura-TVac vector (see figure 1).

2. Application example of the vector pNeoCura-TVac: in vitro transcription expression exemplary plasmid pNeoCura-TVac-neoAg1 was constructed and tested

2.1 digestion of pNeoCura-TVac plasmid and recovery of the Long fragment

pNeoCura-TVac plasmid was mixed with BamHI, BspEI endonuclease, NEB 3.1Buffer, water in the following proportions:

pNeoCura-TVac 100ng

BamHI 0.5μL

BspEI 0.5μL

NEB 3.1Buffer 1μL

supplementing water to 10 μ L

2.2 Synthesis of a coding fragment carrying a T epitope (referred to as "T epitope fragment")

A DNA fragment of 519bp in length was synthesized by a third party supplier and ligated into a blank vector supplied by the supplier. The fragment carries the coding sequence of the first two continuous amino acids GS of the GSGGGGSG partial joint coding sequence containing BamHI sites, namely the BamHI sites), 5T cell epitope coding sequences with the length of 25aa/75bp and is separated from each other by the GGSGGGGSG joint coding sequence, and the coding sequence of the GGSGGGGSG partial joint containing BspEI sites (the coding sequence of the last two continuous amino acids SG is namely the BspEI sites) (sequence 2).

Sequence 2:

5’-GGATCCGGGGGTGGTGGATCTGGAGGTCGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAAGTTCAAGAACTTTACTCTCCAATTTTTCTTGGAGGTAGTGGTGGAGGTGGAAGTGGAGGTCAAGAACTTTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACACTCAAAAGAGGAGGTAGTGGTGGAGGTGGAAGTGGAGGTACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGAGGTAGTGGTGGAGGTGGAAGTGGAGGTAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACACGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTGGTGGATCAGGTGGAGGAGGTTCCGGA-3’。

the sequence from the supplier was treated with BamHI and BspEI endonucleases in a similar manner to step 2.1, and then the 519bp long DNA was recovered and dissolved in 20. mu.L Tris-HCl buffer.

2.3 ligation into pNeoCura-TVac-neoAg1 plasmid, amplification and validation

pNeoCura-TVac enzyme digestion recovery long fragment 0.5 u L

T epitope fragment 8 uL

T4 ligase 0.5. mu.L

T4 Buffer 1μL

8 single colonies were picked and placed in 5mL LB liquid medium and cultured at 37 ℃ for 14-16 hours. Then, the plasmids are respectively extracted by using a DNA plasmid extraction kit, sent to a third-party sequencing company for sequencing by using SP6 primers, and the plasmids with correct sequences are selected for storage. Thus, pNeoCura-TVac-neoAg1 plasmid was obtained (see FIG. 2).

2.4 in vitro transcription Synthesis of mRNA encoding T epitope and Pre-and post-related sequence genes

Mixing pNeoCura-TVac-neoAg1 plasmid, MluI-HF restriction enzyme and CutSmart Buffer solution according to the following proportion:

pNeoCura-TVac-neoAg1 500ng

MluI-HF 0.5μL

CutSmart Buffer 1μL

supplementing water to 10 μ L

The mixture was left at 37 ℃ for 4 hours. Subsequently, the DNA was recovered by purification using a DNA gel recovery kit, and dissolved in 20. mu.L of Tris-HCl buffer. Thus obtaining the pNeoCura-TVac-neoAg1 plasmid linearized product.

The linearized product of the pNeoCura-TVac-neoAg1 plasmid was transcribed and purified in vitro into T epitope and related sequence genes, and carried with poly (A) tail mRNA of length 60, using the mMessager mMachine T7 Ultra in vitro transcription kit, according to the standard procedures of the third party's instructions. mRNA was purified according to kit instructions. And mRNA concentration and purity were measured using a NanoDrop spectrophotometer.

(III) results of the experiment

In vitro transcription of pNeoCura-TVac-neoAg1 after linearization resulted in higher concentrations and purities of mRNA (FIG. 3).

While the preferred embodiments and examples of the present invention have been described in detail, the present invention is not limited to the embodiments and examples, and various changes can be made without departing from the spirit of the present invention within the knowledge of those skilled in the art.

Sequence listing

<110> Shenzhen Xinhe biomedical science and technology Limited

<120> plasmid vector for expressing mRNA of cellular immune vaccine, and construction method and application thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>714

<212>DNA

<213> Artificial sequence ()

<400>1

tctagataat acgactcact atagggacat ttgcttctga cacaactgtg ttcactagca 60

acctcaaaca gacaccatgc tggtcatggc gccccgaacc gtcctcctgc tgctctcggc 120

ggccctggcc ctgaccgaga cctgggccgg tggatccggg ggcgattaca aggatcacga 180

tggtgattac aaggatcacg atatagacta taaagacgat gatgacaaag ggggttaccc 240

gtatgacgta cccgactatg ctgggggctc cggaggtatc gtgggcattg ttgctggcct 300

ggctgtccta gcagttgtgg tcatcggagc tgtggtcgct gctgtgatgt gtaggaggaa 360

gagttcaggt ggaaaaggag ggagctactc tcaggctgcg tgcagcgaca gtgcccaggg 420

ctctgatgtg tctctcacag cttaagctcg ctttcttgct gtccaatttc tattaaaggt 480

tcctttgttc cctaagtcca actactaaac tgggggatat tatgaagggc cttgagcatc 540

tggattctgc ctaataaaaa acatttattt tcattgcgct cgctttcttg ctgtccaatt 600

tctattaaag gttcctttgt tccctaagtc caactactaa actgggggat attatgaagg 660

gccttgagca tctggattct gcctaataaa aaacatttat tttcattgct cgag 714

<210>2

<211>519

<212>DNA

<213> Artificial sequence ()

<400>2

ggatccgggggtggtggatc tggaggtcgt gccagatcag tttcacctaa actgttcatc 60

agacaagagg aagttcaaga actttactct ccaatttttc ttggaggtag tggtggaggt 120

ggaagtggag gtcaagaact ttactctcca atttttctta ttgttgcggc aatagtgttt 180

ataacacttt gcttcacact caaaagagga ggtagtggtg gaggtggaag tggaggtact 240

gattacaaac attggccgca aattgcacaa tttgccccca gcgcttcagc gttcttcgga 300

atgtcgcgca ttggaggtag tggtggaggt ggaagtggag gtagcgcttc agcgttcttc 360

ggaatgtcgc gcattggcat ggaagtcaca ccttcgggaa cgtggttgac ctacacacgt 420

gaaggtgtct ttgtttcaaa tggcacacac tggtttgtaa cacaaaggaa tttttatgaa 480

ccacaaatca ttggtggatc aggtggagga ggttccgga 519

Claims

1. A plasmid vector for expressing mRNA of cellular immune vaccine comprises a segment for expressing T antigen epitope and positioning required elements and a poly A segment with length more than 30.

2. The vector of claim 1, wherein the segment for expression of the T epitope and localization of the desired element comprises the cohesive end of the XbaI site, the T7 RNA polymerase recognition fragment, the 5 '-UTR from the HBB gene, the signal peptide sequence of the HLAB protein, the sequence encoding the linker peptide segment and comprising a BamHI site, the removable sequence encoding the 3xFLAG-HA tag, the sequence encoding the linker peptide segment and comprising a BspEI site, the MITD domain coding sequence of the HLAB protein, the 3' -UTR sequence from the HBB, the cohesive end of the XhoI site.

3. The vector of claim 1 or 2, wherein the poly A segment of the polyadenylic deoxynucleic acid is 60 in length.

4. The vector of any one of claims 1 to 3, further comprising sequences in the pNeoCura-Exp060 vector other than the alternative segment of length 30 and the sequence between Xhol and Xbal.

5. The vector of any one of claims 1-4, further comprising a promoter sequence.

6. The vector of any one of claims 1-5, wherein said promoter sequence is T7.

7. A method for constructing the plasmid vector for expressing mRNA of a cellular immune vaccine according to any one of claims 1 to 6, comprising the steps of:

8. The method of claim 7, comprising the steps of:

s13, and connecting into pNeoCura-TVac vector.

9. The method according to claim 7 or 8, wherein in S11, pNeoCura-Exp060 plasmid is mixed with XbaI, XhoI endonuclease, CutSmart Buffer and water in the following proportions:

pNeoCura-Exp060 100ng

XbaI 0.5μL

XhoI 0.5μL

CutSmart Buffer 1μL

supplementing water to 10 μ L

The mixture was left at 37 ℃ for 4 hours, followed by electrophoretic separation on 1.5% agarose gel, and fragments of about 4000bp in length were recovered using a DNA gel recovery kit and dissolved in 20. mu.L of Tris-HCl buffer;

and/or, in S12, mixing the sequence 1 or the sequence 1 recovered from the blank vector containing the sequence 1, and the T4 ligase and the T4 Buffer solution in the T4 ligase kit according to the following proportion:

pNeoCura-Exp060 digestion to recover 0.5. mu.L of long fragment

TVac fragment 8. mu.L

T4 ligase 0.5. mu.L

T4 Buffer 1μL

The mixture was left at 16 ℃ for 1 hour;

the sequence 1 is:

10. use of a vector according to any one of claims 1 to 6 for the in vitro expression of cellular immune vaccine antigenic site mRNA.