CN106834293B - Circular RNA with molecular marker and preparation method and application thereof - Google Patents

Abstract

The present invention relates to a method for preparing circular RNA with molecular markers, which comprises the following steps: s1: adding a DNA construct expressing the linear form of the RNA of the circular RNA into an in vitro transcription system, and transcribing to obtain linear RNA with a molecular marker and a monophosphoric group at the 5' end; s2: adding the linear RNA into a connection system, and enabling the 5 'end and the 3' end of the linear RNA to form a 3', 5' -phosphodiester bond, thereby obtaining the cyclic molecule. The invention also relates to the use of said circular RNA for obtaining a protein that interacts with said circular RNA in a cell and to a method for obtaining said protein. The circular RNA prepared by using the method of the present invention has a very high structural similarity with the circular RNA formed from the original sequence, and the binding efficiency with the protein is not substantially different from that of the circular RNA formed from the original sequence, and thus, the method is a powerful tool for studying proteins interacting with the circular RNA.

Description

Circular RNA with molecular marker and preparation method and application thereof

Technical Field

The present invention relates to the field of circular RNA, and more particularly, to a method for preparing circular RNA with a molecular marker, circular RNA with a molecular marker prepared by the method, use of the circular RNA in obtaining a protein interacting with the circular RNA in a cell, and a method for obtaining the protein.

Background

Circular RNAs (circular RNAs) are non-coding RNAs which are widely present in various biological cells and have the function of regulating gene expression, and have the characteristics of stable structure, tissue specific expression and the like. In recent years, with the widespread use of high-throughput sequencing technologies, researchers have found that cyclic RNAs have conserved features. Therefore, this class of ancient molecules has received great attention.

In 2012, the Salzman team discovered hundreds of circular RNAs that were closely related to human gene expression; in 2013, the Jeck team detected about 2.5 million circular RNAs in human fibroblasts. There are a number of sequential literature reports on the study of circular RNA molecules, of which the Salmena team of the Harvard medical institute proposed a well-known "cerRNA molecule regulation hypothesis". The hypothesis suggests that the biological function of the cerRNA is completed by a MicroRNA Response Element (MRE), and the circular RNA molecule can be used as a molecular sponge to adsorb a large amount of microRNA, thereby influencing the transcriptional regulation of genes.

Almost all molecules within a cell do not function individually and require binding to the corresponding DNA, RNA or protein to function properly. In recent years, the interaction between the cyclic RNA molecule and the microRNA is more and more researched and matured, but the interaction between the cyclic RNA and the protein is only studied a few times. The reason for this is mainly that a molecular biological method for obtaining a large amount of circular RNA with a molecular marker is still lacking. In the prior art, proteins that interact with circular RNA are often studied either directly using linear molecules or by forming circular molecules by ligating both ends. However, such molecules differ greatly in structure from circular RNA, and therefore the reliability of the results obtained is very low. Some researchers have also disclosed some methods for synthesizing circular RNA, however, their methods often require complicated chemical processing steps, thereby reducing the reliability of synthesis and driving up labor and reagent costs.

Therefore, in order to understand the biological function of the circular RNA molecule deeply, a simple and inexpensive molecular biological method is required for synthesizing the circular RNA with molecular markers.

Disclosure of Invention

To solve the above problems, the present invention provides a method for preparing circular RNA with a molecular marker, comprising the steps of:

s1: adding a DNA construct expressing the linear form of the RNA of the circular RNA into an in vitro transcription system, and transcribing to obtain linear RNA with a molecular marker and a monophosphoric group at the 5' end;

s2: adding the linear RNA into a connection system, and enabling the 5 'end and the 3' end of the linear RNA to form a 3', 5' -phosphodiester bond, thereby obtaining the cyclic molecule.

Preferably, the in vitro transcription system comprises the monophosphate form of the first ribonucleoside at the 5' end of the linear RNA, and the triphosphate forms of all four ribonucleosides, and one or more of the triphosphate forms of the four ribonucleosides are labeled with a molecular marker, the concentration of the ribonucleoside monophosphate being higher than the concentration of its corresponding ribonucleoside triphosphate.

Preferably, the concentration of the ribonucleoside monophosphate is 5-15 times the concentration of its corresponding ribonucleoside triphosphate.

Preferably, the molecular marker is biotin.

Preferably, the ligation system comprises an RNA ligase and a single-stranded guide DNA, wherein the 5 'end of the guide DNA is complementary to the 5' end of the linear RNA, the 3 'end of the guide DNA is complementary to the 3' end of the linear RNA, the two ends of the guide DNA are respectively combined with the 5 'end and the 3' end of the linear RNA, and the 5 'end and the 3' end of the linear RNA are respectively free from 0-10 bases.

Preferably, the 5 'end and the 3' end of the guide DNA are respectively and independently 8-15nt long, and no spacer sequence or a spacer sequence with less than or equal to 5nt exists between the 3 'end and the 5' end of the guide DNA.

The invention also provides the circular RNA prepared by the method.

The invention also provides the application of the circular RNA in obtaining the protein interacting with the circular RNA in the cell.

The present invention also provides a method for obtaining a protein that interacts with a circular RNA in a cell, comprising the steps of:

s3: taking the circular RNA as a probe, and incubating the circular RNA and cell lysate together, wherein the circular RNA and protein interacted with the circular RNA form a circular RNA-protein complex;

s4: capturing the circular RNA-protein complex by the molecular marker;

s5: separating the protein from the captured circular RNA-protein complex.

Preferably, the molecular marker is biotin and the circular RNA-protein complex is captured by magnetic beads.

The sequence of the circular RNA prepared by using the method of the present invention has only a few extra bases at the 5' end of the original sequence, and the formed circular RNA has extremely high structural similarity with the circular RNA formed by the original sequence, and the binding efficiency with protein is not substantially different from that of the circular RNA formed by the original sequence. The prepared circular RNA also has molecular markers, so the prepared circular RNA is a powerful tool for researching proteins interacting with the circular RNA.

Drawings

FIG. 1 is a flow chart of the study of circular RNAs and proteins interacting therewith;

FIG. 2 is a schematic diagram showing the binding of guide DNA to linear RNA;

FIG. 3 is an electrophoresis diagram of RNA electrophoresed in 3% denaturing agarose gel after digestion with RNase R;

FIG. 4 is an electrophoresis diagram of a DNA product electrophoresed in 1.5% agarose gel after reverse transcription PCR of the RNase R-treated circular RNA probe;

FIG. 5 is a photograph showing the staining of a circular RNA probe by a Coomassie blue staining after eluting proteins and then electrophoresing the proteins in a 12% denaturing polyacrylamide gel.

Detailed Description

The principles and features of this invention are described below in conjunction with examples, which are set forth to illustrate, but are not to be construed to limit the scope of the invention.

The present invention further describes the content of the present invention by taking circular RNA molecule hsa _ circ _0123777 as an example, and the flow chart is shown in FIG. 1.

1. Construction of hsa _ circ _0123777 expression vector

The coding sequence of the circular RNA molecule hsa _ circuit _0123777 (SEQ ID NO: 1) was found in the circular interventionme website (http:// circular intervention. nia. nih. gov). And amplifying the linear sequence of the circular RNA molecule by using human genome DNA as a template. In order to ensure the successful construction of the vector, when designing the primer, a corresponding restriction enzyme cutting site is added at the 5' end of the primer. In this example, HindIII (CCCAAGCTT) cleavage sites were added to the front primers and BamH I (CGCGGATCC) cleavage sites were added to the rear primers. After successful amplification, the DNA was identified and recovered by 1.5% normal agarose gel electrophoresis (DNA gel recovery kit purchased from Tiangen Biochemical technology Co., Ltd., product number DP 209), and the DNA product was stored at-20 ℃. If the linear DNA sequence of the circular RNA molecule cannot be successfully amplified, the corresponding organism company can be found for synthesis.

The linear sequence of the circular RNA is connected to a eukaryotic expression vector which can be used for in vitro transcription, and the specific method is as follows: the eukaryotic cloning vector selected is pcDNA3.1(+) -myc-His C (eukaryotic vectors which can be transcribed in vitro all meet the conditions). The above DNA product and the empty pcDNA3.1(+) -myc-His C vector were double digested with the endonucleases Hind III and BamH HI (purchased from TAKARA, Hind III cat # 1060, BamH I cat # 1010), respectively, as follows:

DNA product digestion system, total volume 30. mu.l: 10 XQuickcut Green buffer 3. mu.l, Hind III 1.5. mu.l, BamH I1.5. mu.l, DNA product 2. mu.g, remainder ddH₂O；

pcDNA3.1(+) -myc-His C empty vector double enzyme digestion system, the total volume is 20 mul: 10 XQuickcut Greenbuffer 2. mu.l, Bam HI 1. mu.l, Hind III1. mu.l, pcDNA3.1(+) no-load 1. mu.g, the remainder being ddH₂O；

After mixing well, the mixture was reacted at 37 ℃ for 1.5 hours, and then identified and recovered by 1.5% normal agarose gel electrophoresis (DNA gel recovery kit from Tiangen Biochemical technology Co., Ltd., product No. DP 209), and the concentration of the sample was measured after the recovery was completed.

The double-restriction DNA product is connected to pcDNA3.1(+) -myc-His C cloning vector. The 10 mul system contains 5 mul DNA ligase (the DNA ligase kit is purchased from TAKARA company, the commodity number is 6022), the total amount of the DNA double enzyme digestion product and the pcDNA3.1(+) -myc-His C double enzyme digestion cloning vector is 5 mul, the mol ratio of the DNA product to the cloning vector is 10:1, the connection is carried out for 1 hour at the temperature of 16 ℃, and the DNA ligase kit is placed on ice for standby after the connection reaction is finished;

taking out an escherichia coli competent cell DH5 α from-80 ℃, unfreezing the escherichia coli competent cell DH5 α on ice for 2-3 minutes, adding the connected recombinant plasmid, gently mixing the plasmids uniformly, incubating on ice for 20 minutes, thermally shocking at 42 ℃ for 60 seconds, rapidly placing the mixture on ice for standing for 2 minutes, adding 450 mu l of sterile LB liquid culture medium without antibiotics, placing the mixture in a constant temperature shaking table for resuscitation for 1 hour under the resuscitation condition of 37 ℃ and 200 revolutions per minute, taking 100 mu l of resuscitated bacterial liquid, uniformly coating the resuscitated bacterial liquid in an LB solid selective culture medium with the diameter of 3.5 cm and containing ampicillin resistance, absorbing the culture medium for 10 minutes, placing the culture medium in a constant temperature incubator at 37 ℃ upside down for overnight, picking out a single colony to 5ml of LB liquid culture medium containing ampicillin the next day, carrying out 200 revolutions per minute at 37 ℃, breeding the bacteria for 12 hours, extracting the plasmid, and identifying the plasmid by 1.5 percent common gel electrophoresis;

the extracted plasmid is subjected to double enzyme digestion identification by using endonucleases Hind III and BamH I (purchased from TAKARA, Hind III with the product number of 1060 and BamH I with the product number of 1010), the positive group is sent to Wuhan engine biotechnology limited company for sequencing, the DNA fragment is confirmed to be integrated on pcDNA3.1(+) -myc-His C vector, and the recombinant plasmid is successfully constructed.

2. In vitro transcription

And (3) carrying out in-vitro transcription on the recombinant plasmid successfully constructed by the in-vitro transcription, and additionally adding Guanosine Monophosphate (GMP) and Biotin-labeled uracil (Biotin-16-UTP) into an in-vitro transcription system to synthesize a large amount of linear RNA which is labeled by Biotin and has a monophosphate group at the 5' end. The specific method comprises the following steps:

and (3) plasmid linearization: the downstream 3' end of the T7 promoter of the pcDNA3.1(+) -myc-His C recombinant plasmid was subjected to a single cleavage with the endonuclease BamH I. 20 μ l digestion system: 10 XQuickcut Green buffer 3. mu.l, BamH I1.5. mu.l, pcDNA3.1(+) recombinant plasmid 7. mu.g, the remainder being ddH₂O；

The plasmid linearized system was reacted at 37 ℃ for 2 hours to ensure sufficient cleavage. Identifying and recovering linear plasmid by using 1.5% common agarose gel electrophoresis (a DNA gel recovery kit is purchased from Tiangen Biochemical technology Co., Ltd., the product number is DP 209), and detecting the concentration of a plasmid recovery product after linearization treatment;

dephosphorylation of linearized plasmids: after the plasmid is linearized by using the enzyme BamH I, the viscous end groups of the plasmid are respectively monophosphate and hydroxyl, and the linearized plasmid can be connected into a complete plasmid after the phosphate group and the hydroxyl are combined into a phosphodiester bond. When the cohesive end monophosphate group is removed, the phosphate group is changed into hydroxyl, so that a phosphodiester bond cannot be formed, and the complete plasmid cannot be connected. To prevent plasmid self-ligation following BamH I linearization, dephosphorylation was performed using calf alkaline phosphatase CIAP (CIAP from TAKARA, cat. No. 2250A) in a 50. mu.l dephosphorylation system as follows: 10 Xbuffer 5. mu.l, CIAP 3. mu.l, linearized plasmid 30. mu.l, remainder ddH₂O；

After mixing well, the reaction was carried out at 37 ℃ for 1 hour. After the reaction is finished, 1.5 percent of common agarose gel electrophoresis is used for identification and recovery (a DNA gel recovery kit is purchased from Tiangen Biochemical technology Co., Ltd., the product number is DP 209), and the DNA gel is stored at the temperature of 20 ℃ below zero for later use after the concentration is measured;

the in vitro transcription raw material comprises Biotin-16-UTP, so that the in vitro transcription product is marked by the Biotin;

the 5' end of the exogenous linear RNA synthesized in vitro is of a triphosphate structure, and the 3' end is of a hydroxyl structure, so that the 5' end of the exogenous linear RNA cannot be connected with the 3' end to form a ring, and the 5' end is guaranteed to be of a monophosphate structure, so that the head and the tail of the exogenous linear RNA can be connected to form a ring structure. In this example, the transcription initiation site of the expression vector is G, so the in vitro transcription material also includes a large amount of GMP, GTP =5-15:1 (10: 1 in this example) (GMP is purchased from Beijing Solibao technologies, Inc., having a product number of G8850), so that the in vitro transcription RNA includes a large amount of linear RNA labeled by biotin and having a monophosphate group at the 5' end, thereby ensuring the smooth progress of cyclization;

prepared from Biotin RNA labelled mix (Biotin-16-UTP available from ROCHE under the reference 11388908910): ATP/CTP/GTP/UTP was 100mM, Biotin-16-UTP was 10 mM, and the mixture was stored at-20 ℃. The concentration of NTP is 10 mM, and the final working concentration of NTP during in vitro transcription is 1 mM;

the RNA polymerase used for in vitro transcription was T7 RNA polymerase (T7 RNA polymerase was purchased from Biyun, cat # D7069), and a 30. mu.l in vitro transcription system was prepared as follows: 5 × transfection Buffer 6 μ l, Biotin RNA labelled mix 3 μ l, GMP (100 mM) 3 μ l, T7 RNA polymerase 3 μ l, RNase inhibitor 1 μ l, linearized plasmid 1 μ g, and the remainder ddH₂O；

After mixing well, the reaction was carried out at 37 ℃ for 4 hours. After the reaction, the sample was identified by 2% normal agarose gel electrophoresis, and the size of the sample was determined to be correct, and then recovered by using an RNA recovery kit (the RNA recovery kit was purchased from Zymo Research, Inc., and has a product number of R1011), and the sample was stored at-80 ℃. Thus, a large amount of linear RNA marked by biotin is prepared, the coding sequence of the linear RNA is shown as SEQ ID NO. 3, a small section of vector sequence and an added enzyme cutting site sequence are respectively added at two ends of the coding sequence of the circular RNA, and the added sequences are very short and have NO influence on the structure of the circular RNA.

3. Connecting to form a ring: connecting the 5 'end and the 3' end of the RNA to form 3,5 phosphodiester bonds, and synthesizing the exogenous circular RNA probe with the biotin label, wherein the specific implementation method is as follows:

design of guide DNA: to promote circularization efficiency, single stranded guide DNA was now designed. The single-stranded guide DNA may have 8 to 15 bases at the 5 'end and the 3' end, respectively, which are complementary-paired with the bases at the 5 'end and the 3' end of the RNA, respectively, and a gap spline (gap spline) added in the middle thereof, which is not bound to the RNA, or may not exist. In this example, the guideDNA sequence is shown in SEQ ID NO 2. A model in which 0 to 10 bases are released at the 5 '-end and 3' -end of the RNA after the head and tail of the RNA are bound to the guide DNA to form single-stranded connections, as shown in FIG. 2;

t4 RNA Ligase I (purchased from Biyun, with the code of D7021) is used for catalyzing the formation of phosphodiester bonds between 5 'terminal phosphate groups and 3' terminal hydroxyl groups in single-stranded RNA molecules, and after the head-to-tail connection is successful, a circular RNA molecule is formed, 30 mul of an in vitro cyclization system is 10 × Reaction Buffer 3 mul, T4 RNA Ligase I2 mul, ATP 2 mul, BSA 2 mul, RNase inhibitor 1 mul, linear RNA 2 mul, guide DNA (100 mM) 3 mul, and the rest is ddH₂O；

After the mixture is fully mixed, the reaction is carried out for 4 hours at 37 ℃, after the reaction is finished, the cyclization condition is identified by 3 percent common agarose gel electrophoresis, and the electrophoresis speed of the cyclized RNA molecule is slower than that of the linear RNA molecule. The remaining product was recovered by RNA purification (RNA recovery kit from Zymo Research, cat # R1011) and stored at-80 ℃.

4. Digestion of linear RNA: cutting off the linear RNA without successful cyclization by using RNase R to obtain a purified exogenous circular RNA probe, wherein the specific embodiment is as follows:

RNase R (purchased from epicentre, Inc. under the trade designation RNR 07250) digests to remove linear RNA interference. The specific digestion system is as follows: after the reaction is finished, the cyclization condition is identified by 3% common agarose gel electrophoresis, and the electrophoresis speed of the cyclization RNA molecule is slower than that of the linear RNA molecule. The remaining product was recovered by RNA purification (RNA recovery kit purchased from Zymo Research, cat # R1011) and stored at-80 ℃;

10 μ l of the digestion system was: 10 Xbuffer 1. mu.l, RNase R1U, RNA 0.5. mu.g, remaining ddH₂O；

After fully mixing, reacting for 10 minutes at 37 ℃, then processing for 5 seconds at 85 ℃ to inactivate the RNase, and after the RNase R digestion is finished, identifying the cyclization efficiency by 3% common agarose gel electrophoresis. The detection of the cyclization efficiency of the embodiment of the invention is shown in figure 3;

the in vitro circularized RNA products were reverse transcribed using random primers (reverse transcription kit purchased from TAKARA under the accession number RR 037A), with 2. mu.l Buffer, 0.5ul MIX, 0.5. mu.l Randam primer6, 0.5. mu.g RNA in a 10. mu.l reverse transcription system, and finally made up in double distilled water. The reaction was carried out at 37 ℃ for 15 minutes and inactivated at 85 ℃ for 5 seconds. The cDNA obtained by reverse transcription is used as a template to carry out ordinary PCR, and after the PCR is finished, the DNA product is recovered by electrophoresis (figure 4) and sent to Wuhanquan biotechnology limited company for sequencing to confirm the existence of the cyclization sites.

5. RNA pull-down experiments: and incubating the prepared circular RNA probe and cell lysate together to form an RNA-protein complex, wherein the complex can be combined with magnetic beads marked by streptavidin, so that RNA is enriched, and the magnetic bead-circular RNA probe-protein complex is obtained. The specific embodiment is as follows:

in the RNA pull-down experiment, the cell amount required for each sample is 1000 ten thousand cells (about a culture dish with a diameter of 10 cm), 2 culture dishes are collected in the example, one culture dish is used as a control group, and the other sample is used as an experimental group;

for experimental control and treatment groups, this example employed an unclycled RNA probe as the control group, i.e. a linear RNA probe; in this example, the circularized probe was used as an experimental group, i.e., a circular RNA probe;

the prepared circular RNA probe and cell lysate are hybridized and incubated overnight at 4 ℃ in a 360-degree rotary shaker. The hybridization system comprises cell lysate, RNA probe, streptavidin-labeled magnetic beads (purchased from ThermoFisher company, with the product number of 11205D), RNase Inhibitor (purchased from TAKARA with the product number of 2313A), protease Inhibitor (purchased from PMSF with the product number of 36978B; purchased from ROCO HE with the product number of 04693132001);

the beads were washed 3 times with PBS to eliminate interference due to non-specific binding, and a protease inhibitor (PMSF, purchased from Thermo Fisher, Inc. under the reference 36978B; cocktail, purchased from ROCHE, Inc. under the reference 04693132001) was added to the PBS. When the magnetic beads are washed and the supernatant is discarded, the liquid in the EP tube is not completely sucked up, 50 mu l of liquid is left after the previous 2 times of centrifugation, and the liquid is completely sucked up in the last time, so that the purified magnetic bead-circular RNA probe-protein complex is obtained.

6. Recovery and analysis of proteins: and eluting the magnetic bead-circular RNA probe-protein complex to obtain purified protein, and performing protein detection such as Western Blot and mass spectrometry to find out the protein interacting with the circular RNA. Specific embodiments are as follows:

eluting the protein combined on the circular RNA probe by using the principle of acid-base denaturation, and detecting the protein;

the specific elution mode is as follows: 0.1M Glycine-HCl eluate (pH = 2.5-3.0), 1.5 MTRIS-HCl eluate (pH = 8.8) was prepared. Firstly, adding 50 mu l of 0.1M Glycine-HCl eluent into a magnetic bead-annular RNA probe-protein compound, fully and uniformly mixing, standing for 30 seconds, breaking the connection between protein and RNA, then adding 1 mu l of 1.5M TRIS-HCl eluent, fully and uniformly mixing, carrying out acid-base neutralization, then centrifuging at 12000 r/min for 1 minute, and collecting the supernatant in a new EP tube; repeating the above operation, continuously eluting once, collecting 102 μ l protein eluate, quickly freezing in liquid nitrogen, taking out from liquid nitrogen after 10 min, and storing at-80 deg.C;

taking out 30 μ l of protein eluate, adding 5 × protein denaturation Buffer 6 μ l, mixing well, heating in 95 deg.C water bath for 10 min to denature protein, performing polyacrylamide gel electrophoresis (SDS-PAGE electrophoresis), performing 80V constant voltage electrophoresis for 90 min, cutting gel, soaking in fixative (40% ethanol, 10% acetic acid), fixing in 37 deg.C constant temperature incubator for 30 min, dyeing in 37 deg.C constant temperature incubator with Coomassie brilliant blue for 30 min, fading with fixative (40% ethanol, 10% acetic acid), changing fixative after fading in 37 deg.C constant temperature incubator for 30 min, placing in 4 deg.C refrigerator for overnight, observing Coomassie brilliant blue dyeing condition, preliminarily judging whether there is protein pulled down after RNA pull-down experiment, proving that there is protein interacting with circular RNA, and performing electrophoresis after elution with Coomassie brilliant blue staining as shown in figure 5.

The remaining protein eluate was sent to Wuhan Biotechnology research institute for protein mass spectrometric detection. Eventually, proteins interacting with the circular RNA are found.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> affiliated cooperation hospital of college of Tongji medical college of Huazhong university of science and technology

<120> a method for preparing circular RNA with molecular marker and its application

<130>1

<160>3

<170>PatentIn version 3.5

<210>1

<211>254

<212>DNA

<213> human

<400>1

atattgatgg acagtatgca atgactcgag ctcagagggt acgagctgct atgttccctg 60

agacattaga tgagggcatg cagatcccat ctacacagtt tgatgctgct catcccacta 120

atgtccagcg tttggctgaa ccatcacaga tgctgaaaca tgcagttgta aacttgatta 180

actatcaaga tgatgcagaa cttgccacac gtgcaatccc tgaactgaca aaactgctaa 240

atgacgagga ccag 254

<210>2

<211>23

<212>DNA

<213> Artificial sequence

<400>2

acgaggacca gggagaaagc tgg 23

<210>3

<211>287

<212>DNA

<213> Artificial sequence

<400>3

gggagaccca agctggctagttaagcttat attgatggac agtatgcaat gactcgagct 60

cagagggtac gagctgctat gttccctgag acattagatg agggcatgca gatcccatct 120

acacagtttg atgctgctca tcccactaat gtccagcgtt tggctgaacc atcacagatg 180

ctgaaacatg cagttgtaaa cttgattaac tatcaagatg atgcagaact tgccacacgt 240

gcaatccctg aactgacaaa actgctaaat gacgaggacc agggatc 287

Claims (8)

1. A method for preparing circular RNA with a molecular marker, comprising the steps of:

s1: adding a DNA construct expressing the linear form of the RNA of the circular RNA into an in vitro transcription system, and transcribing to obtain linear RNA with a molecular marker and a monophosphoric group at the 5' end;

s2: adding the linear RNA into a connection system, and enabling the 5 'end and the 3' end of the linear RNA to form a 3', 5' -phosphodiester bond, thereby obtaining the cyclic molecule;

the in vitro transcription system comprises the monophosphate form of the first ribonucleoside at the 5' end of the linear RNA, and the triphosphate forms of all four ribonucleosides, and one or more of the triphosphate forms of the four ribonucleosides are labeled with a molecular marker, the concentration of the ribonucleoside monophosphate being higher than the concentration of its corresponding ribonucleoside triphosphate.

2. The method of claim 1, wherein the concentration of said ribonucleoside monophosphate is 5 to 15 times the concentration of the corresponding ribonucleoside triphosphate.

3. The method for producing a circular RNA carrying a molecular marker according to claim 1, wherein the molecular marker is biotin.

4. The method for preparing a circular RNA with a molecular marker according to any one of claims 1 to 3, wherein the ligation system comprises an RNA ligase and a single-stranded guide DNA, the 5 'end of the guide DNA is complementary to the 5' end of the linear RNA, the 3 'end of the guide DNA is complementary to the 3' end of the linear RNA, the two ends of the guide DNA are respectively bound to the 5 'end and the 3' end of the linear RNA, and the 5 'end and the 3' end of the linear RNA are respectively free from 0 to 10 bases.

5. The method of claim 4, wherein the 5 'end and the 3' end of the guide DNA are each independently 8-15nt long, and there is no spacer sequence between the 3 'end and the 5' end of the guide DNA, or there is a spacer sequence of 5nt or less.

6. Use of the method of any one of claims 1-5 for the preparation of a circular RNA with a molecular marker for obtaining a protein that interacts with said circular RNA in a cell.

7. A method for obtaining a protein that interacts with a circular RNA in a cell, comprising the steps of:

s3: preparing the circular RNA according to the method for preparing the circular RNA with the molecular marker according to any one of claims 1 to 5, incubating the circular RNA as a probe with a cell lysate, and forming a circular RNA-protein complex with a protein interacting therewith;

s4: capturing the circular RNA-protein complex by the molecular marker;

s5: separating the protein from the captured circular RNA-protein complex.

8. The method of claim 7, wherein the molecular marker is biotin and the circular RNA-protein complex is captured by magnetic beads.

Images