CN106754731A - Recombinant cell and MrgprX2 expression membrane receptor fixing phase and the preparation method and application high of MrgprX2 expression high - Google Patents
Recombinant cell and MrgprX2 expression membrane receptor fixing phase and the preparation method and application high of MrgprX2 expression high Download PDFInfo
- Publication number
- CN106754731A CN106754731A CN201710100941.6A CN201710100941A CN106754731A CN 106754731 A CN106754731 A CN 106754731A CN 201710100941 A CN201710100941 A CN 201710100941A CN 106754731 A CN106754731 A CN 106754731A
- Authority
- CN
- China
- Prior art keywords
- mrgprx2
- expression
- cell
- membrane
- recombinant cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
- C07K17/14—Peptides being immobilised on, or in, an inorganic carrier
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
Abstract
The invention discloses recombinant cell and MrgprX2 expression membrane receptor fixing phase and the preparation method and application high of a kind of MrgprX2 expression high, the recombinant cell is with HEK293 cells as host cell, expression vector of the transfection comprising MrgprX2 full-length genes, expression MrgprX2 acceptor macromoleculars can be stablized on its cell membrane, and with complete receptor biological activity.MrgprX2 expression membrane receptor fixing phases high are made up of the cell membrane of the recombinant cell of activated silica gel absorption MrgprX2 expression high, can be applied to the class allergy component that specificity screening identification is triggered by MrgprX2.The present invention has found that Sinomenine can be combined with specificity with MrgprX2 by practical application, the allergic experiment of cellular level shows that Sinomenine can stimulate histamine release of mast cell and β hexosaminidases simultaneously, it was demonstrated that MrgprX2 is high, and expression membrane receptor fixing phase can apply to specific recognition class allergy component really.
Description
Technical field
The invention belongs to biological technical field, it is related to the recombinant cell of MrgprX2 expression high and based on recombinant cell spy
MrgprX2 expression membrane receptor fixing phase and its construction method and the applications high of opposite sex identification class allergy component.
Background technology
Growing with Chinese medicine clinical practice, Chinese native medicine security " event " happens occasionally, especially traditional Chinese medicine
Clinical safety sex chromosome mosaicism receive much attention.Anaphylactoid reaction is also called pseudoanaphylaxis, is that exogenous irritant directly stimulates hypertrophy
Cell, causes its release histamine class activity mediator, and anaphylactoid reaction is not mediated by IgE typically, can produced in patient's medication first
It is raw.Research has shown that the G-protein that class allergic stimulated thing is activated is MRGPRS (MAS-Related G Protein-Coupled
Receptors), and MrgprX2 (Mas-related GPR family member X2) is mainly distributed on people's mast cell table
Face, and the receptoroid is independent of IgE, it is probably the acceptor of basic sercretogogue, can directly mediating mast cell activation, induction
Mast cell degranulation.Johns Hopkins University researcher determines that MrgprX2 acceptors will solve drug anaphylaxis
Extremely important target spot.
Membrane flexibility technology is a kind of effective new technology that identification target components are directly screened from complex system.Mesh
It is preceding also without be capable of specific recognition class allergy component MrgprX2 it is high expression membrane receptor fixing phase relevant report.
The content of the invention
It is an object of the invention to provide recombinant cell and MrgprX2 the expression membrane receptor high of a kind of MrgprX2 expression high
Fixing phase and preparation method and application, based on the recombinant cell of the MrgprX2 expression high for building, further construct
MrgprX2 expression membrane receptor fixing phases high, can be used in screening the class allergy component for acting on MrgprX2.
To reach above-mentioned purpose, the present invention is realized using following technical scheme：
A kind of recombinant cell of MrgprX2 expression high, the recombinant cell is the transfection with HEK293 cells as host cell
Exogenous expression's carrier of host cell is the expression vector comprising MrgprX2 full-length genes.
The nucleotide sequence of the MrgprX2 full-length genes is as shown in SEQ.ID.NO.1.
The expression vector comprising MrgprX2 full-length genes is LV5-MrgprX2homo slow virus.
The MrgprX2 expression membrane receptor fixing phases high of the recombinant cell based on described MrgprX2 expression high, it is described
MrgprX2 expression membrane receptor fixing phases high are made up of the cell membrane of the recombinant cell of activated silica gel absorption MrgprX2 expression high
's.
The preparation method of described MrgprX2 expression membrane receptor fixing phases high, comprises the following steps：
1) cell membrane suspension is prepared
By recombinant cell centrifugation, the cleaning of cultured MrgprX2 expression high, then under condition of ice bath, by MrgprX2
The recombinant cell ultrasonication of height expression, organelle is removed by differential centrifugation, isolates cell membrane, then by cell membrane physiology
Salt solution is resuspended, and cell membrane suspension is obtained；
2) MrgprX2 expression membrane receptor fixing phases high are prepared
To be placed in tool test tube after silica gel activating, under vacuum condition, to adding step 1 in tool test tube) obtained in it is thin
Then after birth suspension, vortex oscillation stands overnight, and obtains MrgprX2 expression membrane receptor fixing phases high.
In terms of class allergy component of the described MrgprX2 expression membrane receptor fixing phases high in screening with MrgprX2 as target spot
Application.
The MrgprX2 expression membrane receptor fixing phases high are obtained for recognition reaction in MrgprX2's after wet method dress post
The membrane flexibility post of class allergy component, the class allergy group using membrane flexibility post screening identification with MrgprX2 as target spot
Point.
Compared with prior art, the invention has the advantages that：
1st, the expression vector comprising MrgprX2 full-length genes is transfected into HEK293 host cells by the present invention, and through sieving
Choosing, obtains the recombinant cell of the MrgprX2 expression high of stabilization, is designated as HEK293-MrgprX2 cells.The bag that the present invention builds
The expression MrgprX2 molecules that the cell membrane of the restructuring HEK293-MrgprX2 cells containing MrgprX2 full length genes can be stablized, most
Height expression MrgprX2 improves 5000 times before relatively being transfected by the scale of construction, and with complete molecular activity.
2nd, the immortality of 5 type adenovirus (Ad5) DNA is transfected for primary human embryonic kidney cell as the HEK293 cells of host cell
Change cell, the various expression of receptor amounts that the cell contains in itself are relatively low；And the HEK293-MrgprX2 cells after recombinating
The relative expression quantity of MrgprX2 parts is more obvious than HEK293 to be increased, and advantage of expression ground is occupied relative to other cell surface molecules
Position, is on a good wicket in terms of MrgprX2 acceptors are combined；Screening is thus substantially increased with MrgprX2 as target drug
Sensitivity and specificity；Preferable cell model can be provided further to study MrgprX2 biological characteristicses simultaneously.
3rd, provided by the present invention for the MrgprX2 expression membrane receptor fixing phases high of specific recognition class allergy component, it is
The cell membrane of the recombinant cell of MrgprX2 expression high is adsorbed in support-activated silica gel and is made, it is specific with expressing
The membrane receptor of MrgprX2, MrgprX2 acceptors are the acceptor that can be specifically bound with class allergy component.In membrane flexibility post
Middle filling MrgprX2 expression membrane receptor fixing phases high can improve the specificity of " class allergy component " screening in complex sample, energy
Specific identification enough is carried out for " the class allergy component " in complex sample, analysis efficiency is lifted, to improving screening efficiency, explaining
The bright mechanism of action has great importance.
The preparation method of the MrgprX2 expression membrane receptor fixing phases high that the 4th, the present invention is provided, by the weight of MrgprX2 expression high
The cell membrane of group cell is separated, and is added in activated silica gel, makes activated silica gel adherent cell film, that is, obtain MrgprX2 tables high
Up to membrane receptor fixing phase.The method process is simple, it is easy to operate.Further, obtained MrgprX2 expression membrane receptors high are consolidated
After determining phase wet method dress post, can also be obtained for recognition reaction in the membrane flexibility post of the class allergy component of MrgprX2, be easy into
The screening of class allergy component in row complex sample.
5th, the MrgprX2 expression membrane receptor fixing phase screening Sinomenines high built with the present invention, it is found that hydrochloric acid is blue or green
Rattan alkali can retain in MrgprX2 expression membrane receptor fixing phases high, and retention time is 35min or so, illustrates Sinomenine
Can be combined with MrgprX2.Find that Sinomenine can stimulate mast cell that degranulation occurs and react by experiment in vitro, release
The Anaphylactic mediator such as β hexosaminidases and histamine.Therefore the above results show that MrgprX2 expression membrane receptor fixing phases high can be answered
Trigger the screening of class allergy component for the medicine with MrgprX2 as target spot.
Brief description of the drawings
Fig. 1 is LV5-MrgprX2 homo slow-virus infection efficiency charts；Wherein a is NC-HEK293 cells (infection LV5-NC
The HEK293 cells of virus) light field figure；B is NC-HEK293 cell fluorescence figures；C is MrgprX2-HEK293 cell light field figures；d
It is MrgprX2-HEK293 cell fluorescence figures.
Fig. 2 is the positive cell culture figure of puromycin screening；Wherein a is sieved for MrgprX2-HEK293 cells puromycin
Growth conditions figure after choosing；B is positive cell growth figure after the screening of MrgprX2-HEK293 cells puromycin；C is NC-HEK293
Growth conditions figure after the screening of cell puromycin；D is positive cell growth figure after the screening of NC-HEK293 cells puromycin.
Fig. 3 is the RT-PCR detection figures of mRNA level in-site MrgprX2 expressions；
Fig. 4 is the Westernblot detection figures of protein level MrgprX2 albumen；
Fig. 5 is calcium Imaging: Monitoring intracellular calcium flow change in concentration figure；Wherein a acts on HEK293 cells for A+P；B makees for A+P
For NC-HEK293 cells；C acts on MrgprX2-HEK293 cells for A+P；D acts on HEK293 cells for C48/80；e
For C48/80 acts on NC-HEK293 cells；F acts on MrgprX2-HEK293 cells for C48/80.
Fig. 6 is chromatogram of the Sinomenine on MrgprX2 high expressing cell membrane chromatography posts；
Fig. 7 is that Sinomenine stimulates histamine release of mast cell.
Fig. 8 is that Sinomenine stimulates mast cell to discharge β hexosaminidases.
Specific embodiment
The present invention is described in further details with reference to embodiment and accompanying drawing.
The present invention turns on the basis of the carrier for expression of eukaryon LV5-MrgprX2 slow virus for building MrgprX2 full-length genes
Dye HEK293 cells, obtain the recombinant cell of the MrgprX2 expression high of stabilization, are designated as HEK293-MrgprX2 cells, and
MrgprX2 expression membrane receptor fixing phases high are prepared based on HEK293-MrgprX2 cells.I.e. will using differential centrifugation method
The cell membrane of the recombinant cell of MrgprX2 expression high is extracted and separated, and the cell membrane of separation is made with activated silica gel physical absorption
MrgprX2 expression membrane receptor fixing phases high.MrgprX2 expression membrane receptor fixing phases high are carried out into wet method dress post with packing column machine, i.e.,
Obtain for recognition reaction in the membrane flexibility post of the class allergy component of MrgprX2.Treat that MrgprX2 membrane flexibility posts are abundant
After balance, complex sample sample introduction to be analyzed is analyzed, if there is component to retain on MrgprX2 cell membranes, the component is
Class allergy component.
The present invention is elaborated below, the explanation of the invention is not limited.
1. height expresses the structure of MrgprX2 recombinant cells：
(1) transduce：
1) first day：
Bed board：Using the lentiviral particle (buying in Shanghai Ji Ma companies) containing MrgprX2 genes to HEK293 cells
Infected, cellar culture HEK293 cells, 0.5 × 10 is inoculated with 24 orifice plates5Individual cells/well, adds 0.5mL to cultivate completely
Base, it is ensured that the fusion rate of cell reaches 40%-60% during virus infection, because the expression time of Lentivirus is more long.By cell
Plate puts 5%CO237 DEG C of overnight incubations, treat cell attachment in incubator.
2) second day：
A. virus is diluted：Prepare 2 aseptic 1.5mL EP pipes, 450 μ L complete mediums are sucked respectively, draw 50 μ L's
9×108The virus (being taken out in thawed on ice from -80 DEG C in advance) of TU/mL is added in first pipe, soft to mix, and is not produced
Raw foam, carries out 10 times of dilutions, and draws 45 μ L to second pipes from first pipe, mixes.Thus obtain two
The virus of individual different gradients：10 times of dilutions, 100 times of dilutions.Calculate and understand, two MOI values difference of various concentrations virus
It is 10 and 1.
B. addition Polybrene (polybrene)：Polybrene can effectively improve efficiency of infection in most cells,
The original liquid concentration that adaptable volume is separately added into the dilution virus liquid that step a is obtained is the Polybrene of 5mg/mL, is protected
The final concentration of 5 μ g/mL of Polybrene in card viral dilution liquid.
C. infection cell：Old cell culture fluid in 24 orifice plates is removed, the virus liquid in step b is added, while setting up empty
White control and negative control, put back to cell incubator and are incubated, 37 DEG C, 5%CO2Overnight.
3) the 3rd day：Remove the virus liquid after cellular invasion after 12-24h, add the complete medium of 0.5mL, 37 DEG C,
5%CO2Overnight.
4) fourth, fifth day：Efficiency of infection is detected, after infection 48-96h：Green fluorescence table is observed in inverted fluorescence microscope
Up to situation, the efficiency of slow-virus infection HEK293 cells is estimated, as a result as shown in Figure 1, it is seen that efficiency of infection is higher.
Metainfective cell can be cultivated continuously one week, slow to determine by the expression time and expression intensity of observing fluorescence
Infection conditions of the virus to HEK293 cells.Situation during infection according to cell growth is changed liquid in time to cell, if any
Need, 1/3-1/5 can be separated with vitellophag, add the complete medium of 0.5mL, continue to cultivate 24-48h, to ensure cell
Good growth conditions.
(2) Puromycin (puromycin) screenings：
1) optimal screening concentration is determined
A. take the logarithm the HEK293 cells (typically in the 70%~80% of confluent cultures vessel bottom) in growth period, with new
Fresh complete medium DMEM is made 1.5 × 105The cell suspension of individual/mL.To cell suspension is added in 96 well culture plates, per the μ of hole 100
L (makes every hole cell number 1.5 × 104It is individual), then add fresh DMEM medium appropriate to every hole, quiescent culture mistake in incubator
Night.
B. the puromycin storing solution that concentration is 8mg/mL was diluted to 0.25-2.5 μ respectively with DMEM culture mediums in second day
Totally 13 liquids of concentration gradient between g/mL, replace the old culture medium in each hole by packet respectively.
C. daily check cell viability, because HEK293 cell growths are too fast, every other day changes once mould containing purine
The culture medium of element.
D. after observation is cultivated 2-3 days, the Cmin of puromycin of all cell deaths is can result in just as optimal
Screening concentration, it is used to screen metainfective cell.
2) Puromycin screenings infected cell.
A. just can use the culture medium containing optimal concentration puromycin instead to screen NC-HEK293 after 48h after virus infection
Cell and MrgprX2-HEK293 cells, while setting up a HEK293 cell controls ware, add puromycin, as
Whether puromycin effectively compares.
B. the culture medium containing puromycin is every other day used instead, to replace the culture medium containing a large amount of dead cells, until resistance
Group can be identified.Result is shown in Fig. 2, it is seen that after being screened with puromycin, the HEK293 cells of infection virus LV5-MrgprX2
There are shrinkage, the phenomena of mortality in major part, but has a small amount of cell to be still within adherent growth, and as shown in Figure 2 a, what is obtained has
The positive MrgprX2-HEK293 cells of puromycin resistance gene, as shown in Figure 2 b.The HEK293 of infection virus LV5-NC is thin
Born of the same parents with puromycin screen after growth conditions as Fig. 2 c shown in.
C. after resisting cell is covered with, 10cm culture dishes, harvesting, in mRNA or protein level identification gene table are transferred to
Up to situation.Retaining cell simultaneously carries out Secondary Culture, is frozen after success to be identified, for subsequent experimental.
2.RT-PCR detects the expression of MrgprX2 transcriptional levels in gained cell.
(1) extraction of total serum IgE：
Using Trizol reagents extract be uninfected by HEK293 cells, infection NC virus, MrgprX2 virus HEK293 it is thin
The total serum IgE of born of the same parents.
1) culture medium is exhausted, is gently washed once with PBS, sop up PBS.Add 3mL Trizol by the big culture dishes of 10cm, rock
Under 3-5, then under being blown and beaten more with rifle, until rifle point when lifting there is no filiform, it is ensured that all after cracking (no longer in thick),
It is drawn in 1.5mL centrifuge tubes, is vortexed or acutely shakes.
2) it is stored at room temperature 5-15 minutes.In 4 DEG C, 12000rpm centrifugation 10min take supernatant, add according to every milliliter of Trizol
Enter 0.2mL chloroforms, Vortex mixes or fiercely rocks 15 seconds, and room temperature is placed 2-3 minutes.
3) in 4 DEG C, 12000rpm centrifugations 15min, careful upper strata aqueous phase of the absorption containing total serum IgE to a new 1.5mL centrifugations
Guan Zhong, every milliliter of Trizol can about draw 0.4-0.5mL, and often pipe is added and the isometric isopropanol of supernatant, reverse to mix for several times,
Precipitation at room temperature is placed 2 hours for 10 minutes or 4 DEG C.
4) in 4 DEG C, 12000rpm centrifugation 15min in the visible gluey RNA precipitate of ttom of pipe, abandon supernatant, per effective
0.8mL75% alcohol is washed and (teetertottered, supernatant, 75000rpm, 5min, 4 DEG C are removed in uniform centrifugation) twice, and absolute ethyl alcohol washes one
It is secondary, then (﹥ 5000rpm are centrifuged 1 second) is got rid of with centrifuge, liquid is carefully exhausted with small pipette tips, RNA precipitate should not be encountered.
5) vacuum is drained or dried naturally 3-5 minutes, after RNA is slightly dry, the μ L of deionized water 20 for adding DEPC treated
Dissolution precipitation, freezes in -80 DEG C.
6) agarose gel electrophoresis:0.3g agarose powders are weighed, is dissolved in 30mL TEA buffer solutions, under microwave condition
Moderate heat is heated for 2 minutes, when temperature is down to 50-60 DEG C, with rifle to adding 2 μ L EB to rock uniformly in solution, glue is poured into rapidly
Drilling comb drilling is inserted in groove, in glue is immersed in electrophoresis tank electrophoretic buffer after gelling is solid, by RNA:6×Loading
Buffer:DEPC water=1:1:4 ratio mixes on sealed membrane, and drawing mixed liquor with rifle is added in loading hole, constant pressure (electricity
Stream is adjusted to maximum) electrophoresis is carried out under conditions of 120V, electrophoresis starts to take out gel after no more than 15-20 minutes, by gel
It is placed under gel imaging instrument, opens ultraviolet light and inspected.The RNA for preferably extracting is by the band after gel separation
The brightness of 28S should be the twice of 18S, and occur without 5S bands.It is the RNA for being extracted if the RNA for extracting meets mentioned above principle
Quality preferably, can carry out follow-up reverse transcription operation.
7) using NanoDrop ND-1000 types it is ultraviolet/visible spectrophotometer determine RNA purity and content.
(2) reverse transcription RNA is cDNA
Using the PrimeScrip of Takara companiesTMRT reagent Kit with gDNA Eraser(Perfect
Real Time) the RNA reverse transcriptions that will extract of Reverse Transcriptase kit synthesize the first chain cDNA, and specific method is as follows:
1) removal genomic DNA reaction：
Reaction mixture is prepared on ice, to ensure the accuracy that reaction solution is prepared, when carrying out every reaction, should first by reaction
The amount of number+2 prepares Maste Mix, is then dispensed into again in each reaction tube, is eventually adding RNA sample.10 μ L reaction systems are matched somebody with somebody
System is as follows, can accordingly expand as needed.
After preparing reaction system, finger flicks EP bottom of the tube, is centrifuged 10 seconds, is put into PCR instrument, sets response procedures：42
DEG C 2min (or room temperature 5min*2), 4 DEG C of ∞.
| Reagent | Usage amount |
| 5×gDNA Eraser Buffer | 2.0μL |
| gDNA Eraser | 1.0μL |
| Toal RNA | *1 |
| RNase Free dH2O | up to 10μL |
*1:In 20 μ L reverse transcription reaction systems, the Toal RNA of 1 μ g at most can be used in SYBR Green qPCR methods.
*2：During room temperature reaction, 30 minutes can be extended to.
2) reverse transcription reaction：
Using<SYBR Green qPCR methods>In reaction solution is prepared on ice, Maste Mix are prepared by the amount of stoichiometric number+2,
Then in dispensing 200 μ L reaction tubes again*3, reverse transcription reaction is carried out immediately after soft mixing.
After preparing reaction system, finger flicks EP bottom of the tube, is centrifuged 10 seconds, is put into PCR instrument, sets response procedures：37
℃15min；85℃5sec；4℃∞.The cDNA of synthesis is preserved in -20 DEG C or lower temperature.
| Reagent | Usage amount |
| Step 1) reaction solution | 10.0μL |
| PrimeScript Enzyme Mix Ⅰ | 1.0μL |
| RT Primer Mix | 1.0μL |
| 5×PrimeScript Buffer 2(for real time) | 4.0μL |
| RNase Free dH2O | 4.0μL |
| Toal | 20μL |
*3：If do not prepared Master Mix, during to adding reagent in the reaction solution of step 1, RNase Free are first added
dH2O and 5 × PrimeScript Buffer 2 (for real time) is well mixed, so that the activity of gDNA Eraser is filled
Point it is suppressed, then adds RT Primer Mix, PrimeScript Enzyme Mix I, gently mixes that to carry out reverse transcription anti-
Should.
3) Real Time PCR amplifications：
SYBR Premix Ex Taq II (Tli RNaseH Plus) kit of selection Takara companies, application
Thermal Cycler Dice Real Time System amplification instruments, by the use of the first chain cDNA as template, use specific primer
Expanded, using the reaction system of 25 μ L, specific method is as follows：
A. according to the sequence of genes of interest MrgprX2, design primer is as follows：
Upstream：5'CAGGACATTGCTGAGGTGGA 3'
Downstream：5'AGTTCAGCAAATCAGACAGACAGG 3'
Primer is synthesized by Takara companies, and purpose fragment is the 993bp long that can represent MrgprX2 gene expression abundances
MrgprX2 genetic fragments.
B. primer is dissolved in water standby.
C. PCR reaction systems are prepared on ice, are constituted as follows：
| Reagent | Usage amount | Final concentration |
| SYBR Premix Ex TaqⅡ(Tli RNaseH Plus)(2×) | 12.5μL | 1× |
| PCR Forward Primer(20μM) | 0.5μL | 0.4μM |
| PCR Reverse Primer(20μM) | 0.5μL | 0.4μM |
| RT reaction solutions (cDNA solution) | 2.0μL | |
| dH2O (sterile purified water) | 9.5μL | |
| Toal | 25μL |
D. expression of results of each cell in transcriptional level is obtained after being expanded through PCR, Fig. 3 is seen, it is seen that MrgprX2-HEK293
There is significantly MrgprX2 genes compared with HEK293 cells and NC-HEK293 cells in the expression quantity of mRNA level in-site in cell
Improve.
3.Western blot detect the expression quantity of MrgprX2.
Under the conditions of 4 DEG C, Amplification Culture is resistant after HEK293 cells, the puromycin screening that will be uninfected by
MrgprX2-HEK293 cells, NC-HEK293 cells are cracked with RIPA lysates, and Ultrasonic Cell Disruptor is crushed, and extract the total egg of cell
In vain, and with BCA methods protein content is determined.Institute's leach protein through SDS-PAGE electrophoresis, transferring film, closing, be incubated primary antibody, be incubated secondary antibody and
With ECL chemiluminescence detection protein expressions, the expression of MrgprX2 albumen is detected.Result is as shown in figure 4, shown in swimming lane 1
The MrgprX2 expression quantity of HEK293 cells is significantly lower than the restructuring MrgprX2-HEK293 cells shown in swimming lane 2.From Western
The result of blot show that the MrgprX2 expression quantity recombinantly expressed in MrgprX2-HEK293 cells is significantly improved.
4. calcium imaging technique monitors various Cytoplasmic Cas2+Change in concentration.
(1) preparation of related liquid：
1) preparation of reagent mother liquor：
A. poly-D-lysine：Poly-D-lysine powder is dissolved with aseptic tri-distilled water be configured to 0.1mg/mL, i.e., 0.01%
Poly-D-lysine working solution, matching while using, or 4 DEG C maintain up to one or two week.
B.Fluo-3 (specification 100ug) adds 17.7 μ L DMSO dissolvings.
C.F-127 takes 5mg and adds 44.2 μ L DMSO dissolvings, is kept in dark place in -20 DEG C.
d.CIB:Respectively according to NaCl 125mM, KCl 3mM, CaCl2 2.5mM,MgCl2 0.6mM,HEPES 10mM,
Glucose 20mM,NaHCO31.2mM, Sucrose 20mM prepare the CIB cushioning liquid of 200mL, adjust pH to 7.4, in
4 DEG C of preservations.
2) preparation of medicine used by：
According to set concentration, will be dissolved in the CIB that the mother liquor of the positive drug C48/80 of DMSO adds respective volume,
It is diluted to the activity of positive drug.
3) preparation of Incubating Solution：
HEK293 cells are attached cell, and its Incubating Solution is：0.7μL Fluo-3+4μL F-127+995.3μL CIB.Incubate
Educate liquid now with the current.
(2) experimental procedure：
1) poly-D-lysine coated cell plate：Though HEK293 cells are attached cell, its is adherent loosely, easily uses pancreatin
Digestion, so inoculation the previous day need to be coated with 96 orifice plates with poly-D-lysine, is specifically processed as：Poly is added to rely per hole in 96 orifice plates
The μ L of propylhomoserin working solution 100, coating overnight, is washed 2-3 times for second day with aseptic tri-distilled water, and PBS washes 1 time to play balance salt action, note
The amount of washing lotion of anticipating is more than the amount of coating buffer, super-clean bench ultraviolet irradiation half an hour, and air-dries.
2) inoculating cell：HEK293, NC-HEK293, MrgprX2-HEK293 cell are digested with pancreatin, by about 5 × 103
96 orifice plates are accessed in individual/hole, are put into incubator, 37 DEG C, 5%CO2Overnight, treat that cell is adjacent to.
3) it is incubated：Culture medium is abandoned in suction, and the μ L of CIB 100 that 37 DEG C are heated to per hole are cleaned 1 time；CIB is abandoned in suction, in lucifuge
Under the conditions of add the μ L of Incubating Solution 100, be placed in and 40min be incubated in incubator.
4) monitored under fluorescence microscope：Incubating Solution is abandoned in suction, adds CIB to abandon supernatant after cleaning 1 time per hole, and CIB is added again
100 μ L, the μ L of positive drug C48/80 200 are added under fluorescence microscope blue light, inhaling to abandon successively per hole by cell packet after CIB, and
Take pictures immediately, the time for exposure is 1s, per second beats one, photo opporunity is 3min.Monitoring result is as shown in Figure 5.
Stimulated simultaneously with A23187 and PMA by HEK293, NC-HEK293 cell and MrgprX2-HEK293 cells,
The intracellular Ca2+ rheologyization for obtaining is respectively as shown in Fig. 5 a, b, c, it is seen that intracellular calcium ion increases.By using positive drug C48/80
Stimulate HEK293, NC-HEK293 cell and MrgprX2-HEK293 cells respectively, as a result respectively as shown in Fig. 5 d, e, f, it is seen then that
The fluorescence intensity of HEK293, NC-HEK293 cell is not changed in, and the fluorescence intensity of MrgprX2-HEK293 cells has substantially
Raising, i.e. MrgprX2-HEK293 cells intracellular free calcium level significantly improves, and illustrates that MrgprX2-HEK293 is intracellular
MrgprX2 acceptors are relevant with intracellular free calcium level increase.So far the success of MrgprX2-HEK293 cell constructions is confirmed.
The preparation of 5.MrgprX2 expression membrane receptor fixing phases high
(1) preparation of MrgprX2 expression membrane receptor fixing phases high
The HEK293-MrgprX2 cells of exponential phase are chosen, using 0.25% trypsase by adherent growth
HEK293-MrgprX2 cell dissociations get off, and are placed in centrifuge tube, the 1000g centrifugations 10min under the conditions of 4 DEG C, removal supernatant
Nutrient solution, sedimentation cell adds physiological saline to be suspended again under the conditions of 4 DEG C 1000g centrifugation 10min, washes away cell surface
The culture medium of residual, physiological saline cleaning process is repeated 2 times.Backward cell in add the Tris-HCl solution of 5mL 50mM,
It is placed in cell Ultrasonic Cell Disruptor.The suspension of cell membrane and organelle is centrifuged 10min under the conditions of 4 DEG C of 1000g, is now taken
Supernatant is centrifuged 10min under the conditions of 4 DEG C of 12000g in centrifuge tube, and precipitation is cell membrane, and precipitation is resuspended with physiological saline,
And under the conditions of 4 DEG C of 12000g 20min is centrifuged again, the cell Membrane cleaning that will be obtained 1 time.The cell membrane that will finally obtain sinks
Form sediment and be suspended with the physiological saline of 5mL, and cell membrane suspension is added to the preactivated macropore silicon of 0.05g under vacuum
In glue, it is placed on magnetic stirring apparatus in 4 DEG C of condition stirring 30min, it is ensured that cell membrane stands overnight after fully being mixed with silica gel, profit
Cell membrane is fully combined with macro porous silica gel with physisorption, obtain MrgprX2 expression membrane receptor fixing phases high.
(2) MrgprX2 expression membrane receptor Chromatography Models screenings high
1) prepared by cell membrane fixing phase
By cell suspension, 5000rpm is centrifuged 10min under the conditions of 4 DEG C, removes the nutrient solution of supernatant, and precipitation is cell,
Physiological saline is added to be suspended again after above-mentioned condition centrifugation, physiological saline cleaning process is repeated 2 times.Add in the cell for obtaining
Enter the Tris-HCl solution of 5mL precoolings, be placed in ice-bath ultrasonic 30min smudge cellses in Ultrasound Instrument, to ensure the activity of cell membrane.
0.02g silica gel is weighed in tool test tube simultaneously, is placed in 105 DEG C of baking ovens and is activated 30min.After sonicated cells, cell is used
Broken instrument is crushed again, and program is work 3s, interval 1s, 6 times.Under the conditions of 4 DEG C 1500g centrifugation 10min, Aspirate supernatant in
In an other centrifuge tube, 12000g centrifugations 10min, is precipitated as cell membrane, precipitation physiological saline weight under the conditions of 4 DEG C
It is outstanding, and the 12000g centrifugations 10min under the conditions of 4 DEG C again, the cell Membrane cleaning that will be obtained is once.The precipitation physiology salt of 5mL
Water is suspended, and in suction 5ml syringes, is mixed with activated silica gel under the conditions of vacuum is vortexed concussion, is placed in magnetic agitation
In 4 DEG C of condition stirring 30min on device, stand overnight, obtain cell membrane fixing phase suspension.
2) preparation of CMC posts
Next day, by cell membrane fixing phase suspension be vortexed mix, be transferred in 10mL centrifuge tubes, under the conditions of 4 DEG C 2000rpm from
Heart 10min, abandons supernatant, and precipitation adds about 5mL physiological saline to be vortexed and mixes, and repeats aforesaid operations 2 times, removes unnecessary parcel
Cell membrane on silica gel, mixes to adding about 5mL physiological saline to be vortexed in precipitation, pours into packing column machine flushed in advance
In, mobile phase is water, and flow velocity is 2.0mL/min, and pressure during dress post is no more than 10MPa, fills post time 5min, you can by cell
Film fixing phase is fitted into post core, and the membrane flexibility post that will be filled is used in being fitted into liquid chromatograph.
(3) chromatographic condition
Shimadzu LC-20A high performance liquid chromatographs (Shimadzu, Japan), comprising DGU-20A3 on-line degassing machines, LC-20AB liquid
Phase chromatogram pump, SIL-20A automatic samplers, CTO-20AC column ovens, SPD-M20A automatic samplers, Shimadzu LC
Labsolution softwares.
Membrane flexibility condition 1：Ultra-pure water is mobile phase, the detection of flow velocity 0.2mL/min, PDA detector.
Membrane flexibility condition 2：Mobile phase：50mmol/L PBS；Flow velocity：0.2mL/min；Column oven：37℃；PDA is examined
Survey.
6. the Anaphylactic mediator release test of Sinomenine
(1) histidine in the golgiosome of mast cell and basophilic granulocyte is acted on through histidine decarboxylase, is sloughed
The amine substance with vasoactive formed after carboxyl, histamine is generally stored in the lung and skin histology of people, and each is thin
The histamine content of born of the same parents is similar, generally 2~5 pg, and it is mainly to be combined by the histamine receptor with target cells and causes gas
The allergic reactions such as road smooth muscle contraction, blood vessel dilatation.
First using standard concentration as X-axis, corresponding absorbance carries out Logit-Log fitting a straight lines as Y-axis,
Obtain following curvilinear equation.
P=OD/OD0, q=1-p,
Y=ln (p/q), x=lg (concentration),
Wherein:OD is response value, and OD0 is the average of response value that concentration is 0, then equation is：
Y=a+b*x
Table 1-1 histamine reference substance solution concentration and corresponding absorbance
Wherein a=4.69239, b=-3.36197, r^2=0.84483.
Table 1-2 histamine standard curve fit values
It is 1.93324 to try to achieve residual sum of squares (RSS).
Bring the absorbance of testing sample into equation, try to achieve corresponding Histamine concentrations.
(2) Hex is mast cells activation degranulation mark, the β-ammonia of detection Sinomenine induction
Mast cells activation effect is evaluated in the release of base hexosidase.With Sinomenine concentration as abscissa, Hex is released
Rate is put for ordinate, description is with the change of the increase Hex release rate of Sinomenine concentration；With C48/80
Used as positive control, buffer solution is cooked negative control.
1) inoculating cell：By the LAD2 cells of exponential phase, it is made of the digestion of 0.25% trypsin solution unicellular
Suspension, after cell count, is inoculated in (5 × 10 in 96 orifice plates with certain density4Individual/hole), cell suspension volume is 150 μ L/ holes.
Every group sets 4 parallel holes, in 37 DEG C, 5%CO2Cultivated in incubator.
2) dosing：Culture 24h, after after cell attachment, with fresh culture medium dilute hydrochloric acid cucoline and is sufficiently mixed
It is even, with fresh 10 times of Compound48/80 of dilution 30mg/mL of culture medium as positive drug.Each hole culture medium is abandoned in suction, per hole
Drug solution and the positive μ L of liquid 100 are sequentially added, negative control group adds isometric fresh culture, 37 DEG C of culture 30min.
3) supernatant detection is taken：2000g centrifugation 10min at 4 DEG C of supernatant are drawn, with 0.1% Trition X-100 lysates
Cracking negative control group cell 5min, takes 2000g centrifugations 10min at 4 DEG C of lysate.1mmol/ is added in 96 clean orifice plates
The μ L of L beta-aminos hexose 50 add the cell supernatant and negative control group cell of 50 each drug concentrations of μ L as reaction substrate
Lysate, be sufficiently mixed, 37 DEG C of incubators are incubated 1h, are subsequently adding the sodium carbonate/bicarbonate end of 150 μ L 0.1mol/L
Only liquid terminating reaction, selects the absorbance in each hole of wavelength measure of 405nm on enzyme-linked immunosorbent assay instrument, records result, root
The release rate of each concentration is calculated according to formula.Formula is as follows：
The absorbance of Hex release rate (the %)=administration group cell conditioned medium/(suction of feminine gender group cell conditioned medium
Luminosity+feminine gender organizes the absorbance of cell pyrolysis liquid) × 100%.
As shown in fig. 6, with the MrgprX2 expression membrane receptor fixing phase screening Sinomenines high that the present invention builds, hair
Existing Sinomenine can retain in MrgprX2 expression membrane receptor fixing phases high, and retention time is 35min or so, illustrates salt
Sour cucoline can be combined with MrgprX2.As shown in Figure 7 and Figure 8, find that Sinomenine can stimulate hypertrophy by experiment in vitro
There is the Anaphylactic mediators such as degranulation reaction, release β hexosaminidases and histamine in cell.The above results show MrgprX2 tables high
The medicine that be can apply to MrgprX2 as target spot up to membrane receptor fixing phase triggers the screening of class allergy component.
The above, is only presently preferred embodiments of the present invention, and not the present invention is imposed any restrictions, every according to the present invention
Any simple modification, change and equivalent structure transformation that technical spirit is made to above example, still fall within skill of the present invention
In the protection domain of art scheme.
Nucleotides sequence list
<110>Xi'an Communications University
<120>Recombinant cell and MrgprX2 expression membrane receptor fixing phase and the preparation method and application high of MrgprX2 expression high
<160> 1
<210> 1
<211> 2130
<212> DNA
<213> MrgprX2
<400> 1
gtttgccagt cccaggaaag cacttctcaa ctcaccaact ccagtagaaa gaagggtgtt 60
aaggggcacc agtggaggtt ttctgagcat ggatccaacc accccggcct ggggaacaga 120
aagtacaaca gtgaatggaa atgaccaagc ccttcttctg ctttgtggca aggagaccct 180
gatcccggtc ttcctgatcc ttttcattgc cctggtcggg ctggtaggaa acgggtttgt 240
gctctggctc ctgggcttcc gcatgcgcag gaacgccttc tctgtctacg tcctcagcct 300
ggccggggcc gacttcctct tcctctgctt ccagattata aattgcctgg tgtacctcag 360
taacttcttc tgttccatct ccatcaattt ccctagcttc ttcaccactg tgatgacctg 420
tgcctacctt gcaggcctga gcatgctgag caccgtcagc accgagcgct gcctgtccgt 480
cctgtggccc atctggtatc gctgccgccg ccccagacac ctgtcagcgg tcgtgtgtgt 540
cctgctctgg gccctgtccc tactgctgag catcttggaa gggaagttct gtggcttctt 600
atttagtgat ggtgactctg gttggtgtca gacatttgat ttcatcactg cagcgtggct 660
gattttttta ttcatggttc tctgtgggtc cagtctggcc ctgctggtca ggatcctctg 720
tggctccagg ggtctgccac tgaccaggct gtacctgacc atcctgctca cagtgctggt 780
gttcctcctc tgcggcctgc cctttggcat tcagtggttc ctaatattat ggatctggaa 840
ggattctgat gtcttatttt gtcatattca tccagtttca gttgtcctgt catctcttaa 900
cagcagtgcc aaccccatca tttacttctt cgtgggctct tttaggaagc agtggcggct 960
gcagcagccg atcctcaagc tggctctcca gagggctctg caggacattg ctgaggtgga 1020
tcacagtgaa ggatgcttcc gtcagggcac cccggagatg tcgagaagca gtctggtgta 1080
gagatggaca gcctctactt ccatcagata tatgtggctt tgagaggcaa ctttgcccct 1140
gtctgtctga tttgctgaac tttctcagtc ctgattttaa aacagttaag agagtccttg 1200
tgaggattaa gtgagacagt gcctatgaaa caaacactaa gtgcagtgtc tctggaactg 1260
ccttactcac aggcttccac cacagcccta tgagagcttt gccaactctg cggtccatga 1320
ctgttcccac ttttaatgaa tcctaccttt cgcagaaggc tgaaagcagg gcagaaaaga 1380
tctacatttc tttggacact gcacttgata gggactcaaa gaatgttata tttttaatta 1440
atttcttttt ctcttccgta caatttctgt ctcaacaaaa ttagaagaat taaatttaaa 1500
actagctcca aaagagcagt cgtctttcat tttggcagac cttagaatat ccccctagct 1560
taataaatct ttgttgaatg gcttaatgaa tgaataaact ggttaatgtt taagttaaac 1620
ctctgaaaag tctccattta ccagatttga gtcactaaat ttattgcttt cactactttt 1680
gaattttgca aacatgaaat taagttttat aattagataa atcaatgtca acacatattt 1740
aaagtttgag gtacactgtc ttcctgtggt ttcctttcac atgccatccc ttaaaatccc 1800
agctacacgc cttcccattc cttccccttt gcctttgttc taatcttccc tctctggggg 1860
ctctctaatt cgtcctggaa gtttccagtg gtcttataga ctccatgttc ttggaggaca 1920
ggctgtatgt cagatttacc ttttattccg aagaactcgg agcatttatt ttgttaatta 1980
aattgcacat atttttaaaa gttacgtgtt ccacagaata aaatactaat tgtaaaaaaa 2040
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2100
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2130
Claims (7)
1. the recombinant cell of a kind of MrgprX2 expression high, it is characterised in that：The recombinant cell is with HEK293 cells as host
Cell, exogenous expression's carrier of transfection host cell is the expression vector comprising MrgprX2 full-length genes.
2. the recombinant cell of the MrgprX2 expression high as described in claim l, it is characterised in that：The MrgprX2 full-length genes
Nucleotide sequence as shown in SEQ.ID.NO.1.
3. the recombinant cell of MrgprX2 as claimed in claim 1 expression high, it is characterised in that：It is described comprising MrgprX2 total lengths
The expression vector of gene is LV5-MrgprX2homo slow virus.
4. the MrgprX2 expression films high of the recombinant cell based on the MrgprX2 expression high described in any one in claim 1-3
Acceptor fixing phase, it is characterised in that：The MrgprX2 expression membrane receptor fixing phases high are high by activated silica gel absorption MrgprX2
What the cell membrane of the recombinant cell of expression was made.
5. the preparation method of the MrgprX2 expression membrane receptor fixing phases high described in claim 4, it is characterised in that including following
Step：
1) cell membrane suspension is prepared
By recombinant cell centrifugation, the cleaning of cultured MrgprX2 expression high, then under condition of ice bath, by MrgprX2 tables high
The recombinant cell ultrasonication for reaching, organelle is removed by differential centrifugation, isolates cell membrane, then by cell membrane physiological saline
It is resuspended, cell membrane suspension is obtained；
2) MrgprX2 expression membrane receptor fixing phases high are prepared
To be placed in tool test tube after silica gel activating, under vacuum condition, in tool test tube add step 1) obtained in cell membrane
Then suspension, vortex oscillation stands overnight, and obtains MrgprX2 expression membrane receptor fixing phases high.
6. the MrgprX2 expression membrane receptor fixing phases high described in claim 4 are screening the class allergy group with MrgprX2 as target spot
Application in terms of point.
7. application as claimed in claim 6, it is characterised in that：The MrgprX2 expression membrane receptor fixing phases high are filled through wet method
It is obtained after post for recognition reaction in the membrane flexibility post of the class allergy component of MrgprX2, is sieved using the membrane flexibility post
Class allergy component of the choosing identification with MrgprX2 as target spot.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710100941.6A CN106754731B (en) | 2017-02-23 | 2017-02-23 | The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710100941.6A CN106754731B (en) | 2017-02-23 | 2017-02-23 | The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754731A true CN106754731A (en) | 2017-05-31 |
| CN106754731B CN106754731B (en) | 2019-10-11 |
Family
ID=58960284
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710100941.6A Active CN106754731B (en) | 2017-02-23 | 2017-02-23 | The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754731B (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107703312A (en) * | 2017-11-15 | 2018-02-16 | 西安交通大学 | The protein marker and method of examination medicine anaphylactoid reaction sensitive group |
| CN108398517A (en) * | 2018-02-11 | 2018-08-14 | 湖南正清制药集团股份有限公司 | A kind of method of potential Allergen in screening Zhengqingfengtongning preparation |
| CN109765324A (en) * | 2018-11-27 | 2019-05-17 | 苏州科技大学 | A kind of screening technique of MEK1 albumen potential inhibitor |
| CN110204606A (en) * | 2019-05-31 | 2019-09-06 | 西安交通大学 | A kind of polypeptide being used to prepare rabbit polyclonal antibody and its application |
| CN110204607A (en) * | 2019-05-31 | 2019-09-06 | 西安交通大学 | A kind of dominant antigen epitope polypeptide of anti-Mrgprx2 antibody and its application |
| CN110229228A (en) * | 2019-05-31 | 2019-09-13 | 西安交通大学 | The polypeptide with immunogenicity of a kind of pair of anaphylactoid reaction specific receptor MRGPRX2 albumen and its application |
| CN110229227A (en) * | 2019-05-31 | 2019-09-13 | 西安交通大学 | It is a kind of be used to prepare ELISA murine monoclonal coated antibody and rabbit polyclonal detection antibody polypeptide and its application |
| CN110240643A (en) * | 2019-05-31 | 2019-09-17 | 西安交通大学 | A kind of double antibodies sandwich kit being used to prepare anaphylactoid reaction matches polypeptide and its application of antibody |
| CN116855503A (en) * | 2023-08-30 | 2023-10-10 | 上海益诺思生物技术股份有限公司 | Stable transgenic cell strain over-expressing MRGPRX2 and construction method and application thereof |
-
2017
- 2017-02-23 CN CN201710100941.6A patent/CN106754731B/en active Active
Non-Patent Citations (6)
| Title |
|---|
| EHSAN AZIMI: "Dual action of neurokinin-1 antagonists on Mas-related GPCRs", 《JCI INSIGHT》 * |
| KATHERINE LANSU: "In silico design of novel probes for the atypical opioid receptor MRGPRX2", 《NATURE CHEMICAL BIOLOGY》 * |
| RUI LIU: "MRGPRX2 is essential for sinomenine hydrochloride induced anaphylactoid reactions", 《BIOCHEMICAL PHARMACOLOGY》 * |
| SHENGLI HAN: "New method of screening allergenic components from Shuanghuanglian injection: With RBL-2H3/CMC model online HPLC/MS system", 《JOURNAL OF PHARMACEUTICAL AND BIOMEDICAL ANALYSIS》 * |
| 王瑜: "一种提高细胞膜色谱精确性和灵敏性的方法", 《南方医科大学学报》 * |
| 赵新超: "细胞膜色谱固定相的制备条件优化研究", 《天津药学》 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107703312A (en) * | 2017-11-15 | 2018-02-16 | 西安交通大学 | The protein marker and method of examination medicine anaphylactoid reaction sensitive group |
| CN108398517A (en) * | 2018-02-11 | 2018-08-14 | 湖南正清制药集团股份有限公司 | A kind of method of potential Allergen in screening Zhengqingfengtongning preparation |
| CN109765324A (en) * | 2018-11-27 | 2019-05-17 | 苏州科技大学 | A kind of screening technique of MEK1 albumen potential inhibitor |
| CN109765324B (en) * | 2018-11-27 | 2021-03-30 | 苏州科技大学 | Screening method of MEK1 protein potential inhibitor |
| CN110229227A (en) * | 2019-05-31 | 2019-09-13 | 西安交通大学 | It is a kind of be used to prepare ELISA murine monoclonal coated antibody and rabbit polyclonal detection antibody polypeptide and its application |
| CN110229228A (en) * | 2019-05-31 | 2019-09-13 | 西安交通大学 | The polypeptide with immunogenicity of a kind of pair of anaphylactoid reaction specific receptor MRGPRX2 albumen and its application |
| CN110204607A (en) * | 2019-05-31 | 2019-09-06 | 西安交通大学 | A kind of dominant antigen epitope polypeptide of anti-Mrgprx2 antibody and its application |
| CN110240643A (en) * | 2019-05-31 | 2019-09-17 | 西安交通大学 | A kind of double antibodies sandwich kit being used to prepare anaphylactoid reaction matches polypeptide and its application of antibody |
| CN110204606A (en) * | 2019-05-31 | 2019-09-06 | 西安交通大学 | A kind of polypeptide being used to prepare rabbit polyclonal antibody and its application |
| CN110204607B (en) * | 2019-05-31 | 2021-04-20 | 西安交通大学 | Dominant antigen epitope polypeptide of anti-Mrgprx 2 antibody and application thereof |
| CN110204606B (en) * | 2019-05-31 | 2021-04-20 | 西安交通大学 | Polypeptide for preparing rabbit polyclonal antibody and application thereof |
| CN116855503A (en) * | 2023-08-30 | 2023-10-10 | 上海益诺思生物技术股份有限公司 | Stable transgenic cell strain over-expressing MRGPRX2 and construction method and application thereof |
| CN116855503B (en) * | 2023-08-30 | 2023-12-08 | 上海益诺思生物技术股份有限公司 | Stable transgenic cell strain over-expressing MRGPRX2 and construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754731B (en) | 2019-10-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106754731B (en) | The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application | |
| CN104814984A (en) | Applications of alphavirus in preparation of anti-tumor drugs | |
| CN103333858B (en) | Gleevec-resistant gastrointestinal stromal tumor cell line, method thereof, and nude mouse transplantation tumor model thereof | |
| CN104818334A (en) | Tiny RNA related to lung adenocarcinoma metastasis | |
| CN105950628A (en) | Long non-coding RNA (Ribose Nucleic Acid) and application thereof to diagnosis/treatment of non-small-cell lung cancer | |
| CN108004322A (en) | A kind of applications of lncRNA in adenocarcinoma of lung is diagnosed and/or treated | |
| CN108277279A (en) | A kind of application of lncRNA in diagnosing and/or treating breast cancer | |
| CN106929577A (en) | A kind of lncRNA biomarker related to adenocarcinoma of lung | |
| CN103920164B (en) | MiR-424-5p is suppressing the application in secondary liver cancer | |
| CN105039342A (en) | siRNA capable of inhibiting MAT2A genetic expression and application of siRNA | |
| CN108085389A (en) | A kind of and the relevant lncRNA of breast cancer and its application | |
| CN110283912A (en) | Application of the has-miR-3656 as esophageal squamous cell carcinoma molecular marker | |
| CN109953998A (en) | EPS8L1 gene is inhibiting the application in treatment of ovarian cancer | |
| CN105602989B (en) | A kind of recombinant vector and its application in preparation or screening Tamiflu | |
| CN103695427B (en) | Small interfering RNA (Ribonucleic Acid) and recombinant vector for knocking down VPS11 (Vacuolar Protein Sorting-Associated Protein 11), and application of small interfering RNA and recombinant vector | |
| CN108118061A (en) | Epinephelus coioides innate immunity receptor TLR22 genes and its carrier for expression of eukaryon and application | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| CN104450710B (en) | Inhibit nucleic acid oligomer and its application of MYD88 genes | |
| CN106636444A (en) | Application of FAM78A gene | |
| CN105985961A (en) | SiRNA for inhibiting EGFR gene expression and application thereof | |
| CN106702002A (en) | Biomarker for lung adenocarcinoma diagnosis and treatment | |
| CN110468210A (en) | CDC45 is as glioblast tumor markers and its as the application of therapy target | |
| CN106868197B (en) | Application of the gene marker in Huppert's disease | |
| CN103667295B (en) | siRNA for FOXC1 gene expression inhibition, and application thereof | |
| CN104342440A (en) | CDKL1 gene, siRNA thereof, and applications of gene and siRNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |