CN108004322A - A kind of applications of lncRNA in adenocarcinoma of lung is diagnosed and/or treated - Google Patents
A kind of applications of lncRNA in adenocarcinoma of lung is diagnosed and/or treated Download PDFInfo
- Publication number
- CN108004322A CN108004322A CN201711397060.1A CN201711397060A CN108004322A CN 108004322 A CN108004322 A CN 108004322A CN 201711397060 A CN201711397060 A CN 201711397060A CN 108004322 A CN108004322 A CN 108004322A
- Authority
- CN
- China
- Prior art keywords
- lung
- adenocarcinoma
- cell
- lncrna
- pharmaceutical composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Pathology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Hospice & Palliative Care (AREA)
- Biotechnology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention belongs to biology field, and in particular to a kind of lncRNA adenocarcinomas of lung marker and knock out its application in adenocarcinoma of lung is treated.The lncRNA is AC009948.5, and as shown in SEQ ID NO.1, which has in lung adenocarcinoma cell obviously raises its nucleotide sequence, can aid in the examination for adenocarcinoma of lung.In addition, present invention discover that the invasion and attack, transfer and propagation of lung adenocarcinoma cell can effectively be suppressed by knocking out the lncRNA, available for treating adenocarcinoma of lung.
Description
Technical field
The invention belongs to biology field, and in particular to a kind of lncRNA is in adenocarcinoma of lung is diagnosed and/or treated
Using.
Background technology
The death rate of lung cancer worldwide occupy the first.At present in China, the incidence of lung cancer is in what is risen year by year
Trend.Lung cancer can be divided into Small Cell Lung Cancer and non-small cell lung cancer (non-small cell according to the difference of clinicopathologic pattern
Lung cancer, NSCLC) two classes.Wherein, non-small cell lung cancer is most common in lung cancer, accounts for 85% in lung cancer, lung gland
Cancer is wherein most important part again.For non-small cell lung cancer, operative treatment is still the first choice of clinical treatment, for
The Patients with Non-small-cell Lung (I and II phases, and comparatively ideal IIIA phases patient) of early stage, radical resection of pulmonary carcinoma is still primary
Treatment method.Pertinent literature reports that IIIA phase patient survival rates are apparently higher than non-operative treatment group.For losing lung cancer
For the patients with terminal on radical operation opportunity, treatment should be based on chemotherapy.In recent years, as accurate radiotherapy technology develops, lead to
Cross reduction radiotherapy number, increase the dosage of single radiotherapy, the effect of radiotherapy is greatly improved.
RNA can be divided into mRNA (mRNA), transfer RNA (tRNA) and rRNA according to classical taxonomy method.Except this
Outside, according to whether can have the function of that encoding proteins can be divided into coding RNA and non-coding RNA (non-coding RNA).It is early
Phase, research of the people for RNA is only limitted to coding RNA, but is found by research, and part RNA only accounts for the 1% of genome, remains
Under be non-coding RNA.Then, the excavation for non-coding RNA function becomes the weight of scientists concern in recent years
Point.And ncRNA according to the number of contained base quantity can be divided into small molecule non-coding RNA (miRNA, microRNA) and
Long-chain non-coding RNA (lncRNA, long non-coding RNA).Wherein, miRNA has taken by research these years
Significant progress was obtained, the new drug that some miRNA have become neoplasm targeted therapy applies to clinic.But the research of lncRNA
The starting stage just is at present, in this field, also very big blank needs researcher to go to fill up.
In these years, in the various tumours of the mankind, the lncRNA for constantly having new unconventionality expression is mined.From current
From the point of view of research, during effects of the lncRNA in tumour runs through the whole occurrence and development of tumour.Both can be to cancer cell
Cycle, apoptosis, transfer etc. have an impact, also can in the aspect of epigenetic macro adjustments and controls tumour cell many features.
The occurrence and development of lncRNA and tumour have important relationship, therefore the lncRNA that screening can be effectively used for treatment tumour has weight
The meaning wanted.
The content of the invention
One of main purpose of the present invention, there is provided a kind of kit for diagnosing adenocarcinoma of lung, can be such that patient is accurately examined
It is disconnected.
The two of the object of the invention, there is provided a kind for the treatment of means and drug regimen for treating adenocarcinoma of lung, realize adenocarcinoma of lung molecule
Horizontal accurate treatment.
To achieve these goals, the present invention adopts the following technical scheme that：
Reagent the present invention provides detection AC009948.5 expressions is preparing the use in diagnosing adenocarcinoma of lung kit
On the way.
Further, AC009948.5 up-regulated expressions in patients with lung adenocarcinoma.
The present invention provides a kind of kit for diagnosing adenocarcinoma of lung, the kit includes that AC009948.5 can be detected
The PCR reaction reagents of expression.
Further, the PCR reaction reagents include the primer of amplifiable AC009948.5cDNA, the amplification
The primer sequence of AC009948.5cDNA is as shown in SEQ ID NO.2~3.
The present invention provides a kind of purposes of AC009948.5, is used to prepare prevention or treats the drug regimen of adenocarcinoma of lung
Thing.
Further, described pharmaceutical composition includes the inhibitor of AC009948.5 functional expressions, and the inhibitor can
Suppress AC009948.5 or be related to the material expression of AC009948.5 upstreams or downstream pathway.
Further, the inhibitor is the RNAi for AC009948.5.
Further, the RNAi, its shRNA sequence is as shown in SEQ ID NO.4.
The present invention provides a kind of pharmaceutical composition, described pharmaceutical composition includes AC009948.5 functional expressions
Inhibitor, the inhibitor can work on DNA level or rna level.
Further, described pharmaceutical composition is further included and other medicine classes of the inhibitor compatibility and can pharmaceutically connect
The carrier and/or auxiliary material received.
Further, the carrier includes (but being not limited to)：Diluent, excipient such as lactose, sodium chloride, glucose, urine
Element, starch, water etc., filler such as starch, sucrose etc.；Adhesive such as simple syrup, glucose solution, starch solution, cellulose spread out
Biology, alginates, gelatin and polyvinylpyrrolidone；Wetting agent such as glycerine；Disintegrant such as dried starch, sodium alginate, kelp are more
Icing Sugar end, agar powder, calcium carbonate and sodium acid carbonate；Sorbefacient quaternary ammonium compound, lauryl sodium sulfate etc.；Surface
Activating agent such as polyoxyethylene sorbitan fatty acid ester, lauryl sodium sulfate, glyceryl monostearate, hexadecanol etc.；
Humectant such as glycerine, starch etc.；Absorption carrier such as starch, lactose, bentonite, silica gel, kaolin and soap clay etc.；Lubricant
Such as talcum powder, calcium stearate and magnesium, polyethylene glycol, boric acid powder.
LncRNA-AC009948.5 is located at No. 2 chromosomes, and RNA length is 740bp, seqname AC009948.5.This
Inventive technique personnel by fluorescence quantitative PCR detection normal pulmonary epithelial cells BEAS-2B and lung adenocarcinoma cell H1299,
The expression of lncRNA-AC009948.5 in A549, SPC-A1, the results show that with normal pulmonary epithelial cells BEAS-2B phases
Than expression of the lncRNA-AC009948.5 in lung adenocarcinoma cell is substantially raised, and therefore, detects AC009948.5 expressions
Can be used for diagnose adenocarcinoma of lung.
For invention technician by further studying, discovery is transferred to lncRNA-AC009948.5 inhibitor RNAi can be with
Effectively suppress migration, invasion and attack and the multiplication capacity of lung adenocarcinoma cell.
Figure of description
Fig. 1 is fluorescence quantitative PCR detection lncRNA-AC009948.5 in normal pulmonary epithelial cells BEAS-2B and lung gland
Expression in cancer cell H1299, A549, SPC-A1.
Fig. 2 is GV248 slow virus infected cell efficiency charts.
Fig. 3 is the transfer ability of cell before and after wound healing assay detection infection.
Fig. 4 is the invasive ability of cell before and after the detection infection of Transwell Cell migration assays.
Fig. 5 is the multiplication capacity of cell before and after CCK-8 detection infection.
Fig. 6 shows the tumor nodule number for being transferred to lung for results of animal.
Fig. 7 is the change for the weight that results of animal shows tumour.
Embodiment
It is noted that described further below be all exemplary, it is intended to provides further instruction to the present invention.Unless
Otherwise indicated, all technical and scientific terms used herein has and general technical staff of the technical field of the invention
Normally understood identical meanings.
It should be noted that term used herein above is merely to describe embodiment, and be not intended to restricted root
According to the illustrative embodiments of the present invention.As used herein, unless the context clearly indicates otherwise, otherwise odd number shape
Formula is also intended to include plural form, additionally, it should be understood that, when in the present specification use term "comprising" and/or
During " comprising ", it indicates existing characteristics, step, operation, component and/or combinations thereof.
In order to enable those skilled in the art can clearly understand technical scheme, below with reference to
The specific embodiment technical solution that the present invention will be described in detail.
Embodiment 1
(1) with the total serum IgE in the Trizol extraction cells of Invitrogen.
(1) nutrient solution of cell to be measured in 6 orifice plates is exhausted, cell adds 1ml Trizol, makes its covering culture cell,
Blown and beaten 2-3 times with suction pipe or sample injector again, cell should crack completely, be then transferred in centrifuge tube.
(2) chloroform (the 1mL Trizol 0.2 mL chlorine of addition of 0.2 times of volume is added in the centrifuge tube equipped with lysate
It is imitative), on oscillator fully vibration mix 30 seconds, room temperature is placed 2-3 minutes.4 DEG C of 12000g is centrifuged 10 minutes, is then drawn and is contained
For the upper strata aqueous phase of total serum IgE into a new centrifuge tube, every milliliter of Trizol can about draw 0.5-0.6mL.Organic phase and intermediate layer
Containing DNA and protein, should avoid touching.
(3) 0.5mL isopropanols are added by every milliliter of Trizol, reverse to mix for several times, precipitation at room temperature 10 minutes.12000g
4 DEG C centrifuge 10 minutes, in the visible RNA precipitate of tube bottom.Supernatant is abandoned, 75% ethanol of 1mL is added by every milliliter of Trizol, gently runs
Mix, to clean RNA precipitate.4 DEG C of 12000g is centrifuged 2 minutes, is discarded liquid, is not abandoned RNA precipitate carefully.Room temperature is inverted
Dry 5-10 minutes.
(4) dissolve：Adding appropriate DEPC processing water dissolves RNA precipitate.Deposit in -80 DEG C.
(2) the first chain cDNA is synthesized using M-MLV reverse transcriptases.Synthesis reagent and condition are as shown in table 1 below：
1 reverse transcription condition of table
70 DEG C of 5min place 5min on ice
37℃ 60min 95℃5min
(3) with lncRNA-AC009948.5 in the SYBR Green PCR kit for fluorescence quantitative detection cell of Bio-Rad
Expression quantity.With 2–△△CTMethod calculates the relative expression quantity of lncRNA-AC009948.5.AC009948.5 primer sequences are as follows：
forward primer：5 '-AAAGCAGGAACGAGTAGCGG-3 ', as shown in SEQ ID NO.2, reverse primer：
5 '-AAGGCAGCTCCTTTCAGACA-3 ', as shown in SEQ ID NO.3.GAPDH is as internal reference.
Normal pulmonary epithelial cells BEAS-2B and lung adenocarcinoma cell H1299, A549, SPC-A1 are detected by the above method
The expression of middle lncRNA-AC009948.5, the results are shown in Figure 1；As shown in Figure 1, with normal pulmonary epithelial cells BEAS-
2B is compared, and expression of the lncRNA-AC009948.5 in lung adenocarcinoma cell is substantially raised, and in high aggressive cell H1299
In expression quantity highest, the expression quantity in low aggressive cell SPC-A1 is minimum.
Embodiment 2
With shRNA slow-virus infection lung adenocarcinoma cell H1299, to knock out the lncRNA-AC009948.5 in cell, and
The cell line for stablizing expression shRNA is filtered out, the H1299 cells of infection RNAi slow virus are known as SiAC009948.5/H1299,
Infection control slow virus H1299 cells are known as Scr/H1299.
LncRNA-AC009948.5shRNA slow virus customizes for Shanghai Ji Kai genome companies, container name GV248.
ShRNA sequences are TACCTTGCCTCATTGAGTAAT, as shown in SEQ ID NO.4.
The screening technique of the cell line of the stable expression shRNA is：ShRNA slow virus is stayed overnight into infection cell, then
Replace fresh culture, when culture 48-72 is small after, GFP positive cell ratios are observed, to determine viral efficiency of infection；Viral band
Puromycin screen resistance, 72 it is small when after, add 2 μ g/mL puromycins screened；GFP positive rates are more than 90% or fast
Cell after the screening of purine mycin can be considered shRNA stable expression cell strains.
Embodiment 3
The transfer ability that cell is carried out using wound healing assay is detected, experimental procedure：By SiAC009948.5/H1299
Cell and Scr/H1299 cells are layered in the culture dish of 35mm, and growth two days later, removes cellar culture liquid, changes into containing 1% tire
The nutrient solution of cow's serum.Uniform cut is marked in culture dish bottom with 10 μ L pipette tips, randomly selects three under an optical microscope
The width of a fixed position record cut.The change of cell migration ability is judged according to the change of scratch width.Experiment repeats three
It is secondary, with the area of ImageJ statistics cell cuts.As described in Figure 3, knocking out lncRNA-AC009948.5 can be obvious for experimental result
Suppress the transfer ability of H1299 cells.
Embodiment 4
Transwell Matrigels comprise the following steps that：Transwell culture plates prepare to be both needed to sterile working. -20℃
The Matrigel 2-8 DEG C of preservation melt overnight.The Matrigel addition ice precoolings of 100 μ L are drawn using the pipette tips of precooling on ice
300 μ L serum free mediums in, be uniformly mixed.Above-mentioned 25 μ L of diluted Matrigel are taken to add Transwell plate upper chambers,
The whole poly- carbon ester film of covering, 37 DEG C are placed 30 minutes, Matrigel is polymerize plastic.Each group cell is rinsed 3 times with PBS.With normal
Rule method prepares single cell suspension with serum free medium.100 μ L cell suspensions are added in Transwell culture plate upper chambers simultaneously
Add 200 μ L of serum free medium.37 DEG C, 5%CO2Cultivate 24 it is small when.With wet cotton swab gently wipe Matrigel gels and
The cell of poly- carbon ester film upper surface.Ice-cold methanol fixes cell 15 minutes.Giemsa staining 30 minutes, PBS cleaning three
Time, three visuals field are randomly selected under mirror take pictures and be averaged.Experimental result is as shown in Fig. 4.The result shows that knock out LncRNA-
AC009948.5 can substantially suppress the invasive ability of H1299 cells.
Embodiment 5
(1) cell suspension of 100 μ L is configured in 96 orifice plates.By culture plate when incubator preculture 24 is small (37
DEG C, 5%CO2Under conditions of).
(2) test substance of 10 μ L various concentrations is added to culture plate.One section of reasonable time is incubated in incubator.
(3) 10 μ L CCK-8 solution are added to every hole (to be careful not to generate bubble in hole, they can influence OD values
Reading).Fresh culture is replaced before CCK-8 is added (to remove culture medium, and cell is washed twice with culture medium, then add
New culture medium).
(4) culture plate is incubated in incubator 1-4 it is small when.
(5) absorbance with microplate reader measure at 450nm, draws OD values.
Experimental result is as shown in figure 5, as shown in Figure 5, knock out the increasing that lncRNA-AC009948.5 can inhibit H1299 cells
Grow ability.
Embodiment 6
SCID mouse are subcutaneously tested into knurl：Surely turn SiAC009948.5/H1299 and Scr/H1299 cells difference after taking infection
0.1mL (1 × 10 is injected in SCID mouse oxter6) a cell, establish SCID mouse subcutaneous transplantation knurl models, routine observation nude mice skin
Lower tumour growth situation of change, and SCID mouse were put to death after 8 weeks, cut off subcutaneous tumor and lung tissue counts the number weight of tumour
The tubercle of amount and lung simultaneously does the transfer case of HE sections observation adenocarcinomas of lung.
Experimental result is as shown in Figure 6, Figure 7.Understand that injection knocks out the H1299 of lncRNA-AC009948.5 by Fig. 6, Fig. 7
The size and quantity and Lung metastases tubercle quantity of the mouse subcutaneous tumor of cell are considerably less than the mouse for injecting control cell.
SEQUENCE LISTING
<110>Weifang Medical College
<120>A kind of applications of lncRNA in adenocarcinoma of lung is diagnosed and/or treated
<130>
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 490
<212> RNA
<213> lncRNA-AC009948.5
<400> 1
cgcggugauu uaacagcuuu uguuuugggc agaagaaccu augggcacaa aaagcaggaa 60
cgaguagcgg uggcugaaga acgagcagga gcuugaauuu caguuuucuu augaggaauu 120
uuccagaaaa gauaucuuca cugugaaaua acuaaauaaa ugcccacuca guacaacagu 180
gccgauguaa uaguaacaaa aagucucagc cucauuuaag auaaaaggcc aucaucagac 240
aaugcaggac agauuguaac aauaggaagu acuacagaga uucagagaau gccauaaaua 300
accuuggaau ccugugcuug guuuuguucu caaagaauuc cagauaugau uuuuuuccag 360
acaaaaauac cugcuacaug cuuccuucug uaugaauaca ugagaccuac cuucauucau 420
guuuccucua ugaagcuuuc ccugcacucc aaacacagag cugagacuuc caccuaaugu 480
agaaagcuag 490
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
aaagcaggaa cgagtagcgg 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
aaggcagctc ctttcagaca 20
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence
<400> 4
taccttgcct cattgagtaa t 21
Claims (10)
1. the reagent for detecting AC009948.5 expressions is preparing the purposes in diagnosing adenocarcinoma of lung kit.
2. purposes according to claim 1, it is characterised in that on the AC009948.5 is expressed in patients with lung adenocarcinoma
Adjust.
3. a kind of kit for diagnosing adenocarcinoma of lung, it is characterised in that the kit includes that AC009948.5 expression can be detected
Horizontal PCR reaction reagents.
4. kit according to claim 3, it is characterised in that the PCR reaction reagents include amplifiable
The primer of AC009948.5cDNA, the primer sequence of the amplification AC009948.5cDNA is as shown in SEQ ID NO.2~3.
5. a kind of purposes of AC009948.5, it is characterised in that be used to prepare prevention or treat the pharmaceutical composition of adenocarcinoma of lung.
6. purposes according to claim 5, it is characterised in that described pharmaceutical composition includes AC009948.5 feature tables
The inhibitor reached.
7. purposes according to claim 6, it is characterised in that the inhibitor is the RNAi for AC009948.5.
8. purposes according to claim 7, it is characterised in that the RNAi, its shRNA sequence such as SEQ ID NO.4 institutes
Show.
9. a kind of pharmaceutical composition, it is characterised in that described pharmaceutical composition includes the suppression of AC009948.5 functional expressions
Agent.
10. pharmaceutical composition according to claim 8, it is characterised in that described pharmaceutical composition further includes and the suppression
Other medicine classes and pharmaceutically acceptable carrier and/or auxiliary material of preparation compatibility.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711397060.1A CN108004322B (en) | 2017-12-21 | 2017-12-21 | Application of lncRNA in diagnosis and/or treatment of lung adenocarcinoma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711397060.1A CN108004322B (en) | 2017-12-21 | 2017-12-21 | Application of lncRNA in diagnosis and/or treatment of lung adenocarcinoma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108004322A true CN108004322A (en) | 2018-05-08 |
| CN108004322B CN108004322B (en) | 2020-04-03 |
Family
ID=62060483
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711397060.1A Active CN108004322B (en) | 2017-12-21 | 2017-12-21 | Application of lncRNA in diagnosis and/or treatment of lung adenocarcinoma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108004322B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108998528A (en) * | 2018-08-27 | 2018-12-14 | 中山大学 | Pulmonary cancer diagnosis molecular marked compound lncRNA LINC00516 and kit and its application |
| CN109055556A (en) * | 2018-08-27 | 2018-12-21 | 中山大学 | A kind of lncRNA detection kit and its application for diagnosing transfer |
| CN110093422A (en) * | 2019-05-24 | 2019-08-06 | 中国人民解放军西部战区总医院 | Application of the LINC02159 in adenocarcinoma of lung diagnosis and treatment |
| CN110106252A (en) * | 2019-06-19 | 2019-08-09 | 济宁市第一人民医院 | Cancer diagnosis molecular marker |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106282347A (en) * | 2016-08-17 | 2017-01-04 | 中南大学 | HoxC11 as biomarker preparation adenocarcinoma of lung pre-diagnostic reagent in application |
| CN107190052A (en) * | 2017-01-25 | 2017-09-22 | 河北医科大学第四医院（河北省肿瘤医院） | The purposes of LOC101928926 genes |
-
2017
- 2017-12-21 CN CN201711397060.1A patent/CN108004322B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106282347A (en) * | 2016-08-17 | 2017-01-04 | 中南大学 | HoxC11 as biomarker preparation adenocarcinoma of lung pre-diagnostic reagent in application |
| CN107190052A (en) * | 2017-01-25 | 2017-09-22 | 河北医科大学第四医院（河北省肿瘤医院） | The purposes of LOC101928926 genes |
Non-Patent Citations (2)
| Title |
|---|
| SHUANG YANG等: "Construction of differential mRNA-lncRNA crosstalk networks based on ceRNA hypothesis uncover key roles of lncRNAs implicated in esophageal squamous cell carcinoma", 《ONCOTARGET》 * |
| 杨泽天: "长链非编码RNA ZXF2在肺腺癌中的表达及对细胞生长的影响", 《中国博士学位论文全文数据库 医药卫生科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108998528A (en) * | 2018-08-27 | 2018-12-14 | 中山大学 | Pulmonary cancer diagnosis molecular marked compound lncRNA LINC00516 and kit and its application |
| CN109055556A (en) * | 2018-08-27 | 2018-12-21 | 中山大学 | A kind of lncRNA detection kit and its application for diagnosing transfer |
| CN110093422A (en) * | 2019-05-24 | 2019-08-06 | 中国人民解放军西部战区总医院 | Application of the LINC02159 in adenocarcinoma of lung diagnosis and treatment |
| CN110106252A (en) * | 2019-06-19 | 2019-08-09 | 济宁市第一人民医院 | Cancer diagnosis molecular marker |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108004322B (en) | 2020-04-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wong et al. | The microRNA miR-139 suppresses metastasis and progression of hepatocellular carcinoma by down-regulating Rho-kinase 2 | |
| Zhou et al. | miR-503 regulates metastatic function through Rho guanine nucleotide exchanger factor 19 in hepatocellular carcinoma | |
| CN108004322A (en) | A kind of applications of lncRNA in adenocarcinoma of lung is diagnosed and/or treated | |
| TW201615202A (en) | Use of alphavirus for preparing anti-cancer drug | |
| CN107586781B (en) | Liver cancer marker lncRNA ENST00000620463.1 and application thereof | |
| CN108277279A (en) | A kind of application of lncRNA in diagnosing and/or treating breast cancer | |
| CN105524924A (en) | Cyclic RNA circ-ZKSCAN1 use | |
| CN108486060A (en) | It is a kind of to be used to treat excretion body of tumour and its preparation method and application | |
| CN108374048A (en) | A kind of lncRNA markers for diagnosing and treating hepatocellular carcinoma | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| CN109055561A (en) | LncRNA-AP003774.1 is diagnosing and/or treating the application in breast cancers | |
| CN109750104A (en) | Application of the ABHD6 in Diagnosis of Non-Small Cell Lung, prognosis, treatment product | |
| CN104726584A (en) | Application of miR-425 in tumor diagnosis, treatment and prognosis | |
| CN110283912A (en) | Application of the has-miR-3656 as esophageal squamous cell carcinoma molecular marker | |
| CN107164528B (en) | Application of non-coding gene related to liver cancer occurrence and development | |
| CN106995857B (en) | Application of biomarker ENSG00000267416 in cancer | |
| CN111424082A (en) | Application of lncRNA-SNHG6 gene in preparation of medicine for treating osteosarcoma | |
| CN110628791B (en) | Application of tRNA (transfer RNA) modified enzyme gene in non-small cell lung cancer | |
| CN106974929A (en) | Purposes of the miR 647 in the medicine for preparing treatment stomach cancer | |
| CN111635941A (en) | Detection kit for SDPR gene expression and/or SDPR gene methylation level and application | |
| CN105582536B (en) | Application of AGPAT9 gene in preparation of liver cancer treatment drug and diagnosis and prognosis evaluation reagent | |
| CN111407758A (en) | Application of cantharidin as miR-214-3p/Wnt/β -Catenin signal pathway inhibitor in preventing and treating osteosarcoma | |
| CN103667295B (en) | siRNA for FOXC1 gene expression inhibition, and application thereof | |
| CN110042164A (en) | Lung cancer diagnosis and treatment lncRNA marker | |
| CN108624689A (en) | The application of biomarker LINC01451 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder |
Address after: 261056 Shandong Province, Weifang city Weicheng District Baotong Street No. 7166 Patentee after: WEIFANG MEDICAL University Address before: 261053 No. 288 Shengli East Street, Kuiwei District, Shandong, Weifang Patentee before: WEIFANG MEDICAL University |
|
| CP02 | Change in the address of a patent holder |