CN105950628A

CN105950628A - Long non-coding RNA (Ribose Nucleic Acid) and application thereof to diagnosis/treatment of non-small-cell lung cancer

Info

Publication number: CN105950628A
Application number: CN201610547496.3A
Authority: CN
Inventors: 刘志利; 茅卫东; 王赛花; 姜彬
Original assignee: Jiangyin Peoples Hospital
Current assignee: Jiangyin Peoples Hospital
Priority date: 2016-07-12
Filing date: 2016-07-12
Publication date: 2016-09-21

Abstract

The invention belongs to the field of gene engineering, and particularly relates to application of LINC00961 to prediction of non-small-cell lung cancer (NSCLC) prognosis and treatment of target spot medicine. In the NSCLC, down-regulation of the LINC00961 is closely related to clinical stages and tumor sizes, and is closely related to patient prognosis at the same time. The invasion, migration and the like of NSCLC cells are influenced by changing expression of the LINC00961, so that the LINC00961 expression is enhanced, and the invasion and migration of the NSCLC cells can be restrained.

Description

A kind of long non-coding RNA and the application in diagnosis/treatment nonsmall-cell lung cancer thereof

Technical field

The invention belongs to genetic engineering field, particularly to a kind of long non-coding RNA and at diagnosis/treatment non-small cell Application in pulmonary carcinoma.

Background technology

Pulmonary carcinoma is the modal reason of tumor associated death in world wide, and wherein nonsmall-cell lung cancer (NSCLC) is about Account for the 80%-85% of all of cases of lung cancer.Adenocarcinoma of lung (LUAD) and squamous cell lung carcinoma (LUSC) are nonsmall-cell lung cancers Two kinds of principal modes.Although have latest developments in clinical treatment nonsmall-cell lung cancer, but the existence of Patients with Non-small-cell Lung Rate remains disappointed.Therefore, the pathogeny of nonsmall-cell lung cancer and molecular mechanism it are best understood to non-small cell The diagnosis of pulmonary carcinoma and treat most important.

Recently, substantial amounts of proto-oncogene and antioncogene the most identified out as NSCLC tumor occur and development Key regulatory person.Except protein coding gene, lncRNA also becomes the key molecule of NSCLC Related Research Domain.LncRNA's Length more than 200nt, protein coding limited in one's ability, it is well known that lncRNA regulates and controls gene expression in multiple levels, bag Include chromatin to modify, transcribe and transcribe post-treatment.In addition, it has been reported that the imbalance going out lncRNA can change varied Cell biological processes and cause various human diseases, particularly cancer.Evidence shows, lncRNA is at nonsmall-cell lung cancer Occur evolution plays an important role.Such as, the low expression of lncRNA PANDAR imply that NSCLC poor prognosis, And affect apoptosis by regulation and control Bcl-2.In NSCLC, LSD1 is passed through in the rise of intergenic long non-coding RNA 00673 Interact and the suppression of NCALD promotes tumor proliferation.Obviously, several molecules of lncRNAs in nonsmall-cell lung cancer Mechanism had been discussed in detail, but the overall Pathophysiology of NSCLC is contributed and the most still failed to understand by lncRNAs.

In view of lncRNAs importance in NSCLC, we have probed into intergenic non-protein coding RNA 961 (LINC00961), by TCGA RNA sequence data analysis and the detection of qPCR, compared with normal adjacent tissue, LINC00961 Substantially reduce at Non-Small Cell Lung Carcinoma.We have further found that, in NSCLC, LINC00961's lowers with bigger Gross tumor volume is relevant with higher clinical stages；LINC00961 patient's prognosis of low expression is relatively poor.Noticeable It is that LINC00961 is suppressed by histone demethylase LSD1 epigenetic.And, functional experiment shows dystopy process LAN LINC00961 can suppress NSCLC cell invasion and transfer, and part is realized by regulation and control β-catenin expression, but right NSCLC cell proliferation does not affect.Research shows, LINC00961 is suppression regulation and control of non-developing small cell lung cancer mechanism Person, and promote the development of diagnosis and the treatment mediated by lncRNA.

Summary of the invention

It is an object of the invention to provide for diagnosing non-small cell lung cancer (NSCLC) prognosis situation or as treatment non-little carefully The non-protein coding RNA 961 (LINC00961) of born of the same parents' lung-cancer medicament target spot, its nucleotides sequence is classified as SEQ ID NO.1,

SEQ ID NO.1:

AACCAGGACAGAGGCTGCAGCACCCAGGGAGGAACGCCGTGGTCCCTGGGACGGCCACCAGGCCAGGAG GCTGCAGCACCAGGGAATCTGTGCTCACGTCTTCCAGGACAGTGCTTCTTCTAGAAGCTGACATGGAGCTGACCACA GCTCTTGGAGGCATGGCCTGAGGCTTAGAAAATAGACAGAGATCATCTGAGATTTCAGCAGTGGGGCCACGTGGCAG CGCCCGAAGGCCTGGAGCAGGAGCGACCCAGGGACTCAGAGCAGCATCTTCTTAGGAGACGGAAGGAGAGCCGCCGG AGGAGCACGGGGCACCTGCGATCGCGAAGAGCCTCCTGTTCTGGATGGGAGCGAAGGCTCCGAGAGGACCTAAGGTT GCTCAGTGGGCCATGGAAACGGCAGTGATTGGGGTGGTGGTGGTGCTGTTCGTGGTGACTGTGGCCATCACCTGCGT CCTCTGCTGCTTCAGCTGTGACTCAAGGGCCCAGGATCCTCAGGGGGGTCCTGGCCGCAGCTTCACGGTGGCCACGT TTCGCCAGGAAGCTTCTCTCTTCACGGGGCCTGTTCGCCATGCCCAGCCAGTGCCAAGTGCCCAGGACTTCTGGACC TTCATGTGACGCCCGAGTCCCCAGGATTTGCTGTGCTGATGGGTCAGACTCACCCGCTCCTCAGCAAGCCTTCCCTG GCCTTCCCCTCCTCCCAGGGCCTTCTCCCTGTCCTTCCCCTCCAGTAACCTGTGAACTTCCCGTCTCCTCCCATTCC AGCCTTCTGTGCCCTCCAGCCTCAGGGATCCTTGTTATTGGGACAGCCCAGCTGGGGTTGACCCACAGGATGGGGCT TAGGAGAGCTCTGAGGAGTGAGTGAACAGACAGCGCCGGAGTGCACGGTGGGCCGGCTCTGCTGATCTACACCAGGA ACTGAAATATCACTGGAATTTATTGTAAACGGTGTGCCTATGATGCTGGTTCTGTTGCCACCTGGGCACGCAGCACC CTCAAGTGGACATTTCTAGAAACCGCTTCTTACTTGCTCCTAATTGATTACTTTTGCACATTGCACAGAACCCAACC TCGAGGCCTGCTCCCTGCCAGTTGCCTGAAATCAGCCCTGAAATTCTGAAACCAAAGAGCTGCTTCCTGAGAACAAG TTATTTACCTTAGAATTGAAAATGTATATCCTTTTATGGGCCTTTCCAAATCTGATTAGAAAAACCACAAAAGGAAA CAGAAGAGAAAATAAGAGCCACAGAAAGTACAATATGTTTTATTAACAGGAAAGCCAGAAATAAGATATTTTAAACA TATTTTTAATGAGACTTTATTGCTATATTCCAACAGGTCACTCCTATTCTTAGAGAATGTGAATGACTTGTGTCACT TCGGAGTGACAGAAAAATCAGGAACTGAAAGATAATTCCAGACAAGTTAAAATGTTATGTTACATTCAAAGCTCTTG TTTTCATCACAAATAAGGGGATATTCAGTTTTTATTAACAGAAAACCCATTCTCCCATGGCCATGGAATAAATGCCA TGCTATATTTAAGG

The invention still further relates to the label identifying described long non-coding RNA and judge that Treatment for Non-small Cell Lung is pre-in preparation Application in the diagnostic products of rear situation, described label includes but not limited to:

(1) long non-coding RNA described in the primer/primer sets of described long non-coding RNA or fluorescently-labeled combination is combined Primer/primer sets；

(2) micromolecular compound of described long non-coding RNA is combined；

(3) combining the biomacromolecule of described long non-coding RNA, described biomacromolecule includes but not limited to: antibody Or antibody functional fragment, fluorescently-labeled antibody or antibody functional fragment, rna binding protein or its function fragment, fluorescent labeling Rna binding protein or its function fragment.

Preferably, the nucleotide sequence of described primer sets or fluorescently-labeled primer sets such as SEQ ID NO:2 and SEQ Shown in ID NO:3,

Primer F (SEQ ID NO:2):

5 '-CTGTTCTGGATGGGAGCGAA-3 ',

Primer R (SEQ ID NO:3):

5’-ACAGTCACCACGAACAGCAC-3’。

The label that the invention still further relates to comprise the long non-coding RNA described in described identification for judging non-small cell The reagent of lung cancer therapy prognosis situation or test kit.

The invention still further relates to the label of the long non-coding RNA described in described identification or comprise the reagent of described label Or the application that test kit is in the treatment prognosis situation judging nonsmall-cell lung cancer.

The invention still further relates to the application in the medicine of preparation treatment nonsmall-cell lung cancer of the described long non-coding RNA；

The invention still further relates to described long non-coding RNA in the diagnosis judging nonsmall-cell lung cancer prognosis situation as screening Application in reagent.

The invention still further relates to described long non-coding RNA answering in the medicine as screening treatment nonsmall-cell lung cancer With.

Technical scheme

Tissue collecting

48 couples of NSCLC and corresponding neighbouring non-tumor sample are to obtain from patient, and these patients are to arrive in 2011 Between 2012, perform the operation in Southeast China University's medical college attached Jiangyin hospital and The Second Affiliated Hospital of Nanjing Medical University.All Case confirms as nonsmall-cell lung cancer according to Histopathology assessment.The clinicopathologic feature of Patients with Non-small-cell Lung is summed up At table 1.These patient's operation consent do not carry out local or the treatment of system.The quick-freezing immediately of the tissue samples of all collections is at liquid In nitrogen, and be stored in-80 DEG C standby.Southeast China University's medical college attached Jiangyin hospital has been passed through in our research and Nanjing medical courses in general are big Learn the research ethics committee of the second Affiliated Hospital.And from all of patient, obtain written informed consent.

Table 1 nonsmall-cell lung cancer patient LINC00961 expresses the relatedness between clinical pathological characteristic

* P < 0.05 is significant difference

Cell is cultivated

Five adenocarcinoma Lines (SPC-A1, A549, PC9, NCI-H1299, NCI-H1975), one Nonsmall-cell lung cancer squamous cell carcinoma line (SK-MES-1), and normal human bronchial's epithelial cell line (16HBE), these are to buy (Shanghai, China) from Chinese Academy of Sciences's biochemistry and Institute of Cell Biology.NCIH1299, NCI-H1975, SK-MES-1 and 16HBE cell is cultivated in RPMI 1640 culture medium；SPC-A1 and PC9 cell is with containing The hyclone of 10%, the DMEM culture medium of the streptomycin of 100U/ milliliter penicillin and 100 mg/ml is at 37 DEG C of 5%CO2 Cultivate.

RNA extracts and quantitative PCR analysis

According to the operation instruction of reagent, with Trizol reagent separation total serum IgE.Reverse transcription reaction application TaKaRa Prime Script test kit (TaKaRa, Dalian, China).Reverse Transcriptase kit carries out reverse transcription to 1 μ g total serum IgE, and final volume is 20 μ l.Interpretation of result: analyze specificity and the amplification efficiency of primer, judge the atopic of primer according to solubility curve.According to expansion Increase curve and obtain Ct value, use relative measurement and internal reference GAPDH to carry out genes of interest relative expression's quantitative analysis.Computing formula For: 2^ (-△ Ct), △ Ct=Ct gene-Ct control.

Plasmid construction

LINC00961 sequent synthesis cell clone are in pcDNA3.1 carrier.The dystopy process LAN of LINC00961 is logical Cross what pcDNA-LINC00961 transfection obtained, with an empty pcDNA carrier for comparison.QRT-PCR detection LINC00961's Expression.

Cell transfecting

According to operating instruction X-tremeGENE HP DNA transfection reagent transfected plasmids carrier (pcDNA3.1- LINC00961 and empty pcDNA carrier).SiRNA s si-EZH2 and si-LSD1 is transfected in A549 and PC9 cell. A549 and PC9 cell merges has expired and has just been inoculated in six orifice plates, then according to operating instruction, enters with Lipofectamine 2000 Row transfection.After transfecting 48 hours, collect cell, for qRT-PCR or immunoblotting assay.

Cell-proliferation activity detects

MTT experiment, the cell after processing is inoculated in 96 well culture plates by 2500, every hole cell.Treat that cell 80% is adherent After, cell synchronization 12h, discard original culture medium.Each sample arranges 6 multiple holes, and every hole total reaction volume is 200 μ l.Often Hole adds the MTT reactant liquor (5mg/ml is dissolved in PBS) of 20 μ l, and 37 DEG C of lucifuges hatch 4h.Abandoning supernatant, every hole adds 150 μ l Dimethyl sulfoxide (DMSO), shakes 10min, and microplate reader measures the absorbance at 490nm wavelength.

Cell migration and Matrigel

24 orifice plates are placed the Transwell cell of 8 μm pore sizes.Cell invasion is tested, and uses 50mg/l BD Matrigel 1:8 diluent is coated the face, upper room of Transwell cell bottom film, and the cell being coated is put in 24 orifice plates, incubated Case is hatched 2h.Peptic cell, is centrifuged after terminating digestion and discards culture fluid, wash 1-2 time with PBS, with the serum-free culture containing BSA Basic weight hangs.Adjust cell density to 1x10⁵.Obtained cell suspension 200 μ l adds Transwell cell.Under 24 orifice plates, room adds 500 The μ l culture medium containing 10%FBS, puts into cellar culture 24h in incubator.Cell migration assay, adjustment cell density to 1- 10x10⁴.Obtained cell suspension 200 μ l adds Transwell cell.Under 24 orifice plates, room adds the 500 μ l culture medium containing 10%FBS, Put into cellar culture 24h in incubator.Take cell, wipe matrigel and the cell of upper indoor with cotton swab, by 0.1% crystal violet by little The cell dyeing of outdoor bottom surface utilizes inverted microscope to clap the cell of the dyeing that side, Transwell cell counterdie upper and lower room is adhered to According to counting.

Immunoblotting assay and antibody

Cell protein pyrolysis product is separated by 10%SDS-PAGE, transfers to 0.22 μm NC film, uses specific antibody Hatch.Autoradiography densitometry thus be quantized.GAPDH antibody is used as comparison.E-cadherin, N- Cadherin, Vimentin, β-catenin antibody (1:1000) buys from CST company.

Chromatin imrnunoprecipitation

A549 with PC9 cell formaldehyde treated and hatch the most bell become DNA-protein cross.Cell lysates warp 200-300bp chromatin fragments is formed after supersound process.Antibody specific with LSD1 and H3K4me2 or IgG immunoprecipitation, IgG is as comparison.The chromatin dna precipitated can regain, and analyzes with qRT-PCR.

Data process

Experimental data all uses SPSS16.0 software analysis, represents with the meansigma methods ± standard error of three experiments, group difference With double tail Student ' s T inspection, rank test and X 2 test.DFS and OS analyzes and uses Kaplan-Meier method.Existence number According to also analyzing with single factor test and multifactor Cox proportional hazard model.Based on Cox regression analysis, p < 0.05 in single factor analysis Re-use multiplicity subsequently.Calculate double tail p value, choose the inspection level of a=0.05.

Accompanying drawing explanation

Fig. 1 .LINC00961 is down-regulated expression in NSCLC organizes, and closely related with patient's poor prognosis

1A, 1B:LINC00961 lower at NSCLC tissue expression compared with normal tissue；

The relative expression that 1C:LINC00961 compares with relative nonneoplastic tissue at NSCLC tissue (n=48) of people；

1D:LINC00961 express be divided into two groups of (E, F) Kaplan-Meier disease free survival and total survival curve according to LINC00961 expression * P < 0.05, * * P < 0.01.

Fig. 2 .LINC00961 impact on NSCLC cell proliferation

2A:NSCLC cell line (SPC-A1, A549, SK-MES-1, PC9, NCI-H1299, NCI-H1975) is with normal Bronchial epithelial cell system (16HBE) compares the situation of differential expression, when with normal bronchial epithelial cell system (16HBE) phase Ratio, LINC00961 expresses notable downward in A549 and PC9 cell；

2B:pcDNA-LINC00961 carrier and empty carrier are transfected into A549 and PC9 cell, analyze with qRT-PCR The result of the expression of LINC00961, shows in the cell of pcDNA-LINC00961 carrier transfection it is to raise；

2C:MTT experiment shows, compared with the cell of their pairing, the growth of A549 cell is not had by process LAN LINC00961 Have an impact；

2D:MTT experiment shows, compared with the cell of their pairing, process LAN LINC00961 is to A549 and PC9 cell Growth not impact.

Fig. 3 .Transwell cell the results show process LAN LINC00961 can suppress NSCLC cell invasion and move Move part

3A, 3B: process LAN LINC00961 can suppress invasion and attack and the transfer ability of A549 cell；

3C, 3D: process LAN LINC00961 can suppress invasion and attack and the transfer ability of A549 cell；

3E, 3F: process LAN LINC00961 can reduce the expression of β-catenin protein level；

Fig. 4 .QRT-PCR is used for detecting striking LINC00961 expression after low EZH2 or LSD1

4A, 4B:A549 and PC9 cell EZH2siRNAs process, QRT-PCR analyzes and shows to lower EZH2 pair LINC00961 expresses not impact；

4C, 4D: after A549 and PC9 cell lowers LSD1, the expression of LINC00961 rises on the contrary.

Fig. 5 .LINC00961 is that of LSD1 directly transcribes target spot at NSCLC cell

The H3K4me2 of LSD1 mediation modifies and plays a role in suppression LINC00961 expresses

5A, 5B:LSD1 can be bonded directly to LINC00961 promoter region and mediate H3K4me2 modification；

The downward that 5C, 5D:LSD1 express reduces LSD1 and combines and increase H3K4me2 modification.

Detailed description of the invention

The invention will be further elaborated by the following examples, but is not intended to the present invention.

General explanation:

In embodiment end indicate actual conditions experimental technique, be substantially all and write according to Sambrook, J et al. " Molecular Cloning: A Laboratory guide (the 3rd edition) " (MolecularCloning:ALaboratoryManual, 3rded. Huang training hall etc. Translate, Science Press .2002.8) described in condition and method or enter according to the condition proposed by material supplier and method OK, other technology being not described in is corresponding to the standard method known to for those skilled in the art being.

The material of the present invention: cell strain, slow virus interference carrier and the culture medium mentioned in the application all have commodity to supply Should or can be for public's gained with other approach, they are the most for example, are not unique to the present invention, can respectively with other be suitable for Instrument and biomaterial replace.

Embodiment 1 detects LINC00961 expression in tissue and cell

Take 0.1g tissue, liquid nitrogen grinding fully (powdered) or 1-5 × 10⁷Cell abandons culture medium, the PBS rinse of pre-cooling 2 times.Add the Trizol lysate of 1ml, without the piping and druming mixing of enzyme rifle head, to stand 5min, lysate to be moved into labelling in advance good 1.5ml without enzyme centrifuge tube in.4 DEG C of 7500g are centrifuged 5 minutes, take supernatant and add the chloroform of 1/5 volume, reverse mixing 30s, Stand 2min.4 DEG C, 12000g is centrifuged, 15min.Solution divides three layers (aqueous phase-white precipitate-redness Organic substances), shifts aqueous layer To new 1.5ml centrifuge tube, try not to be drawn onto white precipitate.Adding equal-volume isopropanol, reverse mixing, places 5-gently 10min.4 DEG C, 12000g is centrifuged, 10min.Supernatant is abandoned in suction, adds the ethanol (now joining) of 1ml 75%, washs RNA precipitate.4 DEG C, 7500g is centrifuged, and 5min abandons supernatant.Remove the ethanol of 75% as far as possible, dry in room temperature, about 15min.With without RNase water (20- 25 μ l) dissolve RNA precipitate.

Determination of uv absorption method measures the concentration of RNA.Use ultraviolet spectrophotometer to measure RNA concentration and purity, measure Front first with the DEPC water zeroing dissolving RNA.At 260nm, readings 1 is for representing 40ng/ μ l, the A260/A280's of RNA solution Ratio is for the detection of RNA purity, and ratio range shows to meet the requirements 1.8 to 2.1.Agarose gel electrophoresis identifies RNA's Integrity.The agarose gel of preparation 1%.Heating for dissolving agarose, cooling, add 1 μ l ethidium bromide (EB, 10mg/ml).Shake up Rear glue, after glue condenses, is placed in electrophoresis tank, is dipped in 1 × TAE buffer balance 10min, stand-by.Point sample.By 1:4 (v/ V) being mixed with sample by 5 × nucleic acid electrophoresis sample-loading buffer, the RNA that each sample accurately contains 1 μ g adds in gel pore.80V Constant voltage electrophoresis 50min.After electrophoresis terminates, observed result on gel imaging instrument.

Tris-acetic acid (TAE) buffer formulation (1L) 50 ×:

Real-time quantitative PCR

NSCLC tissue and cancer beside organism's specimen, the total serum IgE of NSCLC cell, reverse transcription reaction application TaKaRa PrimeScript test kit (Dalian treasured biological engineering company limited).Reverse transcription reaction system is as follows:

Reverse transcription reaction condition is as follows: 37 DEG C of 15min (reverse transcription reaction)；(inactivation of reverse transcription is anti-for 85 DEG C of 5sec Should).The gene order provided according to Genebank, designs primer sequence,

QPCR application 7300PCR system (Applied Biosystems, Warrington, UK).CDNA sample uses three Portion's method PCR amplification standardization program.Reaction system:

Reaction condition:

Interpretation of result: analyze specificity and the amplification efficiency of primer, judge the atopic of primer according to solubility curve. Obtain Ct value according to amplification curve, use relative measurement and internal reference GAPDH to carry out genes of interest relative expression's quantitative analysis.Calculate Formula is: 2^{^(-△Ct)}, △ Ct=Ct gene-Ct control.

The primer of LINC00961 is as follows:

Primer F (SEQ ID NO:2):

5 '-CTGTTCTGGATGGGAGCGAA-3 ',

Primer R (SEQ ID NO:3):

5’-ACAGTCACCACGAACAGCAC-3’

Result shows, LINC00961 lowers (Figure 1A, 1B) at NSCLC tissue expression compared with normal tissue.Utilize real-time quantitative PCR have detected the expression of LINC00961 in 48 pairs of NSCLC tissue/Carcinoma side normal tissue.Result shows normal group other with cancer Knit and compare, and the expression of LINC00961 compared with normal tissue expression reduction in cancerous tissue (multiple>1.5, P<0.01) (Fig. 1 C)..

Tumor feature and the poor prognosis of LINC00961 Yu the NSCLC invasive lowered have significant correlation

Expressing the dependency with clinicopathological characteristics to detect LINC00961,48 patients NSCLC are according to tumor tissues In the intermediate value rate expressed relative to LINC00961 be divided into two groups: LINC00961 relatively low expression group and LINC00961 is relatively high Expression group (Fig. 1 D).The clinicopathological characteristics of 48 NSCLC patients is summarised in table 1.It is readily apparent that in NSCLC The low expression of LINC00961 and TNM (p=0.001) by stages, lymphatic metastasis (p=0.019) and tumor size (p=0.005) show Write relevant.But, the expression of LINC00961 and other parameter such as sex (p=0.551) and age (p=0.383) etc. (table 1) Uncorrelated.In order to determine the relation expressed between NSCLC patient's prognosis of LINC00961, Progression free survival phase (PFS) and always Survival rate (OS) curve each analyze according to Kaplan-Meier and in Log-Rank Test the expression of LINC00961 and make Figure.(Fig. 1 E and 1F).These results show that low expression 3 years total survival rates of LINC00961 are 25%, but high expressed LINC00961 is 37.5%.The LINC00961 median survival interval of low expression is 21 months, but the LINC00961 of high expressed is 28 months (Fig. 1 E, Log rank p=0.009).But, 3 years Progression free survival phases of low expression LINC00961 are 16.7%, But high expressed LINC00961 is 29.1%.The median survival interval of low expression LINC0096 is 16 months, but high expressed LINC00961 is 26 months (Fig. 1 F, Log rank p=0.006). under in these results prompting NSCLC, LINC00961 expresses Adjust the time-to-live significant correlation with patient.

Embodiment 2 LINC00961 impact on NSCLC cell proliferation

In order to study LINC00961 functional role in NSCLC cell, first, we utilize qRT-PCR to detect LINC00961 expression in different NSCLC cell line.Concrete grammar is the same.As shown in Figure 2 A, when with normal bronchus Epithelial cell line (16HBE) is compared, and LINC00961 expresses notable downward in A549 and PC9 cell.Thin in order to control NSCLC LINC00961 level in born of the same parents, pcDNA-LINC00961 carrier and empty carrier are transfected in A549 and PC9 cell.Transfect 48 hours After, to analyze with QRT-PCR, expressing in the cell of pcDNA-LINC00961 carrier transfection of display LINC00961 is to raise (Fig. 2 B).It follows that the impact that A549 and PC9 cell is grown by MTT experiment detection process LAN LINC00961, concrete steps are such as Under:

1) inoculating cell: with 0.25% trypsinization single-layer culturing cell, with 1640 trainings containing 10% hyclone It is thin that nutrient solution is made into single A549/LINC00961, PC9/LINC00961 (comparison is respectively A549/lnc-NC, PC9/lnc-NC) Born of the same parents' suspension, is inoculated in 96 well culture plates with 2500, every hole cell, every pore volume 200ul.

2) cultivate cell: moved into by culture plate in CO2 incubator, cultivate under 37 DEG C, 5%CO2 and relative humidities, training Support 3 days.

3) colour generation: after cultivating 6h, 24h, 48h, 72h, 96h, every hole adds MTT solution (5mg/ml) 20ul, 37 DEG C, continues Continuous 4h of hatching, termination is cultivated, and carefully inhales and abandons culture supernatant in hole.Add 150 μ l DMSO (dimethyl sulfoxide) vibration 10min, Crystal is made fully to dissolve.

4) colorimetric: measuring optical density value (OD) at 490nm wavelength, often the multiple hole of group 3, tests in triplicate.Calculate existence Rate.Survival rate=experimental group OD value/matched group OD value × 100%.

By as above method, by A549/LINC00961, PC9/LINC00961, (comparison is respectively A549/lnc-NC, PC9/ Lnc-NC) cell strain kind is on 96 orifice plates, 2500 cells/well.Cultivate MTT staining prison after 6h, 24h, 48h, 72h, 96h Survey cell viability.

MTT experiment shows, compared with the cell of their pairing, and the process LAN LINC00961 growth to A549 and PC9 cell Impact (Fig. 2 C and 2D), does not shows that LINC00961 participates in other NSCLC biological process.

Embodiment 3 process LAN LINC00961 suppression NSCLC cell invasion and migration

Except cell proliferation, cell invasion and migration also play an important role in the development evolution of tumor.Cause This, we evaluate LINC00961 to NSCLC cell invasion and the impact of migration with the experiment of Transwell cell.Concrete steps As follows:

1) 24 orifice plates are placed the Transwell cell of 8 μm pore sizes.Cell invasion is tested, and uses 50mg/l BD Matrigel 1:8 diluent is coated the face, upper room of Transwell cell bottom film, and the cell being coated is put in 24 orifice plates, incubated Case is hatched 2h.

2) peptic cell, is centrifuged after terminating digestion and discards culture fluid, wash 1-2 time with PBS, with the serum-free culture containing BSA Basic weight hangs.Adjust cell density to 1x10⁵.Obtained cell suspension 200 μ l adds Transwell cell.Under 24 orifice plates, room adds 500 The μ l culture medium containing 10%FBS, puts into cellar culture 24h in incubator.

3) Cell migration assay, adjustment cell density to 1-10x10⁴.It is little that obtained cell suspension 200 μ l adds Transwell Room.Under 24 orifice plates, room adds the 500 μ l culture medium containing 10%FBS, puts into cellar culture 24h in incubator.

4) take cell, wipe matrigel and the cell of upper indoor with cotton swab, with thin by cell outer bottom of 0.1% crystal violet Born of the same parents' dyeing utilizes inverted microscope to take pictures the cell of the dyeing that side, Transwell cell counterdie upper and lower room is adhered to counting.

Result such as Fig. 3 A and 3C, shown, process LAN LINC00961 can suppress invasion and attack and the migration of A549 and PC9 cell Ability；Compared with compared with control cells, the cell number attacked and migrate is (Fig. 3 B and 3D) substantially reduced.In order to probe into LINC00961 causes the molecular mechanism of NSCLC cell phenotype, and we have detected participation tumor invasion and the potential target of migration Point.Specifically comprise the following steps that

Protein immunoblot experiment detection LINC00961 is to non-small cell lung cancer cell strain A549 invasion and attack and the relevant egg of migration The impact that white β-catenin, E-cadherin, N-cadherin and vimentin express.Concrete grammar is as follows:

1. extract total protein of cell

2.SDS-PAGE electrophoresis

1) clean, glass plate, potsherd are installed.

2) preparation perfusion separation gel, 37 DEG C stand 25min.

3) preparation perfusion concentrates glue, and room temperature stands 20min.

4) adding protein sample and molecular weight marker, each period, albumen applied sample amount was 40 μ g.

5) constant voltage electrophoresis (concentrating glue 80V, separation gel 160V).

2. half dry type transferring film

1) after electrophoresis terminates, wear glove, cut glue (corner cut mark according to destination protein molecular weight ranges with reference to molecular weight marker Note), cut formed objects nitrocellulose filter (corner cut labelling) and filter paper 2.

2) transferring film buffer soaks glue, film and filter paper 10min.

1) tiling from bottom to up on transferring film instrument: filter paper, film, gel, filter paper, catches up with bubble removing, especially notes film and gel Between prohibit stay bubble.Dry surplus liquid, 0.8mA × membrane area (cm2) electric current transferring film 1.5 hours.

3. immunoblotting

1) transferring film terminates, and whether inspection marker has turned on film (or Ponceaux dyeing) to judge transferring film effect.TBST After cleaning film, 5% defatted milk powder (TBST preparation) room temperature shake 2h.

2) anti-bax, bcl-2 monoclonal antibody (1:1000) that adds (purchased from cell signal company), closes overnight for 4 DEG C.

3) TBST rinses 3 times, each 5min.

4) add two anti-(1:10000) (purchased from cell signal company), room temperature shake 2h.

5) TBST rinses 3 times, each 10min.

4.ECL detects

1) mixing of AB liquid, after film does not drips, tiles on it.

2) after reaction 5min, according to fluorescence intensity darkroom tabletting 5～30min.

3) development 15～30s, washing, fixing 1～3min.

4) picture scanning and quantitative analysis.

5) as stated above, A549/LINC00961 (comparison is A549/lnc-NC), extracts the total egg of cell after cultivating 48h White detection invasion and attack and migration associated protein β-catenin, E-cadherin, N-cadheri n and vimentin expression.

Western blot analysis shows, process LAN LINC00961 reduces β-catenin protein level, but to E- Cadherin, N-cadherin and vimentin express not impact (Fig. 3 E and 3F).These results hint LI NC00961 energy Enough parts suppress NSCLC cell invasion by the expression of regulation and control β-catenin and migrate can be as the intervention target of oncotherapy Point.

Embodiment 4 LSD1 modifies suppression LINC00961 by H3K4me2 and expresses.

In recent years, the apparent modification of histone is considered to play an important role in suppression lncRNA transcribes.Such as, Sun Ming Et al. research show that lncRNA SPRY4intronic transcript 1 (SPRY4-IT1) passes through in NSCL C cell There is apparent silence in the direct Transcription inhibition mediated by ZNFN3A1 EZH2.Suppressed in order to probe into LINC00961 Whether be to be modified by EZH2, first, A549 and PC9 cell EZH2siRNAs process, QRT-PCR analyzes and shows to lower LINC00961 is expressed not impact (Fig. 4 A and 4B) by EZH2, shows that LINC00961 transcribes the silence not mediated by EZH2 and adjusts Control.And, whether it is to be modified, by histone demethylase LSD1 mediation, the minimizing causing LINC00961 to express to probe into, We design LSD1siRNAs and transfect NSCLC cell.Result shows after A549 and PC9 cell lowers LS D1, LINC00961 Expression rise (Fig. 4 C and 4D) on the contrary.And whether ChIp experiment is used for studying in NS CLC cell LINC00961 be Directly transcribe target spot for one of LSD1.Specifically comprise the following steps that

(1)

1. by 3.33mL 4% paraformaldehyde add containing 10mL culture medium big ware in (final concentration of 1%, notes use High-quality paraformaldehyde), rock uniformly.

2. incubated at room 10min on shaking table；

The pre-1mL PBS of 5 μ L cocktail that adds of preparation the most simultaneously, in centrifuge tube, is placed on ice；

4. 10 × the glycine (Glycin) of 1.33mL is added in culture dish；

5. on shaking table, rock uniform incubated at room 5min；

6. culture dish is put the most stand-by；

7. draw culture medium, draw as far as possible, keep off and contact A549 and PC9 cell；

8. add PBS cell × 2 time of 10mL, abandon supernatant；

9. add the 1mL PBS (containing cocktail) that pre-cooling is good；

10. A549 and PC9 cell is scraped in new centrifuge tube；

11.800 × g, (centrifugal period prepares the cell pyrolysis liquid that 500 μ L contain 2.5 μ L cocktail to 4 DEG C of centrifugal 5min (Cell lysis buffer))；

12. abandon supernatant (cell fixed can be good in this fast quick-freezing of step liquid nitrogen, puts-80 DEG C of Refrigerator store several months)； 13. use ready 500 μ L cell pyrolysis liquid re-suspended cells；

14. hatch 15min, every 5min vortex cell pyrolysis liquid gently on ice；

15.800 × g, (centrifugal period prepares the karyorhexis liquid that 500 μ L contain 2.5 μ L cocktail to 4 DEG C of centrifugal 5min (Nucleus lysis buffer))；

16. centrifugal after abandon supernatant, with the karyorhexis liquid re-suspended cell of 500 μ L.

(2):

The most ultrasonic, condition: ultrasonic 10s is followed by rest 50s, is repeated 10 times altogether, being in the ultrasonic time is 1min40s, amplitude is 30%；

2.12,000 × g, 4 DEG C of centrifugal 10min, supernatant loads in new 1.5mL centrifuge tube (can take 5 μ L race agaroses Ultrasonic effect seen by gel)；

3. every for supernatant 50 μ L are dispensed in centrifuge tube (every individual system contains 1 × 106 cell, enough IP, this portion Divide and can be placed on-80 DEG C of preservation 3mo.)；

The most separately take 5 μ L of supernatant and treat that Part IV is used as Input.

(3)

The most each reaction tube adds the 100 μ L Dilution buffer containing 0.5 μ L cocktail of pre-cooling, first takes The magnetic bead that 20 μ L mix is added thereto, and adds the 1～10 μ specific antibody of g LSD1 and H3K4me2, rIgG or mIgG (according to the source of purpose antibody), uses DL instrument incubated at room 30min；

2. add 50 μ L reactant liquors in 2.3 and contain the 350 μ L Dilution buffer of 1.75 μ L cocktail, 4 DEG C Hatch 1h～3h (or overnight)；

3. pipe is placed on magnetic frame, abandons supernatant

4. clean magnetic bead-antibody, in strict accordance with order with following 500 μ L Buffer vortexs:

A. adding the Low salt buffer of pre-cooling, 4 DEG C rotate 5min, abandon supernatant on magnetic frame；

B. adding the High salt buffer of pre-cooling, 4 DEG C rotate 5min, abandon supernatant on magnetic frame；

C. adding the LiCi buffer of pre-cooling, 4 DEG C rotate 5min, abandon supernatant on magnetic frame；

D. adding TE buffer, room temperature rotates 5min, abandons supernatant on magnetic frame；

(4)

1. E.C. 3.4.21.64 and ChIP Elution buffer being put room temperature, each reaction needs to be dissolved in 100 μ L Elution The 1 μ L E.C. 3.4.21.64 of buffer)；

2. in water-bath 62 DEG C rock and hatch 2h (digesting protein；As not having shaking bath, then every 15min is carried out once Vortex) on → degeneration stove 95 DEG C hatch 10min (making enzyme inactivate)；

3. the centrifuge tube of cooling is placed on magnetic frame, supernatant is separated in new centrifuge tube.

(5)

1. being put in collecting pipe by adsorption column, each reaction needs a collecting pipe；

The most each IP and Input reaction adds the Bind reagent A of 500 μ L, mix homogeneously；

3. being added in adsorption column by the reactant liquor mixed, 12,000 × g is centrifuged 30s, abandons the liquid in collecting pipe, will inhale Attached column is put back in collecting pipe；

4. add 500 μ L Wash reagent B；12,000 × g is centrifuged 30s, abandons the liquid in collecting pipe, and adsorption column is put back to In collecting pipe；

5.12,000 × g is centrifuged 3min, is transferred in new centrifuge tube by adsorption column；

6. being added to the center of adsorption column and stand 2min by 50 μ L Elution buffer C, 12,000 × g is centrifuged 30s, I.e. obtain required DNA；

7., if desired for more thorough eluting, 50 μ L Elution buffer C can be added again and carry out eluting.

Result shows such as Fig. 5 A and 5B, shows that LSD1 can be bonded directly to LINC00961 promoter region and mediate H3K4me2 modifies, and the downward that this can be expressed by LSD1 reduces LSD1 combination and increase H3K4me2 modifies and supported (Fig. 5 C And 5D).The H3K4me2 of these data enlightenment LSD1 mediation modifies and plays a crucial work in suppression LINC00961 expresses With.

Claims

1. one kind is used for judging that nonsmall-cell lung cancer (NSCLC) prognosis situation or the length as Treatment for Non-small Cell Lung target spot are non- Coding RNA (LINC00961) is characterized in that, the nucleotide sequence of described long non-coding RNA is as shown in Seq ID NO:1.

2. identify that the label of the long non-coding RNA described in claim 1 judges Treatment for Non-small Cell Lung prognosis feelings in preparation Application in the diagnostic products of condition, described label includes but not limited to:

(1) combine the primer of long non-coding RNA described in the primer/primer sets of described long non-coding RNA or fluorescently-labeled combination/ Primer sets；

(2) micromolecular compound of described long non-coding RNA is combined；

(3) combining the biomacromolecule of described long non-coding RNA, described biomacromolecule includes but not limited to: antibody or anti- Body function fragment, fluorescently-labeled antibody or antibody functional fragment, rna binding protein or its function fragment, fluorescently-labeled RNA Associated proteins or its function fragment.

Application the most according to claim 2, it is characterised in that described primer sets or the nucleoside of fluorescently-labeled primer sets Acid sequence is as shown in SEQ ID NO:2 and SEQ ID NO:3.

4. comprise the label described in Claims 2 or 3 for judge Treatment for Non-small Cell Lung prognosis situation reagent or Test kit.

5. the long non-coding RNA described in claim 1 is judging the diagnostic reagent of nonsmall-cell lung cancer prognosis situation as screening In application.

6. the application in the medicine as screening treatment nonsmall-cell lung cancer of the long non-coding RNA described in claim 1.

7. the application in the medicine of preparation treatment nonsmall-cell lung cancer of the long non-coding RNA described in claim 1.