CN110468210A - CDC45 is as glioblast tumor markers and its as the application of therapy target - Google Patents
CDC45 is as glioblast tumor markers and its as the application of therapy target Download PDFInfo
- Publication number
- CN110468210A CN110468210A CN201910862416.7A CN201910862416A CN110468210A CN 110468210 A CN110468210 A CN 110468210A CN 201910862416 A CN201910862416 A CN 201910862416A CN 110468210 A CN110468210 A CN 110468210A
- Authority
- CN
- China
- Prior art keywords
- cdc45
- cell
- gbm
- gene
- glioblastoma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4739—Cyclin; Prad 1
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Pathology (AREA)
- Biochemistry (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Wood Science & Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of biotechnology, specifically disclose CDC45 as glioblast tumor markers and its as the application of therapy target.Combination of the present invention is outer and experiment in vivo, show CDC45 gene high expression in glioblastoma (GBM) cell, there is significant correlation with the tumor grade and poor prognosis of GBM, and the expression of CDC45 can significantly promote proliferation, migration and the invasion of GBM cell.On this basis, invention further provides the markers that the expression product of CDC45 gene can be used as GBM, and using CDC45 as the novel targets of the targeted therapy of GBM, the drug that exploitation can lower CDC45 gene expression amount provides new therapy approach and scheme for glioblastoma.
Description
Technical field
The present invention relates to field of biotechnology, specifically, being related to CDC45 as glioblast tumor markers and its work
For the application of therapy target.
Background technique
Glioblastoma (GBM) is most common, the extremely strong brain tumor of invasion, is mainly characterized by life cycle short (middle position
12.5 months life cycles), high recurrence rate, Tumor Heterogeneity is high and lacks effective treatment means.The treatment means of standard are easily
Drug resistance is generated, promotes operation remaining tumor cells gradually insensitive to radiotherapy or chemotherapy, and radiotherapy, chemotherapy have huge pair
Effect, under the premise of improving limited prognosis existence, but often with poor life quality.Therefore, it is badly in need of the hair to GBM
Raw, development mechanism carries out in-depth study, and finds more acurrate, effective therapy target.
CDC45 belongs to cyclin, the starting that regulating DNA replicates in the form of the heterologous tetramer.It mainly grinds at present
Study carefully and is absorbed in its regulation as regulatory factor cell cycle.And the concrete function in GBM and its tune to downstream albumen
Control is still not clear.
Researcher explores TCGA database, and discovery CDC45 belongs to tumour in cervical carcinoma, prostate cancer and lung cancer
Relevant key gene, to the Correlation analysis showed CDC45 of prognosis in non-small cell lung cancer and cancer of pancreas with poor prognosis
Significant correlation.
Therefore, CDC45 is potential tumor markers and therapy target in other tumours, we are to CDC45 in GBM
Function and expression are explored, it is found that it can also serve as the tumor markers of GBM, are mentioned for the targeted therapy of GBM
For new selection.
Summary of the invention
In order to solve the problems in the existing technology, the object of the present invention is to provide CDC45 as glioblastoma
Marker and its application as therapy target.
Firstly, the marker is CDC45 gene the present invention provides a kind of new glioblast tumor markers
The expression product of (Nucleotide ID:NM_001178010.2, CCDS ID:CCDS54499.1), the expression product include
But it is not limited to CDC45mRNA and CDC45 albumen.
The present invention passes through the table using CDC45 in immunohistochemical staining technology 148 clinic GBM patient tissue samples of evaluation
Up to level, find to be gradually increased with the raising of GBM rank, the expression of CDC45 albumen.Meanwhile it is raw using Kaplan-Meier
It deposits analysis method and survival analysis is carried out to CDC45 high expression and low expression sample, no matter raw in final position high expression group is as the result is shown
It deposits the phase (OS) or at progression free survival phase (PFS), all there is relatively poor prognosis situation compared to low expression group.
Therefore, according to the high correlation between CDC45 and GBM rank and prognosis, application of the present invention is CDC45
Product include the product for capableing of quantitative detection CDC45 gene mRNA, and/or be capable of the product of quantitative detection CDC45 albumen.
The new application for example can be able to detect GBM tissue samples for a kind of reagent of detection GBM prognosis, the reagent
In CDC45 gene mRNA content, include the PCR primer for detecting CDC45 gene mRNA content;Being also possible to can
Detect the reagent of CDC45 protein content in GBM tissue samples.
Further, it is described detection CDC45 gene mRNA product be can specific amplification CDC45 gene PCR primer.
Further, the product of the detection CDC45 albumen is the antibody that can specifically bind CDC45 albumen.
Further, the sample of the detection is the tissue samples of GBM.
On the other hand, the application the invention also provides CDC45 gene as glioblastoma therapy target, and its make
For application of the therapy target in terms of screening glioblastoma therapeutic agent.
The present invention stablizes silent carrier by building slow virus, and is constructed by slow virus system and stablize silencing CDC45's
Cell strain detects proliferation growing state of the CDC45 silenced cell strain relative to control cell by the method for CCK8, passes through
The method of Transwell detects migration and the invasive ability of cell.The results show that CDC45 expression is lowered, to significantly inhibit GBM thin
Born of the same parents' proliferation, migration and invasive ability.
In consideration of it, the present invention provides the drugs for lowering CDC45 gene expression amount to treat glioblastoma medicine in preparation
The application in object space face.
The drug has the function of following either side:
1) inhibit proliferation, migration and the invasive ability of glioblastoma cells;
2) inhibit the monoclonal forming ability of glioblastoma cells;
3) inhibit the speed of growth of glioblastoma.
On this basis, the present invention also provides a kind of drugs for treating glioblastoma.The drug targeting CDC45
Gene and the expression quantity that CDC45 gene can be reduced.
Therefore, all targeting CDC45 genes and CDC45 gene expression amount is reduced, and for treating and glioblastoma
The drug of related disease, all belongs to the scope of protection of the present invention.
The beneficial effects of the present invention are:
Combination of the present invention is outer and experiment in vivo, show CDC45 gene high expression in GBM tumour cell, it is swollen with GBM
Tumor classification and poor prognosis have significant correlation, and the expression of CDC45 can significantly promote GBM cell proliferation, migrate and
Invasion.On this basis, invention further provides the markers that the expression product of CDC45 gene can be used as GBM, and will
Novel targets of the CDC45 as the targeted therapy of GBM, the drug that exploitation can lower CDC45 gene expression amount is glioblastoma
New therapy approach and scheme are provided.
Detailed description of the invention
Fig. 1 is the expression that immunohistochemical staining technology evaluates CDC45 in 148 clinic GBM patient tissue samples;Its
In, A is tissue staining standards of grading, and B is the expression of CDC45 and the correlation results of tumor grade in GBM, and C, D are in GBM
The correlation results of expression and the prognosis of CDC45.
Fig. 2 is the expression of results of CDC45 in stable expression cell strain LN229, U251;Wherein, A shows overexpressing cell strain
There is a high expression of significant CDC45 gene, B, D show that the overexpression of CDC45 significantly improves the growth rate of GBM cell, C,
E-F shows that the overexpression of CDC45 significantly improves GBM cell monoclonal Forming ability.
Fig. 3 is influence of the overexpression of CDC45 to the proliferation of GBM cell, migration and invasive ability;Wherein, A CDC45
Overexpression to the cell number of the dyeing of each same time experimental group in the migration of GBM cell and invasion detection, B is that CDC45 crosses table
The statistic analysis result of the cell number dyed up to cell and control cell.
Fig. 4 is the expression of results of CDC45 in stable expression cell strain LN229, U251;Wherein, A shows that silenced cell strain has
The downward of significant CDC45 gene, B, D show that the silencing of CDC45 significantly suppresses the growth rate of GBM cell, and C, E-F are shown
The silencing of CDC45 significantly suppresses GBM cell monoclonal Forming ability.
Fig. 5 is influence of the silencing of CDC45 to the proliferation of GBM cell, migration and invasive ability;Wherein, A is CDC45's
Silencing expresses the cell number of the dyeing of each same time experimental group in migration and invasion detection to GBM cell, and B is CDC45 silencing
The statistic analysis result of cell and the cell number of control cell dyeing.
Fig. 6 is influence of the overexpression of CDC45 to GBM tumor growth rate;Wherein, A is Balb/c-nu Female nude mice body
The tumor size that LN229, U251 cell strain and normal LN229, U251 cell strain that interior CDC45 is overexpressed generate, B are each reality
Test the statistic analysis result of group gross tumor volume.
Fig. 7 is that the influence in Balb/c-nu Female nude mice body to GBM tumor growth rate is lowered in the expression of CDC45;Its
In, A is LN229, U251 cell strain and normal LN229, U251 cell of CDC45 silencing in Balb/c-nu Female nude mice body
The tumor size that strain generates, B are the statistic analysis result of each experimental group gross tumor volume.
Specific embodiment
The preferred embodiment of the present invention is described in detail below in conjunction with embodiment.It will be appreciated that following real
Providing merely to play the purpose of explanation for example is applied, is not used to limit the scope of the present invention.The skill of this field
Art personnel without departing from the spirit and purpose of the present invention, can carry out various modifications and replace to the present invention.
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
CDC45 high is expressed in 1 glioblastoma patient tissue of embodiment, significant related to tumor grade and poor prognosis
In order to study clinical manifestation of the CDC45 albumen in GBM, the present embodiment is analyzed by the method for immunohistochemical staining
148 GBM clinical patient tissue chips by analyzing interlacing point staining conditions determine that CDC45 albumen faces in GBM
Expression in bed patient tissue.
The protein expression situation of different tissues point is determined according to the CDC45 immunohistochemical staining depth: first according to dyeing
Situation gives each interlacing point and scores, if Figure 1A dye-free or few brown point are defined as 1, about 20%-50%'s or so
Cell color is defined as 2, and the cell color of about 50%-75% or so is defined as 3, and 75% or more cell all colours and is defined as 4.Root
Expression and tumor grade (Figure 1B) and prognosis (figure according to CDC45 in each interlacing point immunohistochemical staining scoring situation analysis GBM
1C, D) correlation.
By to each interlacing point carry out 3 people independently score determine finally score after, by the GBM patient of different stage
It is for statistical analysis, it is analyzed between group using ANOVA (Two-way).As a result, it has been found that with the raising of GBM tumour rank, CDC45
The expression of albumen is gradually increased.Meanwhile the tumor tissues of scoring 1,2 being determined as to the low expression sample of CDC45, it will scoring 3,4
Tumor tissues be determined as the high expression sample of CDC45, using Kaplan-Meier survival analysis method to CDC45 high expression and
Low expression sample carries out survival analysis, and no matter high expression group is in final position life cycle (OS) or in progression free survival phase as the result is shown
(PFS), all there is relatively poor prognosis situation compared to low expression group.
The cell strain for being overexpressed CDC45 is stablized in the building of embodiment 2
The present embodiment constructs CDC45 overexpressing cell system in vitro, for verify CDC45 to GBM cell Proliferation, migration and
Invade the function of aspect.
The method for constructing CDC45 overexpressing cell system is specific as follows:
1. design of primers
The website NCBI is utilized from the mRNA sequence (NM_000963.3) for searching people CDC45 gene in gene pool (GenBank)
Middle Primer blast insert design a pair can primer of the efficient amplification comprising CDC45 gene C DS sequence.Use DNAman software
Analyze the restriction enzyme site of CDC45 and slow virus over-express vector and silent carrier.It is needed according to experiment in target gene
Suitable restriction site is added at 5 ' ends of upstream and downstream primer, and adds corresponding protection base before restriction enzyme site.
Primer specifically:
F:CGGAATTCATGTTCGTGTCCGATTTCCGC;
R:CGGATCCGGACAGGAGGGAAATAAG。
2. expanding CDC45 target gene
With the plasmid (CDC45-pUC19) containing CDC45 gene for template, pass through PCR amplification CDC45 using above-mentioned primer
Gene.
The reaction system and PCR amplification program of PCR is as follows:
PrimeSTAR Max Premix (2X) | 25μL |
Upstream primer (10 μM) | 1μL |
Downstream primer (10 μM) | 1μL |
CDC45-pUC19(100ng/μL) | 2μL |
dd-H2O | 21μL |
It amounts to | 50μL |
The digestion of 3.PCR product and purpose carrier, slow virus packaging
Inspection, gel extraction or direct purification target fragment are connect with carrier T, according to plasmid construction method, building
Lentiviral (CDC45 over-express vector, CDC45 silencing expression vector).After sequencing, with the micro plasmid of endotoxin-free
The core plasmid of extracts kit extraction Lentiviral.Using Lipo 3000 by core plasmid transfection to 293T cell,
37 DEG C, 5%CO2Culture.Culture supernatant is collected in 48h, 72h and 96h respectively, 4 DEG C of 400g centrifugation 5min remove cell fragment, then
With 0.22 μm of membrane filtration virus liquid removal cell fragment and degerming, the virus liquid comprising virion is obtained.Virus liquid is closed
And be placed in the super filter tube of 100KD, 4 DEG C of 3000g centrifugation is concentrated, and virus liquid is concentrated into 200 μ L or so, freeze in-
80 DEG C of ultra low temperature freezers, avoid multigelation.
4. the virus infection and screening of target cell
Detect the sensibility of target cell (LN229, U251) to puromycin (puromycin, puro), i.e., minimum lethal agent
Amount;LN229 cell is 1 μ g/mL;U251 cell is 2 μ g/mL.To target cell infection bed board, the every hole paving of 6 orifice plates (culture medium 2mL)
1×105A cell is infected (cell confluency degree reaches 50%-70%) after overnight incubation.1mL complete medium is replaced, with
1mL viral supernatants dilution (virus liquid after the 50 above-mentioned concentrations of μ L is diluted to 1mL with complete medium) and 4 μ g/ are added afterwards
ML gathers peaceful amine (Polybrene) Lai Tigao virus infection efficiency.Virus infection liquid is siphoned away after infecting 48h and changes complete culture into
Base, and the Puro that respective concentration is added is screened.It is passed on according to cell growth status, step sizing obtains steady after number generation
Surely it is overexpressed LN229, U251 cell strain of CDC45, freeze-stored cell is spare.
3 CDC45 of embodiment remarkably promotes GBM cell Proliferation, migration and invasive ability
In order to probe into concrete function of the CDC45 in GBM, CDC45 overexpressing cell strain phase is detected by the method for CCK8
For the proliferation growing state of control cell, migration and the invasive ability of cell are detected by the method for Transwell.
1) CCK8 detects cell Proliferation
Good LN229, U251 plating cells of growth conditions (96 orifice plate) are taken, U251 cell per well is 1000 cells,
LN229 cell per well is 800 cell (wherein, every 100 μ L complete mediums of hole, when then spreading cell if necessary to agent-feeding treatment
Add 50 μ L culture mediums, carry out mending the complete medium that 50 μ L contain drug when agent-feeding treatment).Setting control wells and blank well, 37
DEG C, 5%CO2Constant incubator overnight incubation.10 μ L CCK8 reaction solutions are added in every hole, are protected from light during adding, are placed in 37 DEG C of perseverances
Warm cell incubator reacts 2h.Multi-function microplate reader reads the light absorption value in each hole in 450nm wavelength, calculates.
2) cell invasion and transfer
With the blank cultures of the no FBS pretreatment cell Transwell (the wherein matrigel of upper chamber: culture medium=1:
25).According to each cell containing 200 μ L culture medium U251 cells be 50000, LN229 cell is 30000, and control is arranged
Hole.Lower room blank cultures are substituted for containing the complete of 20%FBS by the blank cultures of reject upper chamber and lower room before spreading cell
Culture medium, upper chamber spread corresponding cell according to different cell densities.37 DEG C are placed in, 5%CO2Constant incubator culture.Wait cultivate
When time is enough, culture medium is discarded, the fixed cell 15min of 500 μ L methanol is added in PBS cleaning, and then PBS is cleaned.500 μ are added
L crystal violet carries out cell dyeing 5min.It is finally impregnated using ultrapure water and removes remaining crystal violet, and wiped in upper chamber with cotton swab
Attached cell, retain across cell, drying cabinet saves in 37 DEG C of incubators.Microscope is taken pictures, is counted, according to across cell
Quantity come determine the transfer of each cell and invasion ability or drug to the inhibiting effect of cell transfer and invasive ability
By the expression of CDC45 in the method detection building stable expression cell strain of q-RT-PCR, pass through t-test
Statistical method analyzes the changes in gene expression of overexpressing cell strain relative comparison cell, shows the building by stable cell strain,
Overexpressing cell strain has the high expression (Fig. 2A) of significant CDC45 gene.By the overexpressing cell of CDC45 in 450nm wavelength
Under light absorption value, to measure absorbance of cells in different time periods, by different time sections overexpressing cell and control cell
The proliferative differences that dynamic curve comes between comparative group are done in the comparison of light absorption value, by between the statistical method statistics group of t-test
Conspicuousness, the overexpression of CDC45 significantly improves the growth rate (Fig. 2 B, D) of GBM cell as the result is shown.To cell monoclonal
The detection of Forming ability is determined by carrying out a small amount of long time cultivation to equal number of overexpression and control cell, is passed through
After the culture of 7d, every hole cell number of overexpressing cell and control cell is counted, to determine the overexpression of CDC45 to GBM cell
The influence of monoclonal forming ability, by conspicuousness between t-test statistical method statistics group, the overexpression of CDC45 is aobvious as the result is shown
Work improves GBM cell monoclonal Forming ability (Fig. 2 C, E-F).To migration and invasive ability detection in, in Transwell
The equal number of overexpression of cell upper layer kind and control cell are led to hyperchromatic method after 24h and are carried out to cell through the membrane
It counts, compares overexpressing cell and number that control cell passes through, the conspicuousness between group is statisticallyd analyze by t-test, as a result
It has been shown that, cell number through the membrane, overexpressing cell are significantly higher than control cell.In conclusion the overexpression of CDC45 significantly improves
The proliferation of GBM cell, migration and invasive ability (Fig. 3).
4 CDC45 of embodiment expression, which is lowered, significantly inhibits GBM cell Proliferation, migration and invasive ability
In order to further probe into concrete function of the CDC45 in GBM, we construct slow virus and stablize silent carrier, and
The cell strain for stablizing silencing CDC45 is constructed by slow virus system, it is opposite to detect the strain of CDC45 silenced cell by the method for CCK8
In the proliferation growing state of control cell, migration and the invasive ability of cell are detected by the method for Transwell.
The expression for stablizing CDC45 in silenced cell strain is constructed by the method detection of q-RT-PCR, passes through t-test
Statistical method analyzes the changes in gene expression of silenced cell strain relative comparison cell, and display is sunk by the building of stable cell strain
Silent cell strain has the downward (Fig. 4 A) of significant CDC45 gene.Pass through extinction of the silenced cell of CDC45 under 450nm wavelength
Value, to measure absorbance of cells in different time periods, by stablizing silenced cell and control cell light absorption value to different time sections
Comparison, do the proliferative differences that dynamic curve comes between comparative group, by the conspicuousness between the statistical method statistics group of t-test,
The silencing of CDC45 significantly suppresses the growth rate (Fig. 4 B, D) of GBM cell as the result is shown.To cell monoclonal Forming ability
Detection is determined by carrying out long time cultivation to equal number of stable silencing and control cell, after the culture of 7d, meter
Every hole cell number of silenced cell and control cell was counted, to determine the silencing of CDC45 to GBM cell monoclonal Forming ability
It influences, by conspicuousness between t-test statistical method statistics group, the silencing of CDC45 significantly suppresses GBM cell list as the result is shown
Clonality (Fig. 4 C, E-F).To migration and invasive ability detection in, in the cell Transwell upper layer kind same number
Silencing and control cell, lead to hyperchromatic method after 24h and cell through the membrane counted, compare silenced cell and right
The number that photo cell passes through statisticallys analyze the conspicuousness between group by t-test, the results show that cell number through the membrane, sinks
Silent cell is substantially less than control cell.Summary, the silencing of CDC45 significantly suppress proliferation, migration and the invasive ability of GBM cell
(Fig. 5).
5 GBM Transplanted tumor model of embodiment verifies influence of the CDC45 overexpression to GBM tumor growth rate
In order to study the overexpression influence to the growth of GBM cell in vivo of CDC45,24 6 week old, Female nude mices are chosen
(Balb/c-nu), control group 12 and experimental group 12 construct metastasis models.
Cell is resuspended with PBS in CDC45 overexpressing cell strain LN229, U251.Match according to 5 × 106 cells of every mouse
Suitable cell suspension is set, isometric matrigel is added when configuring cell suspension, to promote the one-tenth knurl ability of cell.In female
100 μ L cell suspensions are injected at left and right sides of the back nude mice (Balb/c-nu) respectively, during which routine observation nude mice upgrowth situation is used
The indexs such as electronic balance and vernier caliper measurement nude mice weight, gross tumor volume (tumour major diameter (X mm) and minor axis (Y mm)).And
The variation of gross tumor volume is calculated according to following formula:
Nude mice is grouped at random and is administered when tumour growth is to about 100mm3 by the group for needing to be administered.Administration terminates
Or gross tumor volume reaches desired value, takes off neck and puts to death each group nude mice, removes tumour and collects blood and the (determination of required organ
The influence of administration or the growth of tumour to nude mice itself).
Each group tumour marks, and after the completion of taking pictures, each tumour is divided into 3 parts, portion, which is fixed in 4% paraformaldehyde, to be used
In immunohistochemical analysis, two points are frozen in liquid nitrogen for qRT-PCR and Protein Detection.
Fig. 6 discloses the overexpression influence to the growth of GBM cell in vivo of CDC45: Fig. 6 A shows that nude mouse is subendothelial
Tumor formation experimental result;In Fig. 6 B, the growth curve of tumour shows that CDC45 is overexpressed the speed of growth for remarkably promoting GBM tumour.
6 GBM Transplanted tumor model of embodiment verifies influence of the CDC45 expression downward to GBM tumor growth rate
In order to study the silencing influence to the growth of GBM cell in vivo of CDC45,24 6 week old, Female nude mices are chosen
(Balb/c-nu), control group 8 and experimental group 16 construct metastasis models.
Stablize silencing CDC45 cell line LN229, U251, control cell LN229/U251-Sh-Con), cell is resuspended in
In PBS;According to every mouse 5 × 106A cell configures suitable cell suspension, and isometric base is added when configuring cell suspension
Matter glue, to promote the one-tenth knurl ability of cell.100 μ L cells are injected respectively at left and right sides of the back Female nude mice (Balb/c-nu)
Suspension, routine observation nude mice upgrowth situation, during which with electronic balance and vernier caliper measurement nude mice weight, gross tumor volume (tumour
Major diameter (X mm) and minor axis (Y mm)) etc. indexs.And the variation of gross tumor volume is calculated according to following formula:
Administration terminates de- neck and puts to death each group nude mice, remove tumour and collect blood and required organ (determine administration or
Influence of the growth of tumour to nude mice itself).
Each group tumour marks, and after the completion of taking pictures, each tumour is divided into 3 parts, portion, which is fixed in 4% paraformaldehyde, to be used
In immunohistochemical analysis, two points are frozen in liquid nitrogen for qRT-PCR and Protein Detection.
By being counted at the end of experiment to gross tumor volume, and carried out by t-test statistical method significant between group
Property compares, as a result, it has been found that, the stabilization silencing of CDC45 significantly suppresses the speed of growth (Fig. 7) of GBM transplantable tumor in vivo.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Claims (9)
1. a kind of glioblast tumor markers, which is characterized in that the marker is the expression product of CDC45 gene.
2. detecting application of the reagent of CDC45 gene expression amount in preparation glioblastoma detection reagent or kit.
3. application according to claim 2, which is characterized in that the reagent of the detection CDC45 gene expression amount includes energy
The product of CDC45 gene mRNA is enough detected, and/or is able to detect the product of CDC45 albumen.
4. application according to claim 3, which is characterized in that the product of the detection CDC45 gene mRNA is can be special
Property amplification CDC45 gene PCR primer.
5. application according to claim 3, which is characterized in that the product of the detection CDC45 albumen is that specific can tie
Close the antibody of CDC45 albumen.
Application of the 6.CDC45 gene as glioblastoma therapy target, which is characterized in that screen colloid as therapy target
The therapeutic agent of blastoma.
7. lowering application of the drug of CDC45 gene expression amount in terms of glioblast tumor medicine is treated in preparation.
8. application according to claim 7, which is characterized in that the drug has the function of following either side:
1) inhibit proliferation, migration and the invasive ability of glioblastoma cells;
2) inhibit the monoclonal forming ability of glioblastoma cells;
3) inhibit the speed of growth of glioblastoma.
9. a kind of drug for treating glioblastoma, which is characterized in that the drug targeting CDC45 gene can simultaneously reduce
The expression quantity of CDC45 gene.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910862416.7A CN110468210A (en) | 2019-09-12 | 2019-09-12 | CDC45 is as glioblast tumor markers and its as the application of therapy target |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910862416.7A CN110468210A (en) | 2019-09-12 | 2019-09-12 | CDC45 is as glioblast tumor markers and its as the application of therapy target |
Publications (1)
Publication Number | Publication Date |
---|---|
CN110468210A true CN110468210A (en) | 2019-11-19 |
Family
ID=68515750
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910862416.7A Pending CN110468210A (en) | 2019-09-12 | 2019-09-12 | CDC45 is as glioblast tumor markers and its as the application of therapy target |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110468210A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111718960A (en) * | 2020-06-01 | 2020-09-29 | 南宁市第一人民医院 | Research method for researching proliferation function of RBM8A gene for promoting glioblastoma multiforme |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2012151523A1 (en) * | 2011-05-05 | 2012-11-08 | Novartis Ag | Csf-1r inhibitors for treatment of brain tumors |
CN108342482A (en) * | 2018-04-09 | 2018-07-31 | 中山大学 | A kind of glioblastoma marker and its application, kit |
CN109913420A (en) * | 2019-03-07 | 2019-06-21 | 北京师范大学 | Application of the CDC20 co-expression gene network as Treatment for Glioma target spot |
CN109913549A (en) * | 2019-03-07 | 2019-06-21 | 北京师范大学 | Glioma molecule parting and application based on CDC20 gene co-expressing network |
-
2019
- 2019-09-12 CN CN201910862416.7A patent/CN110468210A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2012151523A1 (en) * | 2011-05-05 | 2012-11-08 | Novartis Ag | Csf-1r inhibitors for treatment of brain tumors |
CN108342482A (en) * | 2018-04-09 | 2018-07-31 | 中山大学 | A kind of glioblastoma marker and its application, kit |
CN109913420A (en) * | 2019-03-07 | 2019-06-21 | 北京师范大学 | Application of the CDC20 co-expression gene network as Treatment for Glioma target spot |
CN109913549A (en) * | 2019-03-07 | 2019-06-21 | 北京师范大学 | Glioma molecule parting and application based on CDC20 gene co-expressing network |
Non-Patent Citations (3)
Title |
---|
FAN XUAN ET AL.: ""MINA53 deficiency leads to glioblastoma cell apoptosis via inducing DNA replication stress and diminishing DNA damage response"", 《CELL DEATH AND DISEASE》 * |
J. GRAEME HODGSON ET AL.: ""Comparative analyses of gene copy number and mRNA expression in glioblastoma multiforme tumors and xenografts"", 《NEURO-ONCOLOGY》 * |
翟中和等: "《细胞生物学》", 30 June 2011 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111718960A (en) * | 2020-06-01 | 2020-09-29 | 南宁市第一人民医院 | Research method for researching proliferation function of RBM8A gene for promoting glioblastoma multiforme |
CN111718960B (en) * | 2020-06-01 | 2023-09-22 | 南宁市第一人民医院 | Research method for researching RBM8A gene to promote proliferation function of glioblastoma |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
TWI609690B (en) | Use of alphavirus for preparing anti-cancer drug | |
CN105435228B (en) | New anti-tumor application of arsenic trioxide and anti-tumor preparation | |
CN103301447B (en) | Application of DNA (Deoxyribonucleic Acid)-PKcs in preparation of medicine for changing drug resistance of tumor cells on MTX (Methotrexate) | |
CN115300512B (en) | Use of ATR inhibitor VE-822 in the treatment of lung adenocarcinoma | |
CN101246169A (en) | Oral cavity squamous carcinoma diagnosis reagent, reagent kit and preventing and controlling medicament | |
CN107582550A (en) | Application of the QAB-149 in colorectal cancer is treated | |
CN108949768A (en) | A kind of RAB22A-NoeFs fusion system and its application for diagnosing and/or treating osteosarcoma | |
Shi et al. | Expression and prognostic role of orphan receptor GPR110 in glioma | |
CN104031884B (en) | The protein arginine transmethylase 7 application in cancer cell metastasis | |
CN113599524A (en) | Application of HNRNPC and RBMX as target points in preparation of products for treating small cell lung cancer | |
CN110468210A (en) | CDC45 is as glioblast tumor markers and its as the application of therapy target | |
CN109880902A (en) | A kind of application of long-chain non-coding RP11-499F3.2 in head and neck cancer clinical detection and the treatment of reversing tumor Cetuximab drug resistance | |
CN109750104A (en) | Application of the ABHD6 in Diagnosis of Non-Small Cell Lung, prognosis, treatment product | |
CN105727311A (en) | Application of RNASE4 serving as drug target to brain glioma inhibition drugs | |
CN103969452B (en) | The classification diagnosis kit of BAY 43-9006 personalized treatment liver cancer | |
CN109266743A (en) | A kind of cancer markers and application thereof | |
CN108660212A (en) | Application of the WDR1 genes in preparing Treatment for Non-small Cell Lung and detecting product | |
CN106636368A (en) | Application of miR-130a to diagnosis, treatment and prognosis of ovarian cancer | |
CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
CN115282282A (en) | Application of PDK 1-targeted glucose metabolism regulation reprogramming combined with metformin in treatment of patients with endometrial cancer complicated with diabetes | |
CN105582536B (en) | Application of AGPAT9 gene in preparation of liver cancer treatment drug and diagnosis and prognosis evaluation reagent | |
CN102643819B (en) | ShRNA of Rab23 and ientiviral vector and applications thereof | |
CN107412250B (en) | The application of miR-193a-3p | |
CN103417968A (en) | Application of poly cytosine binding protein-2 inhibitor to prepare medicaments for treating human glioma | |
CN104491877A (en) | Application of miRNA in preparing medicaments for treating esophageal cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191119 |