CN104342440A - CDKL1 gene, siRNA thereof, and applications of gene and siRNA - Google Patents
CDKL1 gene, siRNA thereof, and applications of gene and siRNA Download PDFInfo
- Publication number
- CN104342440A CN104342440A CN201310326922.7A CN201310326922A CN104342440A CN 104342440 A CN104342440 A CN 104342440A CN 201310326922 A CN201310326922 A CN 201310326922A CN 104342440 A CN104342440 A CN 104342440A
- Authority
- CN
- China
- Prior art keywords
- cdkl1
- seq
- gene
- dna
- sirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a separated target DNA of CDKL1 gene small interfering ribonucleic acid (siRNA). The target DNA is DNA with the sequence represented by anyone of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4. The invention also discloses a siRNA for inhibiting the expression of the CDKL1 gene, a recombinant vector for encoding the siRNA, a CDKL1 gene silenced cell line, and applications of the siRNA, the vector and the cell line. The sequence of the siRNA can specifically inhibit the expression of the CDKL1 gene, and can also be used for preparing or screening anticancer drugs. The siRNA is of important significance to study the mechanism of influences of the CDKL1 gene on primary drug resistance, proliferation and migration of tumors, and the clinical non-operation treatment of malignant tumors.
Description
Technical field
The invention belongs to biological technical field, in particular to a kind of small molecule disturbance ribonucleic acid target DNA of CDKL1 gene, suppress the nucleotide sequence of siRNA of CDKL1 genetic expression, the recombinant vectors of the described siRNA that encodes and in preparation and the purposes of screening in anticancer medicine.
Background technology
Carcinoma of gallbladder is modal malignant tumour in biliary system, account for the 5th of alimentary system malignant tumour, early stage carcinoma of gallbladder, without specific clinical manifestation, is in progressive stage when Most patients finds, the postoperative prognosis of advanced stage gallbladder cancer is very poor, and 5 annual survival rates are only 5%.The short major cause of Gallbladder Carcinoma Patients shorter survival is caused to be postoperative recurrence and transfer.Not may be used for the molecular target judging Gallbladder Carcinoma Patients postoperative metastasis clinically at present, not may be used for the potential targeted drug therapy target for the treatment of Nasopharyngeal neoplasms yet.
CDKL1 (cyclin-dependent kinase-like1 (CDC2-related kinase)) is cell cycle protein dependent kinase sample albumen 1.This albumen was in the news as far back as 1992, and Meyerson etc. devise the degenerated primer of the conserved sequence for cdc2 albumen, by the method for PCR, identified 7 new cdc2 associated kinases (cdc2related kinase) from cDNA library.One of them molecule being called as KKIALRE was named as CDKL1 (M Meyerson afterwards, GH Enders, CL Wu, LK Su, C Gorka, C Nelson, E Harlow, LH Tsai:A family of human cdc2-related protein kinases.EMBO J1992,11:2909-17).
About the function of CDKL1 molecule, understand considerably less at present.Have been reported Cdc2 in the cell cycle, regulating cell enters S phase (M Pacek, TA Prokhorova, JC Walter:Cdk1:unsung hero of S phase Cell Cycle2004,3:401-3), although and the structure of cdc2 there is higher similarity, up to the present whether to participate in cell cycle regulating still unknown for CDKL1.By the analysis to CDKL1 structure, CDKL1 contains a conservative map kinase dual phosphorylation structural domain (MAP kinase dual phosphorylation motif).This molecule can be activated by Urogastron (epidermal growth factor, EGF) and whole process does not need phosphorylation.In addition, studied by the immunohistochemical experiment for CDKL1 in brain, find this molecule mainly albumen be distributed in colloid, its major function may be affect spongiocyte to generate (SH Yen, A Kenessey, SC Lee, DW Dickson:The distribution and biochemical properties of a Cdc2-related kinase, KKIALRE, in normal and Alzheimer brains.J Neurochem1995,65:2577-84).
RNA interference phenomenon (RNA interference, RNAi) is a conservative defense mechanism in the autonomous organic evolution process produced in cell.SiRNA is considered to the main effects thing of RNA interference, has become a kind of effective tool by suppressing the expression of goal gene to study mammalian genes function.The siRNA of direct transfection synthesis specificity can suppress homogenic expression in zooblast, but in cell, siRNA is easy to degraded, and therefore this method can not realize stable RNA interference.Lentiviral vectors efficiency of infection in zooblast is high, and immunogenicity is low, and the cell that can infect division stage can infect again the cell of non-division stage.Due to these characteristics of virus vector, lentivirus mediated RNA Recombinant Interferon α-2b expresses siRNA steadily in the long term in all kinds of zooblast, inhibition of gene expression, therefore the method have efficiently, stablize, high specificity, applied widely specific, become the main research tool of RNA perturbation technique.The applied basic research that be applied as clinical tumor of RNA perturbation technique in biological medicine adds strong means.
Summary of the invention
Therefore, the technical problem to be solved in the present invention is exactly for the prognosis of tumour patient is very poor clinically at present, Post operation is very short for lifetime, lack the problem of the molecular diagnostic markers thing of effective predicting tumors initial drug-resistant and the molecular target for the treatment of tumour initial drug-resistant simultaneously, there is provided a kind of effective suppression CDKL1 siRNA molecule of genetic expression, the target DNA of described siRNA molecule effect and the application in preparation or screening antineoplastic drugs thereof.
The present invention solves the problems of the technologies described above one of technical scheme taked: a kind of CDKL1 gene small molecule disturbance ribonucleic acid target DNA of separation, and wherein said target DNA is:
(1) DNA of continuous 15 ~ 27 Nucleotide composition on CDKL1 encoding gene;
(2) sequence is as the DNA shown in any in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4; Or
(3) DNA that the polynucleotide of hybridizing under stringent hybridisation conditions with (1) or the DNA described in (2) form, or with the DNA of its complementation.
The CDKL1 gene small molecule disturbance ribonucleic acid target DNA molecular of separation of the present invention, is preferably made up of continuous 10 ~ 30 Nucleotide on CDKL1 gene coding region, is more preferably the DNA of 15 ~ 27 Nucleotide compositions; The DNA molecular as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 in sequence table any best.
DNA of the present invention is the DNA of this area routine, and its preparation method is preferably: extract from naturally occurring nucleotide sequence or obtain this DNA molecular by synthetic.
Wherein said hybridization conditions is classified according to the stringency degree of condition used during measurement hybridization.Stringency degree can the melting temperature(Tm) Tm of nucleic acid binding complex or probe be foundation, or with the salt of hybridization solution or ionic strength conditions for foundation.Described hybridization is preferably carried out at the standard conditions, can carry out according to the mode described in " molecular cloning ": Cold Spring Harbor Laboratory Press, the general scheme (Current Protocols in Molecular Biology) in molecular biology.Described polymerized nucleoside acid hybridization more preferably can carry out in accordance with the following steps, and the film and the label probe that one are loaded with transcribed DNA to be measured or RNA molecule are hybridized in hybridization buffer.The dilution inhibitor and 2 ~ 8 × SSC that consist of 0.1wt%SDS, 5wt% dextran glucosides, add 1/20 of hybridization buffer.20 × SSC is the solution of the citric acid composition of 3M sodium-chlor and 0.3M.Hybridization temperature is 50 ~ 70 DEG C.Cultivation several hours or after spending the night, clean film with cleaning buffer solution.Cleaning temperature is preferably room temperature, is preferably hybridization temperature.The composition of cleaning buffer solution is preferably 6 × SSC+0.1%SDS(wt) solution, be preferably 5 × SSC+0.1%SDS(wt).When with this cleaning buffer solution by Membrane cleaning after, just can by being identified DNA or RNA molecule by the mark on the probe of hybridizing in DNA or RNA molecule.
The present invention solves the problems of the technologies described above two of the technical scheme taked: the application of target DNA of the present invention in screening antineoplastic drugs.
Wherein said tumour is the conventional tumour in this area, is preferably carcinoma of gallbladder.Wherein said application is preferably, the purposes of target DNA of the present invention in the drug target of screening cancer therapy drug.
Wherein said drug target is this area conventional medicine target spot, and described drug target refers to medicine effect binding site in vivo.Rational drug design (rational drug design) can comprise the potential drug effect target position such as enzyme, acceptor, ionic channel, nucleic acid according to what disclose in life science, or the chemical structure characteristic of its endogenic ligand and natural substrate designs drug molecule, to find that selectively acting is in the new drug of target spot.By selection and the utilization of drug target, the efficiency of screening antineoplastic drugs can be improved, shorten the cycle of antitumor drug research.
The present invention solves the problems of the technologies described above three of the technical scheme taked: a kind of recombinant vectors, wherein said recombinant vectors comprises target DNA as above or comprises sequence as SEQ ID NO:5, DNA molecular shown in any one in SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.
The preparation method of wherein said target DNA is: the DNA molecular of synthetic or increased from genome by technology such as PCR and be separated to described DNA molecular.Recombinant vectors of the present invention preferably comprises SEQ ID NO:5, the DNA of any shown sequence in SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.
Wherein said recombinant vectors is selected from the carrier of this area routine.The carrier of described recombinant vectors preferably for being derived by virus, the carrier that described virus derives is preferably lentiviral vectors, adenovirus carrier, adenovirus related vector, herpesvirus vector or vaccinia virus vector, is lentiviral vectors best.Lentiviral vectors can make the DNA of coding siRNA be incorporated in the genome of host cell, produced the clone that specific gene is prevented by specificity, some virus vector can be used for transformant in body, thus can manipulate directly in body and the genetic expression of whole biology.
Wherein said lentiviral vectors refers to based on human immunodeficiency virus (HIV), the virus vector come by removing the virulent gene transformations such as env, vif, vpr, vpu.This virus vector vesicular stomatitis virus G glycoprotein replaces the coating of HIV-1 to pack, and host range is wide, can increase the titre of virus.The virulent gene of lentiviral vectors is deleted and replaced by foreign gene, and belong to pseudotype virus, and can not infect other cell again after this virus infected cell, biological safety is high.Lentiviral vectors all has infection ability to somatoblast and Unseparated Cell, and can longer-term is stable in vivo expression.The present invention's lentiviral vectors used is the lentiviral vectors of this area routine, is preferably pFH1UGW carrier.
The present invention solves the problems of the technologies described above four of the technical scheme taked: a kind of small molecule disturbance ribonucleic acid suppressing CDKL1 genetic expression, wherein said siRNA comprises just RNA fragment and antisense RNA fragment, described just RNA fragment comprises the RNA molecule of target DNA encoding described above, and described just RNA fragment and antisense RNA fragment complementaryly can form double stranded rna molecule.
SiRNA of the present invention is the siRNA of this area routine, and described siRNA is a kind of oligo rna molecule (length is generally at 21 ~ 25 Nucleotide), and the major function of siRNA molecule is the silence exciting target mRNA complementary with it.
SiRNA of the present invention comprises just RNA fragment and antisense RNA fragment, and the complementary pairing effect that described just RNA fragment and antisense RNA fragment pass through complementary base to each other forms double-stranded region.When just RNA fragment and antisense RNA fragment are positioned at different RNA chains, form double stranded rna molecule; When just RNA fragment and antisense RNA fragment are positioned at same RNA chain, then form the single strand RNA molecule with neck ring structure.Small molecule disturbance ribonucleic acid length of the present invention is preferably 8 ~ 50 Nucleotide, and base pair complementary between its sense fragment and antisense fragments is preferably 15 ~ 18 base pairs.
SiRNA of the present invention is preferably: SEQ ID NO:5 in sequence table, SEQ ID NO:6, DNA molecular shown in any one of SEQ ID NO:7 and SEQ ID NO:8 or the RNA sequence coded by its complementary sequence, the sequence of wherein said complementary DNA molecule is preferably SEQ ID NO:9 in sequence table, SEQ ID NO:10, shown in SEQ ID NO:11 and SEQ ID NO:12, described siRNA is preferably the complementary formation RNA molecule of double-strand or the RNA molecule of strand.
Ribonucleic acid molecule (RNA) described in the present invention or DNA molecules (DNA) are by the mode of synthetic or obtained by the mode from genome amplification, and its method is the method that this area routine uses.
SiRNA of the present invention preferably comprises: the double-chain interference RNA (dsRNA) of synthetic, processes the siRNA obtained after transfectional cell in cell by Dicer enzyme system; By the siRNA that synthetic directly obtains; Or by building corresponding lentiviral vectors, after transfected target cells, the siRNA that continuous expression obtains in target cells.
The present invention solves the problems of the technologies described above five of the technical scheme taked: a kind of lentiviral particle, and wherein said lentiviral particle comprises recombinant vectors of the present invention.
Described lentiviral particle (Lentivirus) is by HIV-1(human immune deficiency I C-type virus C) based on the gene therapy vector that grows up.Different from general retroviral vector, lentiviral particle all has infection ability to somatoblast and Unseparated Cell.
The preparation method of described lentiviral particle is this area ordinary method.Described preparation method preferably comprises: be building up in lentiviral vectors by the object fragment that siRNA disturbs, then with package carrier cotransfection in eukaryotic cell, described eukaryotic cell is preferably 293T cell, after cultivating, carry out the recovery purifying of slow virus, obtain packaged lentiviral particle.
The present invention solves the problems of the technologies described above six of the technical scheme taked: a kind of cell model of CDKL1 gene silencing, described cell model comprises lentiviral particle of the present invention.
Cell model of the present invention is preferably eukaryotic cell, is more preferably tumour cell, is gallbladder carcinoma cells system SGC-996 best.The preparation method of the cell model of CDKL1 gene silencing of the present invention is preferably for utilizing above-mentioned lentiviral particle transfecting eukaryotic cells.
Wherein said transfection method is this area ordinary method, it is preferably DEAE-dextran method, calcium phosphate method, cationic-liposome method, cationic polymers method, virus-mediated methods, biological particles passes method (particle gun Particle bombardment), microinjection or electroporation, the method for transfection of the present invention is more preferably calcium phosphate method.Packaged lentiviral particle is transfected in clone, screens, obtain the gene silencing cell model of genetic stability.
The cultural method of cell model of the present invention is this area conventional culture methods, and described cultural method preferably comprises the following steps: with the DMEM substratum of 10% serum, 37 DEG C, containing 5%CO
2cell culture incubator in cultivate, with the DMEM substratum containing 20% serum, 10%DMSO as frozen storing liquid freeze-stored cell, digest with the cell dissociation buffer containing 0.25% pancreatin and 0.02%EDTA.
The present invention solves the problems of the technologies described above seven of the technical scheme taked: the application of cell model in screening anticancer medicine of CDKL1 gene silencing of the present invention.
The application of cell model in screening antineoplastic drugs of described CDKL1 gene silencing preferably comprises the following steps:
(1) drug candidate is made to contact with the tumour cell of CDKL1 gene silencing;
(2) number of tumour cell is detected;
(3) drug candidate that tumor number is declined is selected.
The present invention's utilization does not carry out the Common tumors cell of CDKL1 gene silencing as a control group.According to the present invention, described tumour cell is preferably gallbladder carcinoma cells system SGC-996.The cell model utilizing the present invention to set up can carry out the research of tumour initial drug-resistant mechanism and tumor proliferation and amplification aspect.
The present invention solves the problems of the technologies described above eight of the technical scheme taked: small molecule disturbance ribonucleic acid of the present invention is preparing the application in anticancer medicine.
Application of the present invention is preferably the targeted drug of small molecule disturbance ribonucleic acid as a kind of cancer therapy drug.Application of the present invention is preferably a kind of pharmaceutical composition, and described pharmaceutical composition at least comprises a kind of small molecule disturbance ribonucleic acid of the present invention as activeconstituents and the pharmaceutically acceptable carrier of one.
Wherein said pharmaceutical composition preparation method is the method for this area routine, and described preparation method is preferably: using siRNA of the present invention as activeconstituents, makes various formulation with pharmaceutically acceptable carrier.Wherein said carrier is the pharmaceutical carrier of this area routine, as weighting agent, thinner and vehicle etc.In various preparation, the weight content of activeconstituents is preferably 0.1% ~ 99.9%, and preferred weight content is 0.5 ~ 90%.
Wherein said cancer is the cancer of this area routine, is preferably carcinoma of gallbladder.
The raw material that the present invention is used or reagent except special instruction, all commercially.
Compared to prior art, beneficial effect of the present invention is as follows: the present invention devises for CDKL1 gene RNA interfered target sequence, build corresponding CDKL1shRNA expression vector, its siRNA significantly can lower the expression of CDKL1 gene at mRNA level in-site and protein level.Use slow virus as genetic manipulation instrument, rna interference vector pFH1UGW-CDKL1-siRNA target efficiently can be imported tumour cell, the expression level of remarkable reduction CDKL1 gene, and then improve the chemotherapy drug susceptibility of described tumour cell, the multiplication capacity of initial drug-resistant tumor cell line, tumorigenesis ability and diffusibility are all significantly reduced, and are one of the potential clinical non-operative treatment modes of tumour particularly carcinoma of gallbladder.
The application of this patent obtains the subsidy of following fund: state natural sciences fund (81172026,81272402,81172029); Shanghai excellent academic leader project (11XD1403800); 863 national science and technology key special subjects (2012AA022606); China's post-doctors fund (2012M511107); Shanghai City post-doctor's fund (12R21415300); Shanghai Communications University medical professionals intersection item (YG2011ZD07); The inter-governmental international cooperative project of the Shanghai City State Scientific and Technological Commission (12410705900) and Shanghai City State Scientific and Technological Commission medical science guide project (12401905800).
Accompanying drawing explanation
Fig. 1 is pFH1UGW plasmid map.
The quantitative PCR result figure of Fig. 2 after the slow virus infection gallbladder carcinoma cells carrying siRNA.
The Western result figure of Fig. 3 after the slow virus infection gallbladder carcinoma cells carrying siRNA.
Fig. 4 is cell proliferation experiment MTT detected result figure.
Fig. 5 is that body outer clone forms experimental result picture.
Fig. 6 is transfer cell experimental cell count results figure.
Fig. 7 is transfer cell experiment detection light absorption value result figure.
Embodiment
Embodiment 1 designs siRNA sequence for CDKL1
The invention provides four siRNA effect target sequences for CDKL1 gene, its sequence is in table 1.
The siRNA effect target sequences of table 1CDKL1 gene
| Numbering | Sequence numbering | Sequence |
| siRNA-1 | SEQ ID NO:1 | CCAGCAAGTGTTTAGCACGAA |
| siRNA-2 | SEQ ID NO:2 | CACGAAACATTCCGTGATTAA |
| siRNA-3 | SEQ ID NO:3 | GCCATCAAGAAGTTTCTGGAA |
| siRNA-4 | SEQ ID NO:4 | CCTGAAGATATGGAACCACTT |
Embodiment 2 builds the carrier containing CDKL1-siRNA
1 primer synthesis and annealing
According to the sequence in above table, by the Shanghai Sheng Gong biotech firm positive-sense strand of composite coding (transcribing) above-mentioned siRNA and the DNA sequence dna of antisense strand respectively.Use ddH
2o is by for subsequent use to the concentration of 100 μMs for the serial dilution of synthesis.
The DNA sequence dna of 4 the coding siRNA positive-sense strands wherein synthesized is respectively:
（1）（SEQ ID NO:5）：
5’-CTAGCCGGCCAGCAAGTGTTTAGCACGAATTCAAGAGATTCGTGCTAAACACTTGCTGGTTTTTAAT-3；
（2）（SEQ ID NO:6）：
5’-CTAGCCGGCACGAAACATTCCGTGATTAATTCAAGAGATTAATCACGGAATGTTTCGTGTTTTTAAT-3’；
（3）（SEQ ID NO:7）：
5’-CTAGCCGGGCCATCAAGAAGTTTCTGGAATTCAAGAGAGCCATCAAGAAGTTTCTGGAATTTTTAAT-3’；
（4）（SEQ ID NO:8）：
5’-CTAGCCGGCCTGAAGATATGGAACCACTTTTCAAGAGAAAGTGGTTCCATATCTTCAGGTTTTTAAT-3’；
The DNA sequence dna of 4 the coding siRNA antisense strands wherein synthesized is respectively:
（5）（SEQ ID NO:9）：
5’-TAAAAACCAGCAAGTGTTTAGCACGAATCTCTTGAATTCGTGCTAAACACTTGCTGGCCGG-3’；
（6）（SEQ ID NO:10）：
5’-TAAAAACACGAAACATTCCGTGATTAATCTCTTGAATTAATCACGGAATGTTTCGTGCCGG-3’；
（7）（SEQ ID NO:11）：
5’-TAAAAAGCCATCAAGAAGTTTCTGGAATCTCTTGAATTCCAGAAACTTCTTGATGGCCCGG-3’；
（8）（SEQ ID NO:12）：
5’-TAAAAACCTGAAGATATGGAACCACTTTCTCTTGAAAAGTGGTTCCATATCTTCAGGCCGG-3’。
According to following ratio, above-mentioned each component is mixed: overall solution volume 50 μ l, comprise 5 μ l10x annealing buffers, the DNA sequence dna solution of 5 μ l coding positive-sense strands, the DNA sequence dna solution of 5 μ l encoding antisense chains and 35 μ lH
2o.By gained solution according to following program, carry out annealing reaction: (1) 90 DEG C 1 minute, (2) cool to 30 DEG C by 80 DEG C, and temperature fall time is 30 seconds, step (2) repeat 50 circulations, (4) 4 DEG C of preservations.
2. plasmid construction
The carrier used in the present invention is pFH1UGW, described carrier please refer to Publication about Document: shRNA knockdown of Bmi-1reveals a critical role for p21-Rb pathway in NSC self-renewal during development.Fasano CA, Dimos JT, Ivanova NB, Lowry N, Lemischka IR, Temple S Cell Stem Cell.2007Jun7.1 (1): 87-99, this plasmid map as shown in Figure 1.Utilize PacI/NheI double digestion carrier, according to following addition, each component is mixed.Carrier 5 μ l, water 11.8 μ l, 10 × enzyme cutting buffering liquid 2 μ l, 100 × BSA damping fluid 0.2 μ l, PacI0.5 μ l, NheI0.5 μ l, enzyme Qie Wendu 37 DEG C, enzyme cuts 6 hours.
Reclaim enzyme cut after carrier, carry out ligation with annealed product, ligation system is: carrier 0.5 μ l, annealed product 7.5 μ l, 10 × connect damping fluid 1 μ l, T4 ligase enzyme 1 μ l, room temperature connects 1 hour.Product conversion competent escherichia coli cell will be connected, after competent cell 37 DEG C is cultivated 12-16 hour, PCR is utilized to react qualification positive colony, primers designed wherein used is: 5 ' end universal primer, its sequence is sequence: GGCGGAAGGATCAGGAACG, 3 ' the end reverse primer of corresponding siRNA, as the reverse primer of PCR qualification.
Positive clone identification method is: select single colonies and cultivate 4 hours in 3ml LB substratum, concussion speed is 250rpm; According to following addition, each component is mixed: 2 × PCR mixed solution 7.5 μ l(days root company's T aq PCR MasterMix), H
2o4.5 μ l, bacterium liquid 2 μ l, 5' primer 0.5 μ l, 3' primer 0.5 μ l.
PCR qualification program is: (1) 94 DEG C 5 minutes, (2) 94 DEG C, 30 seconds, (3) 55 DEG C, 30 seconds, (4) 72 DEG C 1 minute, step (2)-(4) repeat 35 circulations, (5) 72 DEG C extension 7 minutes, (6) 4 DEG C of preservations.From the bacterium liquid being accredited as positive colony, namely extracting plasmid DNA obtains the CDKL1-siRNA expression plasmid built in a small amount, adopts the little extraction test kit of the plasmid of Tian Gen company in the present embodiment.Getting the above-mentioned little plasmid taken out of 5 μ l send company to check order, and determines that described four CDKL1-siRNA sequences have all correctly been inserted in pFH1UGW carrier.
Embodiment 3 expresses the virus packaging of CDKL1-siRNA
1 plasmid co-transfection
Detect plasmid concentration and purity: Example 2 prepares gained, expressing the pFH1UGW carrier for the siRNA sequence of siRNA-2 described in embodiment, obtaining the good plasmid of purifying by taking out in plasmid, detect through ultraviolet scene photometer, determine that gained plasmid concentration is 1.28 μ g/ μ l, (OD
260/ OD
280show without protein contamination between 1.75 ~ 2.0), be superhelix single tape through 0.8% ~ 1.0% agarose gel electrophoresis result display plasmid, pollute without RNA.
Plating cells: by collected by trypsinisation 293T cell (293T cell purchased from life science institute cellular resources center, Chinese Academy of Sciences Shanghai, article No.: GNHu17), with (perfect medium: DMEM+10%FBS after the dilution of suitable perfect medium.Substratum DMEM is purchased from Hyclone company, and article No. is: SH30243.01B; Foetal calf serum purchased from GIBCO company, article No.: 10099141; Microbiotic is purchased from Hyclone company, and article No.: SV30010, the working concentration of penicillin is 100U/mL, and the working concentration of Streptomycin sulphate is 100 μ g/mL) with 1 × 10
5to 4 × 10
5cell/cm
2density inoculating cell on Tissue Culture Dish.293T cell is placed in containing 5%CO
237 DEG C of incubators in hatch 8 ~ 24h, when cell attachment completely after namely start transfection.Liquid (replacing old substratum with fresh perfect medium) is changed in transfection for first 2 hours.
Prepare calcium phospate-DNA precipitate: DNA and CaCl
2mixing.In 60mm tissue culture dishes, react cumulative volume is 500 μ l.In aqua sterilisa, add plasmid DNA (3 ~ 5 μ g), then add 31 μ l2M CaCl
2, make three's cumulative volume reach 250 μ l, mixing.
By plasmid and CaCl
2mixture dropwise add 250 μ l(equal-volumes) 2 × HBS buffered soln.Flick tube wall simultaneously, make often to be added dropwise to rear timely mixing.After leaving standstill 20min, the calcium phosphate-DNA suspension of this 500 μ l is dropwise added in the cell culture medium of above-mentioned monolayer cell, shake plate mixing gently.
Be placed in containing 5%CO
237 DEG C of incubations.Cultivate (8 ~ 24h) after for some time and suck substratum with DNA precipitate, add the perfect medium of 5ml37 DEG C preheating, continue cell to place incubation, after cultivating 24 ~ 48h, observe the expression of albumen, and collection is viral.
2 viral purifications
The 293T cell culture supernatant of 48h after collection transfection; Use the centrifugal 10 ~ 15min of refrigerated centrifuge 3000 ~ 4000g, removing cell debris; Use 0.45 μm of filter filtration cell culture supernatant, and be dispensed in 40ml ultracentrifugation pipe; Viral crude extract sample is joined in filtering cup, builds lid; Filtering cup is inserted in collection tube; This filtration unit is the plus-20 centrifugal filter device of MILLIPORE; Assemble after strainer tube weight adjustment, put into whizzer; Centrifugal 10 ~ the 15min of 3000 ~ 4000g on refrigerated centrifuge; Take out centrifugal device after centrifugal end, filtering cup is separated with filtered liquid collection cups below; Filtering cup is tipped upside down on sample collection cup; Use the centrifugal 2 ~ 5min of refrigerated centrifuge 500 ~ 1000g; Centrifuge Cup is removed from sample collection cup; In sample collection cup, liquid is viral purification concentrated solution.
3 virus titers detect
(1) crude extract titer determination method:
Collect viral supernatants 4 DEG C preservation; Carry the day before yesterday at 96 orifice plate middle berth 293T cells, every porocyte number is: 2 × 10
4individual, volume is 100 μ l; Virus stock solution used is added in cell according to 100 μ l, 50 μ l, 20 μ l, 10 μ l, 1 μ l; Infect and observe fluorescence after 3 days; Determine a scale virus (Virus Standard product are ordered from Niu En biotech firm) simultaneously, do 10 at every turn
8, 10
7, 10
6standard substance.
(2) concentrating virus titer determination method:
Collect viral supernatants and carry out filtration and ultracentrifugation ,-80 DEG C frozen; Carry the day before yesterday at 96 orifice plate middle berth 293T cells, every porocyte number is: 4 × 10
4individual, volume is 100 μ l; According to the expection titre of virus, prepare 7 ~ 10 aseptic EP pipes, often pipe adds 90 μ l opti-MEM; Get virus-4 to be measured DEG C to thaw, draw 10 μ l and join in the 1st pipe, get 10 μ l after mixing and join in the 2nd pipe.Continue a same operation to the last pipe; Choose required cell hole, suck 90 μ l substratum, add the viral solution that 90 μ l have diluted, put into incubator and cultivate; After infecting 24h, add perfect medium 100 μ l, careful operation does not blow afloat cell; Infect after 3 days, observe fluorescence, fluorocyte number reduces with the increase of extension rate.
(3) titre method of calculation: according to the fluorescence situation of actual observation, suppose to observe 3 cells with fluorescence in the 8th pipe, illustrate in this hole to have 3 infestation with virus particles cell at least, then the titre of this virus equals cell count with fluorescence divided by virus stock solution used amount, the virus stock solution used amount of the 8th pipe is 1E-6 μ l, so titre=3/(1E-6)=3E+6, unit is TU/ μ l, namely equals 3E+9TU/ml.By above-mentioned virus titer method of calculation, the virus titer of known this packaging CDKL1-siRNA is 5 × 10e8TU/ml.
Embodiment 4MTT method detects the impact of CDKL1-siRNA for tumor cell proliferation ability
By gallbladder carcinoma cells system SGC-996 cell, (SGC-996 cell please refer to " foundation of people's primary gallbladder cancer clone SGC-996 ", Tongji University's journal (medicine), in December, 2003, the 24th volume the 6th phase) be inoculated in 12 orifice plates after trysinization, cell density is 10% ~ 15%; Within second day, be changed to fresh substratum, include 5 μ g/ml polybrene(polybrenes, polybrene adopts available from Sigma, article No.: H9268, CAS No.:28728-55-4); CDKL1-siRNA slow virus is joined in culture plate according to MOI=50, after infecting 6h, renews fresh substratum; After infecting 72h, take pictures at fluorescence microscopy Microscopic observation fluorescence, then to add up total cell count respectively and infect the cell count of virus, the numerical value calculating the cell count of the cell count that infects virus/total is efficiency of infection, statistics shows, efficiency of infection reaches 90%.
Detected the mrna expression level of CDKL1 in the gallbladder carcinoma cells system SGC-996 cell of slow virus infection by fluorescence quantifying PCR method, as shown in Figure 2, wherein * represents P < 0.05 to experimental result, has significant difference significantly.Fluorescent quantitative PCR result shows that the CDKL1mRNA expression amount of CDKL1 infection group and viral infection group cell significantly declines, and (real-time quantitative PCR experimental procedure is sketched: 1) lysing cell, and the intracellular total serum IgE of extracting; 2) by ultraviolet absorption method, measure the concentration of RNA and determine the quality of RNA; 3) by reverse transcription reaction, synthesis complementary DNA, i.e. cDNA; 4) standard substance of gradient dilution and the house-keeping gene (β-actin, is internal reference) of testing sample; 5) for the preparation of the DNA profiling drawing gradient dilution typical curve; 6) the testing gene real-time quantitative PCR reaction of testing sample.）。Detect the gallbladder carcinoma cells system SGC-996 of slow virus infection by Western method, (western experimental procedure is sketched: 1) collecting cell cracking, extracting total protein; 2) carry out quantitatively by BCA method to albumen; 3) every hole adds 10ug protein content, and carries out protein denaturation gel electrophoresis; 4) by the process of transferring film, albumen is transferred on pvdf membrane; 5) by BSA(bovine serum albumin) pvdf membrane is closed, reduce non-specific binding; 6) antibody added for CDKL1 is hybridized; 7) by enhanced chemiluminescence (ECL) detection systems that HRP mark two is anti-, signal is detected) experimental result as shown in Figure 3, this result shows to infect CDKL1 expressing quantity in the SGC-996 cell of CDKL1 virus and significantly reduces.
By be in logarithmic phase and infected viral cell, after trysinization, with the resuspended one-tenth cell suspension of perfect medium.Be inoculated in 96 orifice plates, every hole 100 μ l; Put into 37 DEG C of 5% CO2gas incubator to cultivate, cultivate and stop first 4 hours, add the MTT of 10 μ l5mg/ml; During detection, after abandoning nutrient solution, add 100 μ l DMSO termination reactions; Microplate reader 570nm detects OD value; And statistics.
OD value detected result as shown in Figure 4, MTT colorimetry result shows, with not comparing by slow virus infection or by the gallbladder carcinoma cells system SGC-996 of contrast slow virus infection, infect the slow virus SGC-996 cell carrying CDKL1-siRNA, advancing the speed of its cell number significantly reduces, the above results shows: after lowering CDKL1 genetic expression, the rate of propagation of tumour cell obviously reduces.
Embodiment 5CDKL1-siRNA is for the impact of tumour cell body outer clone Forming ability
After SGC-996 cell covers with, with trysinization, and be inoculated in 12 orifice plates, density is 10%-15%; Within second day, change the fresh culture containing 5 μ g/ml polybrene;
CDKL1-siRNA slow virus is joined in culture plate according to MOI=50, infects and change fresh culture after 6h hour; Infect after 72 hours, fluorescence microscopy Microscopic observation fluorescence, efficiency of infection reaches 90%.
By be in logarithmic phase and infected viral cell, after trysinization, with the resuspended one-tenth cell suspension of perfect medium.Be inoculated in 6 orifice plates after cell counting, inoculum density is 200 cells/well; Cultivate 14 days in the incubator of 37 DEG C of 5% carbonic acid gas, make the cell count of most single clone be greater than 50 cells, liquid is once changed and observation of cell state in every three days in midway; 14th day, first under fluorescent microscope, cell clone is taken pictures; Stop experiment: with 4% paraformaldehyde fixed cell, after PBS washed cell, dye with Giemsa stain, and take pictures.
The result of taking pictures is added up, only selects the cell mass be wherein made up of the cell count of 50 cells or more as a clone.Add up respectively in compared with control cells group/contrast infection group and viral infection group/CDKL1 infection group and viral infection group, clone's number that can be formed.
Result: as shown in Figure 5, body outer clone forms experiment display: relative to uninfecting virus group, (wherein said contrast virus is the slow virus of expressing control sequence with the experimental group having infected contrast virus, described control sequence refers to and can not cause one section of random nucleic acid sequence of expressing interference to any gene), clone's number that the SGC-996 cell gallbladder carcinoma cells of transfection CDKL1-siRNA can be formed reduces significantly, this experimental result shows: the SGC-996 cells in vitro tumorigenesis ability that CDKL1-siRNA slow virus is carried in transfection is greatly reduced.
Embodiment 6CDKL1-siRNA is for the impact of the external transfer ability of tumour cell
To shift cell (transwell) is put in incubator, makes its temperature reach room temperature; With 70% ethanol disinfection tweezers, with tweezers process transfer cell; Add 300ul room temperature serum free medium to little indoor, room temperature places 1 hour, makes ECM layer (extracellular matrix) aquation (hydration process of basilar membrane is to allow cell can carry out Infiltration and metastasis from basilar membrane better); After cell trysinization being got off, make 1X10e6/ml cell suspension with serum free medium; Substratum is removed carefully from little indoor; Add 500 μ l and contain 20%FBS(foetal calf serum) cultivation based in cell; By the above-mentioned ready cell suspension of 300 μ l in each cell; Cultivate 48 hours in incubator for tissue culture; Non-invasion and attack cell is removed gently with cotton swab; Add 500 μ l violet staining liquid in 6 orifice plates; Cell to be immersed in staining fluid 20 minutes, to invade cell in the lower surface dyeing of film; By soaking cell in a large water tumbler, rinsing for several times, in air, drying cell; Microscope is taken pictures, and counting cells number, its result is as shown in Figure 6; After acetate dissolution film, carry out absorbance detection, its result as shown in Figure 7.
According to result as shown in Figure 6 and Figure 7, after endogenous cellular CDKL1 genetic expression is cut down, the transfer ability of tumour cell significantly weakens, and illustrates that CDKL1 gene participates in the transfer process of modulate tumor cell.
Should be understood that those skilled in the art can make various changes or modifications the present invention after having read foregoing of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. the CDKL1 gene small molecule disturbance ribonucleic acid target DNA be separated, it is characterized in that, described CDKL1 gene small molecule disturbance ribonucleic acid target DNA is:
(1) DNA of continuous 15 ~ 27 Nucleotide composition on CDKL1 encoding gene;
(2) sequence is as the DNA shown in any in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4; Or
(3) DNA that the polynucleotide of hybridizing under stringent hybridisation conditions with (1) or the DNA described in (2) form, or with the DNA of its complementation.
2. the application of CDKL1 gene small molecule disturbance ribonucleic acid target DNA according to claim 1 in the medicine of screening anticancer.
3. apply as claimed in claim 2, it is characterized in that, described cancer is carcinoma of gallbladder.
4. a recombinant vectors, it is characterized in that, described recombinant vectors comprises CDKL1 gene small molecule disturbance ribonucleic acid target DNA as claimed in claim 1 or comprises as SEQ ID NO:5 in sequence table, DNA molecular shown in any one of SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.
5. one kind is suppressed the small molecule disturbance ribonucleic acid of CDKL1 genetic expression, it is characterized in that, described small molecule disturbance ribonucleic acid comprises just RNA fragment and antisense RNA fragment, described just RNA fragment comprises the RNA molecule of target DNA encoding described in claim 1, and described just RNA fragment and antisense RNA fragment complementaryly can form double stranded rna molecule.
6. a lentiviral particle, is characterized in that, it comprises recombinant vectors as claimed in claim 4.
7. a cell model for CDKL1 gene silencing, is characterized in that, it comprises lentiviral particle as claimed in claim 6.
8. the application of the cell model of CDKL1 gene silencing as claimed in claim 7 in the medicine of screening anticancer.
9. the application of small molecule disturbance ribonucleic acid in the medicine preparing anticancer of suppression CDKL1 according to claim 5 genetic expression.
10. the application as described in any one of claim 8 or 9, is characterized in that, described cancer is carcinoma of gallbladder.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310326922.7A CN104342440A (en) | 2013-07-30 | 2013-07-30 | CDKL1 gene, siRNA thereof, and applications of gene and siRNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310326922.7A CN104342440A (en) | 2013-07-30 | 2013-07-30 | CDKL1 gene, siRNA thereof, and applications of gene and siRNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104342440A true CN104342440A (en) | 2015-02-11 |
Family
ID=52498899
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310326922.7A Pending CN104342440A (en) | 2013-07-30 | 2013-07-30 | CDKL1 gene, siRNA thereof, and applications of gene and siRNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104342440A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111518808A (en) * | 2020-05-09 | 2020-08-11 | 上海交通大学医学院 | Three ribonucleic acid sequences with anti-tumor effect and application thereof |
| CN115088678A (en) * | 2022-07-21 | 2022-09-23 | 吉林大学 | Method for establishing and analyzing subcutaneous tumor formation animal model of gallbladder cancer |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1742086A (en) * | 2002-11-22 | 2006-03-01 | 生物智囊团株式会社 | Method of detecting target base sequence of RNA interference, method of designing polynucleotide base sequence causing RNA interference, method of constructing double-stranded polynucleotide, method o |
| CN101489547A (en) * | 2006-05-11 | 2009-07-22 | 科森生物科学公司 | Macrocyclic kinase inhibitors |
-
2013
- 2013-07-30 CN CN201310326922.7A patent/CN104342440A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1742086A (en) * | 2002-11-22 | 2006-03-01 | 生物智囊团株式会社 | Method of detecting target base sequence of RNA interference, method of designing polynucleotide base sequence causing RNA interference, method of constructing double-stranded polynucleotide, method o |
| CN101489547A (en) * | 2006-05-11 | 2009-07-22 | 科森生物科学公司 | Macrocyclic kinase inhibitors |
Non-Patent Citations (4)
| Title |
|---|
| ANIRUDH PRAHALLAD ET AL.: "Unresponsiveness of colon cancer to BRAF(V600E) inhibition through feedback activation of EGFR", 《NATURE》 * |
| JASON MOFFAT ET AL.: "A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen", 《CELL》 * |
| WEI SUN ET AL.: "A role for Cdkl1 in the development of gastric cancer", 《ACTA ONCOLOGICA》 * |
| 王晓明 梁志超: "CDKL1 基因在乳腺癌组织中的表达及其临床意义", 《临床肿瘤学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111518808A (en) * | 2020-05-09 | 2020-08-11 | 上海交通大学医学院 | Three ribonucleic acid sequences with anti-tumor effect and application thereof |
| CN111518808B (en) * | 2020-05-09 | 2023-07-14 | 上海交通大学医学院 | Three ribonucleic acid sequences with anti-tumor effect and application thereof |
| CN115088678A (en) * | 2022-07-21 | 2022-09-23 | 吉林大学 | Method for establishing and analyzing subcutaneous tumor formation animal model of gallbladder cancer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111979290B (en) | Application of SPP1 gene in preparation of medicine for enhancing sensitivity of ovarian cancer patient to PARP inhibitor | |
| Yang et al. | CircRNA_100876 promote proliferation and metastasis of breast cancer cells through adsorbing microRNA-361-3p in a sponge form. | |
| CN102892898A (en) | Diagnostic kit including micro-rna biomarkers and used for diagnosis of hepatocellular carcinoma, and method | |
| CN104611449B (en) | Application of the WWP1 genes in osteosarcoma diagnostic products and medicine is prepared | |
| CN104946646A (en) | Small nucleic acid molecules, DNA molecules and proteins for preventing and/or treating Ebola viral hemorrhagic fever and applications | |
| CN109908369B (en) | Application of novel circular RNA circCRKL in prostate cancer treatment | |
| CN108004322A (en) | A kind of applications of lncRNA in adenocarcinoma of lung is diagnosed and/or treated | |
| CN108823307B (en) | Application of PD-L1 spliceosome B as marker for guiding medication of anti-PD-L1/PD 1 immunotherapy | |
| CN104342440A (en) | CDKL1 gene, siRNA thereof, and applications of gene and siRNA | |
| CN110317878B (en) | Long-chain non-coding RNA for diagnosis and treatment monitoring of bladder cancer and application thereof | |
| CN106995857B (en) | Application of biomarker ENSG00000267416 in cancer | |
| CN107164528B (en) | Application of non-coding gene related to liver cancer occurrence and development | |
| CN102533763A (en) | Construction and use of lentivirus-mediated siRNA (small interfering RNA) recombinant 970 against VEGF-C (vascular endothelial growth factor C) gene | |
| CN106729756B (en) | Application of biomarker as target in diagnosis and treatment of lung adenocarcinoma | |
| CN110577952B (en) | Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer | |
| CN105457041B (en) | Application of miR-26a in non-small cell lung cancer | |
| CN112048558B (en) | OLFML2A gene and application of protein as glioma drug target | |
| Fang et al. | MIIP inhibits malignant progression of hepatocellular carcinoma through regulating AKT. | |
| CN103255137B (en) | A kind ofly detect the method for SKA1 genetic expression and the purposes of siRNA thereof | |
| CN106636368A (en) | Application of miR-130a to diagnosis, treatment and prognosis of ovarian cancer | |
| CN107184983B (en) | Diagnosis and treatment target for lung adenocarcinoma | |
| CN111926018A (en) | Application of substance for reducing USP1 expression in preparation of medicine for treating children T-line acute lymphoblastic leukemia | |
| CN111518905B (en) | Application of lncRNA in diagnosis and treatment of lung adenocarcinoma | |
| CN113789340B (en) | Expression vector of circular RNA hsa_circ_0001741, recombinant engineering bacterium and application thereof | |
| CN108624689A (en) | The application of biomarker LINC01451 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150211 |
|
| WD01 | Invention patent application deemed withdrawn after publication |