CN103333858B - Gleevec-resistant gastrointestinal stromal tumor cell line, method thereof, and nude mouse transplantation tumor model thereof - Google Patents

Abstract

The invention discloses a Gleevec-resistant gastrointestinal stromal tumor cell line, a method thereof, and a nude mouse transplantation tumor model thereof. Primary cell culture is performed on Gleevec-resistant gastrointestinal stromal tumor (GIST) tissues to construct a GIST-916 drug-resistant cell line. The GIST-916 cell line is characterized in that under an inversion microscope, the GIST-916 cell line is shown as non-overlapping monolayers, and cell growth is shown as fibroblast state and is long-shuttle shaped. The GIST-916 cell line has high drug resistance to Gleevec. When the concentration of the Gleevec is 0.05-3 [mu]M, the Gleevec has no obvious influence on the growth of the GIST-916 cell line largely, and when the concentration of the Gleevec is 3-5 [mu]M, the Gleevec has slight influence on the growth of the GIST-916 cell line. The GIST-916 cell line comprises KIT gene exon11 V559D primary mutation and exon13 V654A secondary mutation. GIST-916 drug-resistant transplantation tumor is in a type of mixing cells, and rhabdomyosarcoma differentiation can be seen in partial regions. In rhabdomyosarcoma differentiation regions, CD117 is negatively expressed, while Desmin is diffused and positively expressed. According to the invention, the Gleevec-resistant gastrointestinal stromal tumor cell line is constructed as a platform to reveal GIST drug-resistance mechanisms, reverse drug-resistance, and develop and evaluate novel anti-cancer drugs.

Description

The gastrointestinal stromal tumor cell-line of Gleevec resistance and method thereof and Nude Mouse Model

Technical field

The invention belongs to oncobiology field, relate to a kind of human gastrointestinal tract's mesenchymoma medicine-resistant cell line.Improve according to neutral protein enzymic digestion original cuiture method and/or tissue mass cell culture, from the GIST patient of 1 routine Gleevec Endodontic failure, successfully turn out the GIST cell-line of 1 strain Gleevec resistance, establish the gastrointestinal stromal tumor cell-line GIST-916 of Gleevec resistance.

Background technology

Gastrointestinal stromal tumor (gastrointestinal stromal tumor, GIST) intestines and stomach or Intraabdominal expressing K IT(CD117 is positioned at) leaf source property tumour between albumen, there is the gain-of-function sudden change of KIT gene in the overwhelming majority, KIT gene mutation plays crucial effect in GIST pathogenic process.Gleevec is the competitive inhibitor of a kind of oral ATP, the ATP-binding site of KIT tyrosine kinase functional areas can be incorporated into competitively, block phosphate group and transfer to protein substrate (KIT from ATP, PDGFRA, ABL and BCR-ABL fusion) tyrosine residue, thus blocked signal transduction pathway out of control, and then stoped the continuous proliferation of cell, and recover the normal apoptotic program of cell, be the important drugs of targeted therapy gastrointestinal stromal tumor.But generally after 24 months, will resistance be produced in Gleevec mean treatment, therefore study tumor drug resistance mechanism and prevent or the generation of reversing tumor resistance very important for raising targeted therapy effect.In recent years, tumor drug resistance cell-line oneself become important instrument, a large amount of research and utilization it disclose the resistance mechanism of tumour cell, reversal of drug resistance, the exploitation of study tumor cell and evaluate new anti-cancer methods etc.Set up tumor drug resistance cell-line and there is significant application value.Gleevec is the most frequently used medicine of targeted therapy gastrointestinal stromal tumor, is therefore necessary to set up gastrointestinal stromal tumor Gleevec medicine-resistant cell line as platform to disclose the resistance mechanism of GIST, reversing drug resistance and exploitation and the new cancer therapy drug etc. of evaluation.

Summary of the invention

The object of this invention is to provide a kind of gastrointestinal stromal tumor Gleevec medicine-resistant cell line and method for building up thereof, and a kind of resistance GIST cell Nude Mouse Model.

A kind of gastrointestinal stromal tumor cell-line of Gleevec resistance, preservation is called the gastrointestinal stromal tumor cell-line GIST-916 of Gleevec resistance, be preserved in China typical culture collection center (Luo Jia Shan, wuchang, wuhan Wuhan University, postcode: 430072), deposit number: CCTCC NO:C2012171, the preservation time is on November 8th, 2012.

Medicine-resistant cell line establishment step of the present invention is as follows: the capable primitive cell culture of Gastrointestinal Stromal tumor tissue of getting part Gleevec resistance, establishes GIST-916 medicine-resistant cell line.By optics microscope observing cell form, mtt assay detects index of cell drug-resistant, the gene mutation analysis of row medicine-resistant cell line, set up medicine-resistant cell line Nude Mouse Model and (become knurl situation and growth of transplanted human curve, histologic characteristics, Immunohistochemical detection CD117, Desmin, transplantable tumor gene mutation analysis).We find, GIST-916 has following characteristics: the individual layer of GIST primary cell in non-overlapping copies under inverted microscope of resistance, and Growth of Cells is fibroblast shape, is long shuttle-type; GIST-916 has stronger drug resistance to Gleevec; when Gleevec drug concentration is between 0.05-3 μM, the growth of cell-line is not obviously affected substantially; be subject to slight effect during 3-5 μM, but be subject to certain suppression in the growth of the high drug concentration lower part cell of >10 μM; GIST-916 cell-line comprises KIT gene exon11 1697T → A Val559Asp(V559D) primary mutation and exon13 1982T → C Val654Ala(V654A) secondary mutation.Medicine-resistant cell line Nude Mouse Model experiment display: along with the passing of inoculation time, the growth of GIST-916 tumour is accelerated gradually, and gross tumor volume increases gradually, and cell tumor formation rate is: GIST-916 group 60%(3/5); GIST-916 resistance transplantable tumor is mixed cell type, the visible rhabdomyosarcoma differentiation in subregion, and rhabdomyosarcoma differentiation region CD117 feminine gender is expressed, but Desmin fills the air positive expression; Other regions are CD117 positive expression then, and Desmin feminine gender is expressed; Suppress with cell-line, GIST-916 transplantable tumor comprises KIT gene exon11 V559D primary mutation and exon13 V654A secondary mutation equally.

A kind of resistance GIST cell Nude Mouse Model, establishment step is as follows:

Laboratory animal BALB/C/nu/nu strain nude mice, specific-pathogen free level, male and female are not limit, 3 ~ 4 weeks ages of mouse, body weight 19.0 ± 2.0g; GIST-916 cell-line inoculates 5 nude mices, is all inoculated in dorsal sc; It is raised and experiment is all carried out in specific-pathogen free environment;

Resistance GIST cell inoculation nude mice: collect resistance GIST cell-line number about 1 × 10 ⁷be inoculated in nude mice dorsal sc, be designated as inoculation next day the 1st day; Observe mice with tumor diet situation, the state of mind, tumor size and outward appearance every day, the longest vertical footpath (a) of nude mice body weight (g) and tumour, the longest transverse diameter (b) vertical with most major diameter is measured, according to formula V (gross tumor volume)=(1/2) × ab with every 10 days of slide measure ²calculate gross tumor volume, draw growth of transplanted human curve; After the median time growth quiescent stage of about 21 days, tumor growth rate is accelerated gradually, and along with the passing of inoculation time, the growth of tumour is accelerated gradually, and gross tumor volume increases gradually; From the inoculation date, within every 10 days, calculate the Volume rendering tumor growth curve of transplantable tumor, GIST-916 cell tumor formation rate 60%.

Beneficial effect of the present invention

For correlative study provides cells of resistant tumors model: study cells of resistant tumors morphology and Biological characteristics, research tumor drug resistance mechanism, analyze target therapeutic agent susceptibility and screening target therapeutic agent, exploitation tumor drug resistance reversal medicine, research and develop more effective tumor therapeuticing method etc.

Accompanying drawing explanation

Fig. 1. the primary GIST-916 cell observation figure of Gleevec resistance under inverted phase contrast microscope;

Fig. 2 .GIST cell line in vitro Gleevec medicament sensitivity test;

Before Fig. 3 .GIST-916 cells resistance, KIT exon11 V559D suddenlys change;

KIT exon13 V654A after Fig. 4 .GIST-916 cells resistance;

The gastrointestinal stromal tumor transplanted tumor in nude mice growth curve of Fig. 5 .Gleevec resistance;

Fig. 6 A.GIST-916 rhabdomyosarcoma differentiation region HE dyes;

Fig. 6 B.GIST-916 rhabdomyosarcoma differentiation region CD117 dyes;

Fig. 6 C.GIST-916 rhabdomyosarcoma differentiation region Desmin dyes;

Fig. 6 D.GIST-916 transplantable tumor CD117 dyes.

Embodiment

Embodiment 1

Medicine-resistant cell line establishment step is as follows:

Get the capable primitive cell culture of Gastrointestinal Stromal tumor tissue of part Gleevec resistance, portion of tissue sample-80 DEG C saves backup, and all the other samples are fixed, row HE and immunohistochemical detection after paraffin embedding.

(1) tissue mass cell culture

Get part Gastrointestinal Stromal tumor tissue, after the suspicious pollution in careful rejecting periphery and slough, 3 times are rinsed with the PBS liquid of 0.01mol/L, rinse 5-6 time with the serum-free RPMI-1640 containing 500 μ g/ml gentamicins, 500 μ g/ml streptomycins, 500U/ml penicillin again, tissue is cut into small pieces, be layered on equably in 25cm2 blake bottle, be placed in 37 DEG C, cultivate in the incubator of 5%CO2.After 1h, every hole adds medium 0.5m1, continues to cultivate.Within second day, add medium lml again.After this within every 3 days, liquid is changed once.Medium is for containing 15%FCS(hyclone) RPMI-1640.

(2) cultivation is digested

Get part Gastrointestinal Stromal tumor tissue, after the suspicious pollution in careful rejecting periphery and slough, 3 times are rinsed with the PBS liquid of 0.01mol/L, again with containing 500 μ g/ml gentamicins, 500 μ g/ml streptomycins, the serum-free RPMI-1640 of 500U/ml penicillin rinses 5-6 time, shred tissue to diameter <1mm with eye scissors as far as possible, 2 times are washed with serum-free RPMI-1640, add the neutral proteinase of the 1mg/ml of 2 times of volumes, 37 DEG C of digestion 60min, collect oncocyte that is single and fritter tissue, centrifuge washing 2 times, be inoculated in 25c ㎡ blake bottle, condition of culture is the RPMI-1640 containing 15%FCS.Inhale gently next day and abandon supernatant, change fresh medium, after this changed liquid once every 3 days.

Mdr cell is cultivated successfully, and this concentration mdr cell frozen is in liquid nitrogen in time.Cryopreserving liquid is made up of 20% calf serum, 5%DMSO, 75%PMI RPMI-1640, and frozen process should progressively be lowered the temperature, take 4 DEG C 30 minutes →-20 DEG C 1 hour →-70 DEG C spend the night → order of liquid nitrogen carries out.The recovery of freeze-stored cell is undertaken by following program: in the Tissue Culture Flask of a 25c ㎡, add at least 10ml contain the culture fluid of 15% hyclone; Take out from liquid nitrogen and the cryopreservation tube of cell is housed, put into 37 DEG C of water-baths immediately and shake gently and frozen thing was thawed at 1 minute, with taking into super-clean bench after cotton ball soaked in alcohol wiping cryopreservation tube outer wall; Cell suspension after thawing is moved into oneself have been added in the blake bottle of culture fluid, shake tear a little even, unscrew bottle cap, keep flat in CO2gas incubator, 37 DEG C, 5%CO2, to cultivate under 95% damp condition, change fresh medium 3 ~ 5ml after about 24 hour cells are adherent and continue to cultivate.

Embodiment 2

Morphological observation, Identification of Biological Characteristics, detection in Gene Mutation are carried out to the GIST-916 cell line set up:

1. inverted phase contrast microscope observes living cells form

The firm resistance primary cell being separated inoculation starts adherent in about 12 hours, and within 48 hours, trail, within 72 hours, full extension is opened, and the cell of original cuiture rises and starts propagation on the 5th day, within about 10-12 days, can go down to posterity.The individual layer of GIST primary cell in non-overlapping copies under inverted microscope of resistance, Growth of Cells is fibroblast shape, is long shuttle-type (Fig. 1).Go down to posterity after 1-2 generation, Growth of Cells is accelerated, and about 5-7 days goes down to posterity once.The 10-15 that goes down to posterity is slack-off for rear primary cell growth, and cell doubling time extends, cell shrinkage, and rear appearance is old and feeble, dead.

The external susceptibility checking of human gastrointestinal tract's mesenchymoma cell-line of 2.Gleevec resistance

The GIST-916 cell of taking the logarithm vegetative period, routine, by each strain cell-line of 0.25% Trypsin Induced, abandons supernatant after centrifugal, and after medium re-suspended cell, cell counting count board counting adjustment cell concentration is 3 × 10 ⁴/ ml, is inoculated in 96 orifice plates with every hole 100 μ l, is placed in 37 DEG C, cultivates in the incubator of 5%CO2.After 24h, add different final concentration Gleevec(0.05-50 μM), each concentration establishes 3 multiple Kong Bingshe control wells.After cultivating 72h, every hole adds the MTT20 μ l of 5mg/ml, and abandon supernatant after 37 DEG C of effect 4h, every hole adds dimethyl sulfoxide (DMSO) (DMSO) 150 μ l, and vibration 10min makes crystal mix, and reads absorbance (OD) at microplate reader 570nm wavelength place.Above step repeats 3 times at different time, and result gets average.Cell inhibitory rate is calculated, computing formula: cell inhibitory rate=(1-experimental group OD value/control group OD value) × 100% according to OD value.According to often kind of medicine variable concentrations inhibiting rate, utilize this medicine half-inhibition concentration (IC50) of Probit process computation in SPSS17.0 software Regression, judge the sensitivity/drug resistance (Fig. 2) of cell-line to Gleevec.GIST-916 has stronger drug resistance to Gleevec, when Gleevec drug concentration is between 0.05-3 μM, the growth of this cell-line is not obviously affected substantially, be subject to slight effect during 3-5 μM, but be subject to certain suppression in the growth of the high drug concentration lower part cell of >10 μM.

The gene mutation analysis of the GIST cell-line of 3.Gleevec resistance

(1). genome DNA extraction: according to eukaryotic genomic dna extracting (phenol/chloroform, alcohol settling DNA method) basic skills and improve.Collect after the direct Trypsin Induced of cell, 37 DEG C open dry, adds 500ul and digest buffer solution and 20 μ l Proteinase Ks (20 μ g/ μ l,), timing mixing, spend the night (55 DEG C or higher), become after clarification until liquid in pipe and take out, put 95 DEG C and boil 10 minutes inactivated proteases K; 600 μ l phenol chloroform liquid, mix 45 seconds (hand, otherwise easily cause DNA chain to rupture), the centrifugal 5min of 14000rpm, moves to supernatant liquid in new pipe, repeats extracting 2 times; 600 μ l chloroform liquid, mix 45 seconds (hand, otherwise easily cause DNA chain to rupture), the centrifugal 5min of 14000rpm, then supernatant liquid is moved to (attention: do not have impurity to suck) in new pipe.6-7 walks number of times can be increased, and retains situation depending on extracting rear impurity.1/10 volume 3M sodium acetate (alkaline solution, dissolve nucleic acid) mixing, then add 1ml-20 DEG C of absolute ethyl alcohol (promoting DNA deposition) and place more than 2 hours to-70 DEG C of refrigerators; More than 10000rpm rotating speed is centrifugal, abandons alcohol, and add 1ml-20 DEG C of 70% ethanol washing, centrifugal (in dissolving easily in water because of DNA, the ethanol wash time is unsuitable long), abandons alcohol, 37 DEG C of dryings (noting: can not fool too dry, anhydrous); Add TE40-50 μ l Eddy diffusion DNA, ultraviolet specrophotometer measures concentration, and markization DNA concentration is to 1.5ng/ml ,-20 DEG C of preservations.Standing 1-2 hour is needed before surveying concentration.

(2) .DNA concentration determination: the DNA solution good by extracting, with distilled water diluting 50 times, at wavelength 260nm place, distilled water is corrected to zero, then reads the A(distilled water of 280nm) value.Various kinds is originally detected at 260nm and 280nm place respectively, between different sample, distilled water flushing cuvette must be used.It is the A value of DNA that 260nm records, and it is the A value of protein that 280nm records.(A value is general reliably more stable more than 0.5, and error is little) DNA concentration conversion formula (unit ug/ml)=50 × A260nm × extension rate.OD value=A260nm ÷ A280nm, OD value is high in 1.6 ~ 1.8, DNA purity.

(3) synthesis of .PCR primer and amplification condition thereof

1) use software Primer Premier5.0 to design the amplification of primer performing PCR, KIT gene the 9th, 11,13,14,17 exons and PDGFRA gene l2, l8 exon totally 6 pairs of primers synthesizes (see table 1) by Shanghai Sheng Gong company.Amplified reaction replaces template as negative control using distilled water.

The primer of internal reference gene β-actin is presented by institute of oncology of Zhejiang University in addition:

Primer sequence: upstream: tcctgtggcatccacgaaact

Downstream: gaagcatttgcggtggacgat

Annealing temperature: 58 DEG C

Product length: 315bp

Table 1KIT gene the 9th, 11,13,14,17 exons and PDGFRA gene l2,14, l8 exon amplimer, annealing temperature and product fragment

(4) PCR primer detects: get 10 μ l PCR primer, carry out 1.5% agarose gel electrophoresis, DL 2000DNAMarker is as mark.Ultraviolet projectoscope is observed and takes a picture.

(5). sequencing analysis: after PCR primer is suitably preserved, serve purifying and sequencing analysis (ABI3100 sequenator) that the sea biological Co., Ltd of raw work carries out DNA.There is the case row reverse DNA order-checking confirmation again of sudden change, and compare with NCBI gene pool KIT and PDGFRA gene order.

KIT gene exon9,11,13,14,17 and PDGFRA gene exon12,14,18 mutant analysis results display: GIST-916 cell-line is KIT gene exon111697T → A Val559Asp(V559D) sudden change and exon13 1982T → C Val654Ala(V654A) secondary mutation; (Fig. 3,4) do not find PDGFRA gene mutation.

Embodiment 3

The foundation of resistance GIST cell Nude Mouse Model and qualification

1) knurl situation and growth of transplanted human curve is become

Laboratory animal: BALB/C/nu/nu strain nude mice provides (credit number: SYXK(Zhejiang) 2008-0115 by Zhejiang University of Traditional Chinese Medicine's animal experiment study center).Specific-pathogen free level, male and female are regardless of, 3 ~ 4 weeks ages of mouse, body weight 19.0 ± 2.0g.GIST-916 cell-line inoculates 5 nude mices, is all inoculated in dorsal sc.It is raised and experiment is all carried out in specific-pathogen free (specific pathogen free) environment.

Resistance GIST cell inoculation nude mice: collect resistance GIST cell-line number about 1 × 107 and be inoculated in nude mice dorsal sc, be designated as inoculation next day the 1st day.Observe mice with tumor diet situation, the state of mind, tumor size and outward appearance every day, the longest vertical footpath (a) of nude mice body weight (g) and tumour, the longest transverse diameter (b) vertical with most major diameter is measured with every 10 days of slide measure, calculate gross tumor volume according to formula V (gross tumor volume)=(1/2) × ab2, draw growth of transplanted human curve.

After the median time growth quiescent stage of about 21 days, tumor growth rate is accelerated gradually, and along with the passing of inoculation time, the growth of tumour is accelerated gradually, and gross tumor volume increases gradually.From the inoculation date, within every 10 days, calculate the Volume rendering tumor growth curve (Fig. 5) of transplantable tumor.GIST-916 cell tumor formation rate 60%(3/5).

2) histologic characteristics

Excision sample 4% formaldehyde is fixed, paraffin section, and row HE dyes, om observation.Under light microscopic, GIST-916 resistance transplantable tumor is mixed cell type, but the phenomenon of visible rhabdomyosarcoma differentiation in the form of subregion.(Fig. 6 A)

3) Immunohistochemical detection result

Immunohistochemical staining: immunohistochemistry adopts EnVision two step method, slice thick 4 μm, dimethylbenzene dewaxing, graded ethanol aquation, be placed in 3%H ₂o ₂interior 5min, deactivating endogenous peroxydase.Be placed in 0.01M citrate buffer solution, heating cools 20min after repairing antigen 20min naturally.Drip primary antibodie, incubated at room 4h, PBS rinse, 2min × 3 time; Drip two to resist, hatch 30min in 37 DEG C of incubators, PBS rinses 2min × 3 time; DAB develops the color, and distilled water flushing, haematoxylin are redyed, gradient alcohol dehydration, and dimethylbenzene is transparent, resinene sealing.Desmin, CD117 (resisting, dilution factor 1: 100) are Denmark DAKO Products more.Primary antibodie is replaced to make blank with PBS.

GIST-916 resistance transplantable tumor is mixed cell type, the visible rhabdomyosarcoma differentiation in subregion, and rhabdomyosarcoma differentiation region CD117 feminine gender expresses (Fig. 6 B), but Desmin fills the air positive expression (Fig. 6 C); Other regions are CD117 positive expression (Fig. 6 D) then, and Desmin feminine gender is expressed.

4) gene mutation analysis

The genome DNA extraction of GIST tissue, according to eukaryotic genomic dna extracting (phenol/chloroform, alcohol settling DNA method) basic skills and improve, increase before above-mentioned cell DNA extraction step :-80 DEG C are taken out GIST sample for subsequent use; In liquid nitrogen, ceramic mortar grinding, transfers in the 1.5ml Eppendorf pipe of weighing in advance when tissue is in powdery, weighs, must organize 50-100mg.Tissue DNA assay, PCR primer condition, the same cell line dna of sequence measurement.

KIT gene exon9,11,13,14,17 and PDGFRA gene exon12,18 mutant analysis results display, the mutation type of transplantable tumor is consistent with cell-line mutation type before inoculation, and GIST-916 transplantable tumor KIT gene exon11 1697T → A Val559Asp suddenlys change and exon13 1982T → C Val654Ala suddenlys change.Do not find PDGFRA gene mutation.

Claims (3)

1. a gastrointestinal stromal tumor cell-line for Gleevec resistance, preservation is called the gastrointestinal stromal tumor cell-line GIST-916 of Gleevec resistance, is preserved in China typical culture collection center, deposit number: CCTCC NO:C2012171.

2. the gastrointestinal stromal tumor cell-line of Gleevec resistance as claimed in claim 1, is characterized in that, the individual layer of primary cell in non-overlapping copies under inverted microscope of described GIST-916, and Growth of Cells is fibroblast shape, is long shuttle-type; GIST-916 does not obviously affect the growth of cell-line substantially when Gleevec drug concentration is between 0.05-3 μM, is subject to slight effect during 3-5 μM, but is suppressed in the growth of the high drug concentration lower part cell of >10 μM; GIST-916 cell-line comprises KIT gene exon11 1697 T → A Val559Asp(V559D) primary mutation and exon13 1982 T → C Val654Ala(V654A) secondary mutation.

3. adopt a construction method for the resistance GIST cell Nude Mouse Model of gastrointestinal stromal tumor cell-line as claimed in claim 1, it is characterized in that: establishment step is as follows:

Laboratory animal BALB/C/nu/nu strain nude mice, specific-pathogen free level, male and female are not limit, 3 ~ 4 weeks ages of mouse, body weight 19.0 ± 2.0g; GIST-916 cell-line inoculates 5 nude mices, is all inoculated in dorsal sc; It is raised and experiment is all carried out in specific-pathogen free environment;

Resistance GIST cell inoculation nude mice: collect resistance GIST cell-line number about 1 × 10 ⁷be inoculated in nude mice dorsal sc, be designated as inoculation next day the 1st day; Observe mice with tumor diet situation, the state of mind, tumor size and outward appearance every day, the longest vertical footpath (a) of nude mice body weight (g) and tumour, the longest transverse diameter (b) vertical with most major diameter is measured, according to formula V (gross tumor volume)=(1/2) × ab with every 10 days of slide measure ²calculate gross tumor volume, draw growth of transplanted human curve; After the median time growth quiescent stage of about 21 days, tumor growth rate is accelerated gradually, and along with the passing of inoculation time, the growth of tumour is accelerated gradually, and gross tumor volume increases gradually; From the inoculation date, within every 10 days, calculate the Volume rendering tumor growth curve of transplantable tumor, GIST-916 cell tumor formation rate 60%.