CN103333858A - Gleevec-resistant gastrointestinal stromal tumor cell line, method thereof, and nude mouse transplantation tumor model thereof - Google Patents

Abstract

The invention discloses a Gleevec-resistant gastrointestinal stromal tumor cell line, a method thereof, and a nude mouse transplantation tumor model thereof. Primary cell culture is performed on Gleevec-resistant gastrointestinal stromal tumor (GIST) tissues to construct a GIST-916 drug-resistant cell line. The GIST-916 cell line is characterized in that under an inversion microscope, the GIST-916 cell line is shown as non-overlapping monolayers, and cell growth is shown as fibroblast state and is long-shuttle shaped. The GIST-916 cell line has high drug resistance to Gleevec. When the concentration of the Gleevec is 0.05-3 [mu]M, the Gleevec has no obvious influence on the growth of the GIST-916 cell line largely, and when the concentration of the Gleevec is 3-5 [mu]M, the Gleevec has slight influence on the growth of the GIST-916 cell line. The GIST-916 cell line comprises KIT gene exon11V559D primary mutation and exon13V654A secondary mutation. GIST-916 drug-resistant transplantation tumor is in a type of mixing cells, and rhabdomyosarcoma differentiation can be seen in partial regions. In rhabdomyosarcoma differentiation regions, CD117 is negatively expressed, while Desmin is diffused and positively expressed. According to the invention, the Gleevec-resistant gastrointestinal stromal tumor cell line is constructed as a platform to reveal GIST drug-resistance mechanisms, reverse drug-resistance, and develop and evaluate novel anti-cancer drugs.

Description

The gastrointestinal stromal tumor clone of Gleevec resistance and method thereof and transplanted tumor in nude mice model

Technical field

The invention belongs to the oncobiology field, relate to a kind of human gastrointestinal tract's mesenchymoma medicine-resistant cell line.Also improve according to neutral protein enzymic digestion culture method of former generation and/or tissue mass cell culture, from the GIST patient of 1 routine Gleevec treatment failure, successfully turn out the GIST clone of 1 strain Gleevec resistance, set up the gastrointestinal stromal tumor clone GIST-916 of Gleevec resistance.

Background technology

Gastrointestinal stromal tumor (gastrointestinal stromal tumor, GIST) be positioned at gi tract or Intraabdominal expressing K IT(CD117) leaf source property tumour between albumen, there is the function gain mutation of KIT gene in the overwhelming majority, and crucial effect is brought into play in the KIT transgenation in the GIST pathogenic process.Gleevec is the competitive inhibitor of a kind of oral ATP, can be incorporated into the ATP-binding site of KIT Tyrosylprotein kinase functional zone competitively, the blocking-up phosphate group is transferred to protein substrate (KIT from ATP, PDGFRA, ABL and BCR-ABL fusion rotein) tyrosine residues, thereby blocked signal transduction pathway out of control, and then stop the lasting propagation of cell, and the normal apoptotic program of recovery cell, be the important drugs of targeted therapy gastrointestinal stromal tumor.Yet generally after 24 months, will produce resistance in the Gleevec mean treatment, therefore study tumor drug resistance mechanism and prevent or the generation of reversing tumor resistance very important for improving the targeted therapy effect.In recent years, oneself becomes important instrument tumor drug resistance clone, a large amount of research and utilizations it disclose tumour cell resistance mechanism, research tumour cell reversal of drug resistance, exploitation and estimate new anticancer method etc.Set up tumor drug resistance clone and have significant application value.Therefore Gleevec is the most frequently used medicine of targeted therapy gastrointestinal stromal tumor, is necessary to set up gastrointestinal stromal tumor Gleevec medicine-resistant cell line and discloses the new cancer therapy drug of resistance mechanism, reversing drug resistance and the exploitation of GIST and evaluation etc. as platform.

Summary of the invention

The purpose of this invention is to provide a kind of gastrointestinal stromal tumor Gleevec medicine-resistant cell line and establishment method thereof, and a kind of resistance GIST cell transplanted tumor in nude mice model.

A kind of gastrointestinal stromal tumor clone of Gleevec resistance, the gastrointestinal stromal tumor clone GIST-916 of preservation Gleevec resistance by name, be preserved in Chinese typical culture collection center (Lopa Nationality an ancient woman's ornament mountain, wuchang, wuhan Wuhan University, postcode: 430072), deposit number: CCTCC NO:C2012171, the preservation time is on November 8th, 2012.

Medicine-resistant cell line establishment step of the present invention is as follows: get the capable primary cell culture of gastrointestinal stromal tumor tissue of part Gleevec resistance, set up the GIST-916 medicine-resistant cell line.With optics microscope observing cell form, mtt assay detects index of cell drug-resistant, the gene mutation analysis of row medicine-resistant cell line, set up medicine-resistant cell line transplanted tumor in nude mice model and (become knurl situation and growth of xenografted curve, histologic characteristics, immunohistochemistry detects CD117, Desmin, transplanted tumor gene mutation analysis).We find that GIST-916 has following characteristics: the GIST primary cell of resistance is the individual layer of non-overlapping copies under inverted microscope, and the cell growth is the inoblast shape, is long shuttle type; The Gleevec of GIST-916 has stronger resistance, growth to clone when the Gleevec drug level is between 0.05-3 μ M does not have obviously influence substantially, be subjected to slight effect during 3-5 μ M, but the growth of the high drug level lower section cell of 10 μ M is subjected to certain inhibition; GIST-916 clone comprises KIT gene exon11 1697T → A Val559Asp(V559D) former sudden change and exon13 1982T → C Val654Ala(V654A) secondary mutation.The model experiment of medicine-resistant cell line transplanted tumor in nude mice shows: along with the passing of inoculation time, the GIST-916 growth of tumor is accelerated gradually, and gross tumor volume increases gradually, and the cell tumor formation rate is: GIST-916 organizes 60%(3/5); GIST-916 resistance transplanted tumor is mixed cell type, the visible rhabdosarcoma differentiation in subregion, and rhabdosarcoma is broken up the negative expression of regional CD117, but Desmin fills the air positive expression; Other zones are the CD117 positive expression then, and Desmin is negative to express; Suppress with clone, the GIST-916 transplanted tumor comprises former sudden change of KIT gene exon11 V559D and exon13 V654A secondary mutation equally.

A kind of resistance GIST cell transplanted tumor in nude mice model, establishment step is as follows:

Laboratory animal BALB/C/nu/nu strain nude mice, the specific-pathogen free level, male and female are not limit, mouse 3～4 weeks of age, body weight 19.0 ± 2.0g; 5 nude mices of GIST-916 clone inoculation, it is subcutaneous all to be inoculated in the back; Its raising and experiment are all carried out in the specific-pathogen free environment;

Resistance GIST cell inoculation nude mice: collect resistance GIST clone number about 1 * 10 ⁷It is subcutaneous to be inoculated in the nude mice back, is designated as inoculation the 1st day next day; Observe mice with tumor diet situation, the mental status, tumour size and outward appearance every day, measure the longest vertical footpath (a) of a nude mice body weight (g) and tumour, the longest transverse diameter (b) vertical with major diameter with per 10 days of vernier callipers, according to formula V (gross tumor volume)=(1/2) * ab ²Calculate gross tumor volume, draw the growth of xenografted curve; Through in bit time after about 21 days growth quiescent stage, tumor growth rate is accelerated gradually, along with the passing of inoculation time, growth of tumor is accelerated gradually, gross tumor volume increases gradually; From the inoculation date, calculated the volume of transplanted tumor in per 10 days and describe tumor growth curve, GIST-916 cell tumor formation rate 60%.

Beneficial effect of the present invention

For correlative study provides the drug-resistant tumor cell model: research drug-resistant tumor morphocytology and biology characteristics, research tumor drug resistance mechanism, analysis target therapeutic agent susceptibility and screening target therapeutic agent, exploitation tumor drug resistance reversal medicine, the more effective tumor therapeuticing method of research and development etc.

Description of drawings

Fig. 1. the former generation GIST-916 cell observation figure of Gleevec resistance under the inverted phase contrast microscope;

The external Gleevec medicament sensitivity test of Fig. 2 .GIST clone;

KIT exon11 V559D sudden change before Fig. 3 .GIST-916 cell resistance;

KIT exon13 V654A after Fig. 4 .GIST-916 cell resistance;

The gastrointestinal stromal tumor transplanted tumor in nude mice growth curve of Fig. 5 .Gleevec resistance;

Fig. 6 A.GIST-916 rhabdosarcoma is broken up regional HE dyeing;

Fig. 6 B.GIST-916 rhabdosarcoma is broken up regional CD117 dyeing;

Fig. 6 C.GIST-916 rhabdosarcoma is broken up regional Desmin dyeing;

Fig. 6 D.GIST-916 transplanted tumor CD117 dyeing.

Embodiment

Embodiment 1

The medicine-resistant cell line establishment step is as follows:

Get the capable primary cell culture of gastrointestinal stromal tumor tissue of part Gleevec resistance, portion of tissue sample-80 ℃ preservation is standby, and all the other samples are fixed, row HE and immunohistochemical detection behind the paraffin embedding.

(1) tissue mass cell culture

Get part gastrointestinal stromal tumor tissue, behind the careful rejecting suspicious pollution of periphery and the necrotic tissue, PBS liquid with 0.01mol/L washes 3 times, again with the serum-free RPMI-1640 flushing that contains 500 μ g/ml gentamicins, 500 μ g/ml Streptomycin sulphates, 500U/ml penicillin 5-6 time, tissue is cut into small pieces, be layered on equably in the 25cm2 culturing bottle, place 37 ℃, cultivate in the incubator of 5%CO2.Behind the 1h, every hole adds substratum 0.5m1, continues to cultivate.Added substratum lml in second day again.After this changed liquid once in per 3 days.Substratum is for containing the 15%FCS(foetal calf serum) RPMI-1640.

(2) digestion culture method

Get part gastrointestinal stromal tumor tissue, behind the careful rejecting suspicious pollution of periphery and the necrotic tissue, PBS liquid with 0.01mol/L washes 3 times, again with containing 500 μ g/ml gentamicins, 500 μ g/ml Streptomycin sulphates, the serum-free RPMI-1640 flushing of 500U/ml penicillin 5-6 time, shred with eye scissors as far as possible and to organize to diameter＜1mm, wash 2 times with serum-free RPMI-1640, the neutral protease that adds the 1mg/ml of 2 times of volumes, 37 ℃ of digestion 60min, collect the oncocyte of single and little block organization, centrifuge washing 2 times is inoculated in the 25c ㎡ culturing bottle, and culture condition is the RPMI-1640 that contains 15%FCS.Inhale gently next day and abandon supernatant liquor, renew bright nutrient solution, after this changed liquid once every 3 days.

After mdr cell was cultivated successfully, in time frozen this concentration mdr cell was in liquid nitrogen.Frozen storing liquid is made up of 20% calf serum, 5%DMSO, 75%PMI RPMI-1640, and frozen process should progressively be lowered the temperature, take 4 ℃ 30 minutes →-20 ℃ 1 hour →-70 ℃ to spend the night → order of liquid nitrogen carries out.The recovery of freeze-stored cell is undertaken by following program: add the nutrient solution that 10ml at least contains 15% foetal calf serum in the Tissue Culture Flask of a 25c ㎡; From liquid nitrogen, take out the frozen pipe that cell is housed, put into 37 ℃ of water-baths immediately and shake gently frozen thing was thawed at 1 minute, with taking into super clean bench behind the frozen pipe outer wall of cotton ball soaked in alcohol wiping; Cell suspension after will thawing moves into oneself and has added in the culturing bottle of nutrient solution, it is even to shake tear a little, unscrews bottle cap, keeps flat in the CO2gas incubator, under 37 ℃, 5%CO2,95% humidity condition, cultivate, renew bright nutrient solution 3～5ml after about 24 hour cells are adherent and continue to cultivate.

Embodiment 2

The GIST-916 cell strain of setting up is carried out morphological observation, biological characteristics evaluation, detection in Gene Mutation:

1. inverted phase contrast microscope is observed the viable cell form

The resistance primary cell beginning in about 12 hours that has just separated inoculation is adherent, trails in 48 hours, and full extension was opened in 72 hours, former generation cultured cells rose in the 5th day and begin propagation, can go down to posterity in about 10-12 days.The GIST primary cell of resistance is the individual layer of non-overlapping copies under inverted microscope, the cell growth is the inoblast shape, is long shuttle type (Fig. 1).Go down to posterity 1-2 after generation, and the cell growth is accelerated, and goes down to posterity once in about 5-7 days.The 10-15 that goes down to posterity is slack-off for back primary cell growth, and cell doubling time prolongs, cell shrinkage, and the back occurs old and feeble, dead.

2.Gleevec the external susceptibility checking of human gastrointestinal tract's mesenchymoma clone of resistance

The GIST-916 cell of taking the logarithm vegetative period, conventional with each strain clone of 0.25% tryptic digestion, abandon supernatant after centrifugal, behind the substratum re-suspended cell, cell counting count board counting adjustment cell concn is 3 * 10 ⁴/ ml is inoculated in 96 orifice plates with every hole 100 μ l, places 37 ℃, cultivates in the incubator of 5%CO2.Behind the 24h, add different final concentration Gleevec(0.05-50 μ M), each concentration is established 3 multiple Kong Bingshe control wells.After cultivating 72h, every hole adds the MTT20 μ l of 5mg/ml, abandons supernatant behind 37 ℃ of effect 4h, and every hole adds dimethyl sulfoxide (DMSO) (DMSO) 150 μ l, and vibration 10min makes the crystallisate mixing, and the place reads absorbance (OD) at microplate reader 570nm wavelength.Above step repeats 3 times at different time, and the result gets average.Calculate cell inhibitory rate, calculation formula: cell inhibitory rate=(1-experimental group OD value/control group OD value) * 100% according to the OD value.According to every kind of medicine different concns inhibiting rate, utilize the Probit process among the SPSS17.0 software Regression to calculate this medicine half-inhibition concentration (IC50), judge that clone is to sensitivity/resistance (Fig. 2) of Gleevec.The Gleevec of GIST-916 has stronger resistance, growth to this clone when the Gleevec drug level is between 0.05-3 μ M does not have obviously influence substantially, be subjected to slight effect during 3-5 μ M, but the growth of the high drug level lower section cell of 10 μ M is subjected to certain inhibition.

3.Gleevec the gene mutation analysis of the GIST clone of resistance

(1). genome DNA extraction: the basic skills according to eukaryotic genomic dna extracting (phenol/chloroform extracting, ethanol sedimentation DNA method) also improves.Collect behind the direct tryptic digestion of cell, 37 ℃ open dry, adds 500ul digestion damping fluid and 20 μ l Proteinase Ks (20 μ g/ μ l,), the timing mixing, (55 ℃ or higher) spend the night, treat that liquid becomes the taking-up of clarification back in the pipe, put 95 ℃ and boil 10 minutes inactivated proteases K; 600 μ l phenol chloroform extracts, mixing 45 seconds (hand getting final product, otherwise cause the DNA splitting of chain easily), the centrifugal 5min of 14000rpm moves to supernatant liquid in the new pipe, repeats extracting 2 times; 600 μ l chloroform extracts, mixing 45 seconds (hand getting final product, otherwise cause the DNA splitting of chain easily), the centrifugal 5min of 14000rpm moves to supernatant liquid in the new pipe again and (notes: do not have impurity to suck).6-7 step number of times can increase, and decides on the extracting rear impurity situation of retaining.1/10 volume 3M sodium acetate (basic solution, dissolving nucleic acid) mixing adds 1ml-20 ℃ of dehydrated alcohol (promoting the DNA deposition) to-70 ℃ of refrigerators again and places more than 2 hours; The above rotating speed of 10000rpm is centrifugal, abandons alcohol, adds 1ml-20 ℃ of 70% washing with alcohol, centrifugal (because during DNA dissolved easily in water, the alcohol washing time was unsuitable long), abandons alcohol, 37 ℃ of dryings (noting: can not fool too driedly, anhydrous getting final product); Add the TE40-50 μ l DNA that suspends again, ultraviolet spectrophotometer is measured concentration, and markization DNA concentration is to 1.5ng/ml ,-20 ℃ of preservations.Need leave standstill 1-2 hour before surveying concentration.

(2) .DNA concentration determination: the dna solution that extracting is good, with 50 times of distilled water dilutings, proofreading and correct with distilled water at wavelength 260nm place is zero, reads the A(distilled water of 280nm then) value.Various kinds is originally detected at 260nm and 280nm place respectively, between different samples, must use the distilled water flushing cuvette.It is the A value of DNA that 260nm records, and it is the A value of protein that 280nm records.(generally more stable reliable more than 0.5, error is little for the A value) DNA concentration conversion formula (ug/ml of unit)=50 * A260nm * extension rate.OD value=A260nm ÷ A280nm, the OD value is at 1.6～1.8, DNA purity height.

(3) the synthetic and amplification condition of .PCR primer

1) use the amplification of software Primer Premier5.0 design primer performing PCR, KIT gene the 9th, 11,13,14, No. 17 exons and PDGFRA gene l2, totally 6 pairs of primers of l8 exon is given birth to worker company synthetic (seeing Table 1) by Shanghai.Amplified reaction replaces template as negative control with distilled water.

Presented by the Zhejiang University institute of oncology with reference to the primer of gene β-actin in addition:

Primer sequence: upstream: tcctgtggcatccacgaaact

Downstream: gaagcatttgcggtggacgat

Annealing temperature: 58 ℃

Product length: 315bp

Table 1KIT gene the 9th, 11,13,14, No. 17 exons and PDGFRA gene l2,14, l8 exon amplimer, annealing temperature and product fragment

(4) the PCR product detects: get 10 μ l PCR products, carry out 1.5% agarose gel electrophoresis, DL 2000DNA Marker is thing as a token of.Observe on the ultraviolet projectoscope and photograph.

(5). sequencing analysis: after the suitable preservation of PCR product, serve the sea and give birth to purifying and the sequencing analysis (ABI3100 sequenator) that the biological company limited of worker carries out DNA.The case capable reverse DNA order-checking confirmation again of sudden change is arranged, and compare with NCBI gene pool KIT and PDGFRA gene order.

KIT gene exon9,11,13,14,17 and PDGFRA gene exon12,14,18 mutation analysis results show: GIST-916 clone is KIT gene exon111697T → A Val559Asp(V559D) sudden change and exon13 1982T → C Val654Ala(V654A) secondary mutation; (Fig. 3,4) do not find the PDGFRA transgenation.

Embodiment 3

Foundation and the evaluation of resistance GIST cell transplanted tumor in nude mice model

1) becomes knurl situation and growth of xenografted curve

Laboratory animal: BALB/C/nu/nu strain nude mice provides (credit number: SYXK(Zhejiang) 2008-0115) by Zhejiang University of Traditional Chinese Medicine animal experiment study center.The specific-pathogen free level, male and female are regardless of, mouse 3～4 weeks of age, body weight 19.0 ± 2.0g.5 nude mices of GIST-916 clone inoculation, it is subcutaneous all to be inoculated in the back.Its raising and experiment are all carried out in specific-pathogen free (specific pathogen free) environment.

Resistance GIST cell inoculation nude mice: it is subcutaneous that collection resistance GIST clone number about 1 * 107 is inoculated in the nude mice back, is designated as inoculation the 1st day next day.Observe mice with tumor diet situation, the mental status, tumour size and outward appearance every day, measure the longest vertical footpath (a) of a nude mice body weight (g) and tumour, the longest transverse diameter (b) vertical with major diameter with per 10 days of vernier callipers, calculate gross tumor volume according to formula V (gross tumor volume)=(1/2) * ab2, draw the growth of xenografted curve.

Through in bit time after about 21 days growth quiescent stage, tumor growth rate is accelerated gradually, along with the passing of inoculation time, growth of tumor is accelerated gradually, gross tumor volume increases gradually.From the inoculation date, calculated the volume of transplanted tumor in per 10 days and describe tumor growth curve (Fig. 5).GIST-916 cell tumor formation rate 60%(3/5).

2) histologic characteristics

Excision sample 4% formaldehyde fixed, paraffin section, row HE dyeing, om observation.GIST-916 resistance transplanted tumor is mixed cell type under the light microscopic, but the phenomenon of visible rhabdosarcoma differentiation on the form of subregion.(Fig. 6 A)

3) immunohistochemistry detected result

Immunohistochemical staining: immunohistochemistry adopts the EnVision two step method, slice thick 4 μ m, and dimethylbenzene dewaxing, gradient alcohol aquation place 3%H ₂O ₂Interior 5min, deactivating endogenous peroxydase.Place the 0.01M citrate buffer solution, after antigen 20min is repaired in heating, naturally cooling 20min.Drip primary antibodie, incubated at room 4h, PBS flushing, 2min * 3 time; Drip two anti-ly, hatch 30min in 37 ℃ of incubators, PBS flushing 2min * 3 time; The DAB colour developing, distilled water flushing, Hematorylin are redyed, gradient alcohol dehydration, dimethylbenzene is transparent, the resinene sealing.Desmin, CD117 (how anti-, extent of dilution 1: 100) are Denmark DAKO company product.Replace primary antibodie to make blank with PBS.

GIST-916 resistance transplanted tumor is mixed cell type, the visible rhabdosarcoma differentiation in subregion, and rhabdosarcoma is broken up the negative expression of regional CD117 (Fig. 6 B), but Desmin fills the air positive expression (Fig. 6 C); Other zones are CD117 positive expression (Fig. 6 D) then, and Desmin is negative to express.

4) gene mutation analysis

The genome DNA extraction of GIST tissue according to the basic skills of eukaryotic genomic dna extracting (phenol/chloroform extracting, ethanol sedimentation DNA method) and improve, increases before above-mentioned cell DNA extraction step :-80 ℃ of GIST samples that taking-up is standby; Ceramic mortar is ground in the liquid nitrogen, transfers in the 1.5ml Eppendorf pipe of weighing in advance when tissue is powdery, weighs, and must organize 50-100mg.Tissue DNA assay, PCR primer condition, the same cell line dna of sequence measurement.

KIT gene exon9,11,13,14,17 and PDGFRA gene exon12,18 mutation analysis results show, the mutation type of transplanted tumor is consistent with clone mutation type before the inoculation, GIST-916 transplanted tumor KIT gene exon11 1697T → A Val559Asp sudden change and exon13 1982T → C Val654Ala sudden change.Do not find the PDGFRA transgenation.

Claims (4)

1. the gastrointestinal stromal tumor clone of a Gleevec resistance, the gastrointestinal stromal tumor clone GIST-916 of preservation Gleevec resistance by name is preserved in Chinese typical culture collection center, deposit number: CCTCC NO:C2012171.

2. the gastrointestinal stromal tumor clone of Gleevec resistance as claimed in claim 1 is characterized in that, the primary cell of described GIST-916 is the individual layer of non-overlapping copies under inverted microscope, and the cell growth is the inoblast shape, is long shuttle type; GIST-916 does not have obviously influence substantially to the growth of clone when the Gleevec drug level is between 0.05-3 μ M, be subjected to slight effect during 3-5 μ M, but the growth of the high drug level lower section cell of 10 μ M is suppressed; GIST-916 clone comprises KIT gene exon11 1697 T → A Val559Asp(V559D) former sudden change and exon13 1982 T → C Val654Ala(V654A) secondary mutation.

3. the establishment method of the gastrointestinal stromal tumor clone of a Gleevec resistance as claimed in claim 1, it is characterized in that: step is as follows:

1) a, tissue block are cultivated

Get gastrointestinal stromal tumor (GIST) tissue of Gleevec resistance, PBS with 0.01 mol/L washes 3 times, again with the serum-free 3 microbiotic RPMI-1640 flushing that contains 500 μ g/ml gentamicins, 500 μ g/ml Streptomycin sulphates and 500U/ml penicillin 5-6 time, the gastrointestinal stromal tumor tissue is cut into small pieces, is layered on 25cm equably ²In the culturing bottle, place 37 ℃, 5% CO ₂Incubator in cultivate; After 1 hour, every bottle adds substratum 0.5m1, continues to cultivate; Add substratum 1ml after 18 hours again; After this changed liquid once in per 3 days, described substratum is for containing 15% foetal calf serum, 3 microbiotic RPMI-1640;

Or b, digestion cultivate

Get the gastrointestinal stromal tumor tissue of Gleevec resistance, PBS liquid with 0.01 mol/L washes 3 times, again with containing 500 μ g/ml gentamicins, the serum-free 3 microbiotic RPMI-1640 flushing of 500 μ g/ml Streptomycin sulphates and 500U/ml penicillin 5-6 time, shred with eye scissors and to organize to diameter＜1mm, 3 microbiotic RPMI-1640 wash 2 times with serum-free, the neutral protease that adds the 1mg/ml that shreds 2 times of volumes of tissue, 37 ℃ of digestion 60min, collect the gastrointestinal stromal tumor cell of single and little block organization, centrifuge washing 2 times, be inoculated in the 25c ㎡ culturing bottle, substratum is the 3 microbiotic RPMI-1640 that contain 15%FCS, inhales gently next day and abandons supernatant liquor, renews bright substratum, after this changed liquid every 3 days once up to the cultivation of going down to posterity, the Gleevec mdr cell liquid nitrogen cryopreservation preservation of half;

2) mdr cell preservation and recovery

Frozen storing liquid is made up of 20% calf serum, 5%DMSO, 75% PMI RPMI-1640, and frozen process should progressively be lowered the temperature, take 4 ℃ 30 minutes →-20 ℃ 1 hour →-70 ℃ to spend the night → order of liquid nitrogen carries out; The recovery of frozen Gleevec mdr cell is undertaken by following program: add the nutrient solution that 10ml contains 15% foetal calf serum in the Tissue Culture Flask of a 25c ㎡; From liquid nitrogen, take out the frozen pipe that the Gleevec mdr cell is housed, putting into 37 ℃ of water-baths immediately shakes gently frozen thing was thawed at 1 minute, the Gleevec mdr cell suspension that will thaw behind the PBS centrifugal elutriation with 0.01 mol/L moves into oneself and has added in the culturing bottle that contains 15% foetal calf serum, 3 microbiotic RPMI-1640, it is even to shake tear a little, unscrew bottle cap, keep flat in the CO2gas incubator, at 37 ℃, 5%CO ₂, cultivate under 95% humidity condition, renew bright nutrient solution 3 ~ 5ml after about 24 hour cells are adherent and continue to cultivate.

4. resistance GIST cell transplanted tumor in nude mice model, it is characterized in that: establishment step is as follows:

Laboratory animal BALB/C/nu/nu strain nude mice, the specific-pathogen free level, male and female are not limit, mouse 3～4 weeks of age, body weight 19.0 ± 2.0g; 5 nude mices of GIST-916 clone inoculation, it is subcutaneous all to be inoculated in the back; Its raising and experiment are all carried out in the specific-pathogen free environment;

Resistance GIST cell inoculation nude mice: collect resistance GIST clone number about 1 * 10 ⁷It is subcutaneous to be inoculated in the nude mice back, is designated as inoculation the 1st day next day; Observe mice with tumor diet situation, the mental status, tumour size and outward appearance every day, measure the longest vertical footpath (a) of a nude mice body weight (g) and tumour, the longest transverse diameter (b) vertical with major diameter with per 10 days of vernier callipers, according to formula V (gross tumor volume)=(1/2) * ab ²Calculate gross tumor volume, draw the growth of xenografted curve; Through in bit time after about 21 days growth quiescent stage, tumor growth rate is accelerated gradually, along with the passing of inoculation time, growth of tumor is accelerated gradually, gross tumor volume increases gradually; From the inoculation date, calculated the volume of transplanted tumor in per 10 days and describe tumor growth curve, GIST-916 cell tumor formation rate 60%.

Images