CN106754731B - The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application - Google Patents
The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application Download PDFInfo
- Publication number
- CN106754731B CN106754731B CN201710100941.6A CN201710100941A CN106754731B CN 106754731 B CN106754731 B CN 106754731B CN 201710100941 A CN201710100941 A CN 201710100941A CN 106754731 B CN106754731 B CN 106754731B
- Authority
- CN
- China
- Prior art keywords
- mrgprx2
- cell
- membrane
- stationary phase
- highly expressed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
- C07K17/14—Peptides being immobilised on, or in, an inorganic carrier
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Food Science & Technology (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Virology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Inorganic Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phases and preparation method and application, the recombinant cell is using HEK293 cell as host cell, transfection includes the expression vector of MrgprX2 full-length gene, expression MrgprX2 receptor macromolecular can be stablized on its cell membrane, and there is complete receptor biological activity.The MrgprX2 high expresses membrane receptor stationary phase and is made of the cell membrane of the activated silica gel absorption highly expressed recombinant cell of MrgprX2, can be applied to specificity screening and identifies the class allergy component caused by MrgprX2.The present invention has found that Sinomenine specific can be combined with MrgprX2 by practical application, the allergic experiment of cellular level shows that Sinomenine can stimulate histamine release of mast cell and β hexosaminidase simultaneously, it was demonstrated that MrgprX2 high expression membrane receptor stationary phase can be applied to specific recognition class allergy component really.
Description
Technical field
The invention belongs to field of biotechnology, are related to the highly expressed recombinant cell of MrgprX2 and based on recombinant cell spy
The MrgprX2 high expression membrane receptor stationary phase and its construction method of opposite sex identification class allergy component and application.
Background technique
Growing with Chinese medicine clinical application, Chinese native medicine security " event " happens occasionally, especially traditional Chinese medicine
Clinical safety problem receive much attention.Anaphylactoid reaction is also known as pseudoanaphylaxis, is that exogenous irritant directly stimulates hypertrophy
Cell, leads to its release group amine activity mediator, and anaphylactoid reaction is not mediated by IgE generally, can be produced in patient's medication for the first time
It is raw.Research has shown that the G-protein that class allergic stimulated object is activated is MRGPRS (MAS-Related G Protein-Coupled
Receptors), and MrgprX2 (Mas-related GPR family member X2) is mainly distributed on people's mast cell table
Face, and the receptoroid does not depend on IgE, may be the receptor of basic sercretogogue, can directly mediating mast cell activate, induction
Mast cell degranulation.Johns Hopkins University researcher determines that MrgprX2 receptor will solve drug anaphylaxis
Extremely important target spot.
Membrane flexibility technology is a kind of new technology that identification target components are effectively directly screened from complex system.Mesh
The preceding relevant report for capableing of specific recognition class allergy component MrgprX2 high expression membrane receptor stationary phase not yet.
Summary of the invention
The purpose of the present invention is to provide a kind of highly expressed recombinant cells of MrgprX2 and MrgprX2 high to express membrane receptor
Stationary phase and preparation method and application are further constructed based on the highly expressed recombinant cell of the MrgprX2 of building
MrgprX2 high expresses membrane receptor stationary phase, can be used in screening effect in the class allergy component of MrgprX2.
In order to achieve the above objectives, the present invention is realized using following technical scheme:
A kind of highly expressed recombinant cell of MrgprX2, the recombinant cell are the transfections using HEK293 cell as host cell
Exogenous expression's carrier of host cell is the expression vector comprising MrgprX2 full-length gene.
The nucleotide sequence of the MrgprX2 full-length gene is as shown in SEQ.ID.NO.1.
The expression vector comprising MrgprX2 full-length gene is LV5-MrgprX2homo slow virus.
MrgprX2 high based on the highly expressed recombinant cell of MrgprX2 expresses membrane receptor stationary phase, described
MrgprX2 high expresses membrane receptor stationary phase and is made of the cell membrane of the activated silica gel absorption highly expressed recombinant cell of MrgprX2
's.
The preparation method of the MrgprX2 high expression membrane receptor stationary phase, comprising the following steps:
1) cell membrane suspension is prepared
By the highly expressed recombinant cell centrifugation of cultured MrgprX2, cleaning, then under condition of ice bath, by MrgprX2
Highly expressed recombinant cell ultrasonication removes organelle by differential centrifugation, isolates cell membrane, then by cell membrane physiology
Salt water is resuspended, and cell membrane suspension is made；
2) preparation MrgprX2 high expresses membrane receptor stationary phase
Silica gel activating is placed in tool test tube, under vacuum condition, is added into tool test tube thin made from step 1)
After birth suspension, vortex oscillation are then allowed to stand overnight, obtain MrgprX2 high expression membrane receptor stationary phase.
The MrgprX2 high expression membrane receptor stationary phase is in terms of screening using MrgprX2 as the class allergy component of target spot
Application.
The MrgprX2 high expression membrane receptor stationary phase is made after wet method dress post acts on MrgprX2's for identification
The membrane flexibility column of class allergy component, using membrane flexibility column screening identification using MrgprX2 as the class allergy group of target spot
Point.
Compared with prior art, the invention has the following advantages:
1, the expression vector comprising MrgprX2 full-length gene is transfected into HEK293 host cell by the present invention, and through being sieved
Choosing, obtains the highly expressed recombinant cell of stable MrgprX2, is denoted as HEK293-MrgprX2 cell.The packet that the present invention constructs
The cell membrane of the recombination HEK293-MrgprX2 cell of the full length gene containing MrgprX2 can be stable expression MrgprX2 molecule, most
Height expression MrgprX2 improves 5000 times before relatively being transfected by the scale of construction, and has complete molecular activity.
2, the immortality for being 5 type adenovirus (Ad5) DNA of primary human embryonic kidney cell's transfection as the HEK293 cell of host cell
Change cell, the various expression of receptor amounts which contains are relatively low；And the HEK293-MrgprX2 cell after recombinating
The relative expression quantity ratio HEK293 of MrgprX2 ligand is obvious to be increased, with occupying advantage of expression relative to other cell surface molecules
Position is on a good wicket in terms of combining MrgprX2 receptor；Screening is thus substantially increased using MrgprX2 as target drug
Sensitivity and specificity；Simultaneously preferable cell model can be provided for further research MrgprX2 biological characteristics.
3, membrane receptor stationary phase is expressed provided by the present invention for the MrgprX2 high of specific recognition class allergy component, is
Adsorb the cell membrane of the highly expressed recombinant cell of MrgprX2 in support-activated silica gel and manufactured, have express it is specific
The membrane receptor of MrgprX2, MrgprX2 receptor are the receptor that can be specifically bound with class allergy component.In membrane flexibility column
The specificity of " class allergy component " screening, energy can be improved in complex sample in middle filling MrgprX2 high expression membrane receptor stationary phase
The identification that specificity is enough carried out for " the class allergy component " in complex sample, promotes analysis efficiency, to raising screening efficiency, explains
The bright mechanism of action has great importance.
4, the preparation method of MrgprX2 high expression membrane receptor stationary phase provided by the invention, MrgprX2 is highly expressed heavy
The cell membrane of group cell is separated, and is added in activated silica gel, makes activated silica gel adherent cell film to get MrgprX2 high table is arrived
Up to membrane receptor stationary phase.This method simple process, it is easy to operate.Further, MrgprX2 high obtained expression membrane receptor is consolidated
After determining phase wet method dress post, the membrane flexibility column for acting on the class allergy component of MrgprX2 for identification can also be made, convenient for into
The screening of class allergy component in row complex sample.
5, the MrgprX2 high expression membrane receptor stationary phase screening Sinomenine constructed with the present invention, discovery hydrochloric acid are green
Rattan alkali can retain in MrgprX2 high expression membrane receptor stationary phase, and retention time is 35min or so, illustrate Sinomenine
It can be in conjunction with MrgprX2.Find that Sinomenine can stimulate mast cell that degranulation reaction, release occurs by experiment in vitro
The Anaphylactic mediators such as β hexosaminidase and histamine.Therefore the above results show that MrgprX2 high expression membrane receptor stationary phase can answer
For causing the screening of class allergy component using MrgprX2 as the drug of target spot.
Detailed description of the invention
Fig. 1 is LV5-MrgprX2 homo slow-virus infection efficiency chart；Wherein a is NC-HEK293 cell (infection LV5-NC
The HEK293 cell of virus) light field figure；B is NC-HEK293 cell fluorescence figure；C is MrgprX2-HEK293 cell light field figure；d
For MrgprX2-HEK293 cell fluorescence figure.
Fig. 2 is the positive cell culture figure of puromycin screening；Wherein a is MrgprX2-HEK293 cell puromycin sieve
Growth conditions figure after choosing；B is positive cell growth figure after the screening of MrgprX2-HEK293 cell puromycin；C is NC-HEK293
Growth conditions figure after the screening of cell puromycin；D is positive cell growth figure after the screening of NC-HEK293 cell puromycin.
Fig. 3 is that the RT-PCR of mRNA level in-site MrgprX2 expression detects figure；
Fig. 4 is that the Westernblot of protein level MrgprX2 albumen detects figure；
Fig. 5 is calcium Imaging: Monitoring intracellular calcium flow concentration variation diagram；Wherein a is that A+P acts on HEK293 cell；B is A+P work
For NC-HEK293 cell；C is that A+P acts on MrgprX2-HEK293 cell；D is that C48/80 acts on HEK293 cell；e
NC-HEK293 cell is acted on for C48/80；F is that C48/80 acts on MrgprX2-HEK293 cell.
Fig. 6 is chromatogram of the Sinomenine on MrgprX2 high expressing cell membrane chromatography column；
Fig. 7 is that Sinomenine stimulates histamine release of mast cell.
Fig. 8 is that Sinomenine stimulates mast cell to discharge β hexosaminidase.
Specific embodiment
The present invention is described in further details below with reference to embodiment and attached drawing.
The present invention turns on the basis of constructing the carrier for expression of eukaryon LV5-MrgprX2 slow virus of MrgprX2 full-length gene
HEK293 cell is contaminated, the highly expressed recombinant cell of stable MrgprX2 is obtained, is denoted as HEK293-MrgprX2 cell, and
MrgprX2 high is prepared based on HEK293-MrgprX2 cell expresses membrane receptor stationary phase.Use differential centrifugation method will
The cell membrane of the highly expressed recombinant cell of MrgprX2 extracts separation, and isolated cell membrane and activated silica gel physical absorption are made
MrgprX2 high expresses membrane receptor stationary phase.MrgprX2 high expression membrane receptor stationary phase is subjected to wet method dress post with packing column machine, i.e.,
The membrane flexibility column of the class allergy component of MrgprX2 is acted on for identification.It is abundant to MrgprX2 membrane flexibility column
After balance, to complex sample to be analyzed, sample introduction is analyzed, if there is component to retain on MrgprX2 cell membrane, which is
Class allergy component.
It elaborates below to the present invention, the explanation of the invention is not limited.
1. the building of height expression MrgprX2 recombinant cell:
(1) it transduces:
1) first day:
Bed board: using the lentiviral particle (purchase is in Shanghai Ji Ma company) containing MrgprX2 gene to HEK293 cell
It is infected, routine culture HEK293 cell, 0.5 × 10 is inoculated in 24 orifice plates5A cells/well is added 0.5mL and cultivates completely
Base guarantees that the fusion rate of cell when virus infection reaches 40%-60%, because the expression time of Lentivirus is longer.By cell
Plate sets 5%CO237 DEG C of overnight incubations, adherent to cell in incubator.
2) second day:
A. dilution is viral: preparing 2 sterile 1.5mL EP pipes, sucks 450 μ L complete mediums respectively, draw 50 μ L's
9×108The virus (take out from -80 DEG C melt on ice in advance) of TU/mL is added in first pipe, soft to mix, and is not produced
Raw foam carries out 10 times of dilutions, and from being drawn in 45 μ L to second pipes in first pipe, mixes.Thus obtain two
The virus of a difference gradient: 10 times of dilutions, 100 times of dilutions.Calculate the MOI value difference it is found that two various concentration virus
For 10 and 1.
B. add Polybrene (polybrene): Polybrene can effectively improve efficiency of infection in most cells,
It is separately added into the Polybrene that the original liquid concentration of adaptable volume is 5mg/mL in step a dilution virus liquid obtained, protects
Demonstrate,prove the final concentration of 5 μ g/mL of Polybrene in viral dilution.
C. infection cell: removing cell culture fluid old in 24 orifice plates, the virus liquid in step b is added, while establishing sky
Cell is put back to incubator and is incubated for by white control and negative control, and 37 DEG C, 5%CO2Overnight.
3) third day: the virus liquid after removing cellular invasion after 12-24h is added the complete medium of 0.5mL, and 37 DEG C,
5%CO2Overnight.
4) fourth, fifth day: efficiency of infection detection, after infecting 48-96h: observing green fluorescence table in inverted fluorescence microscope
Up to situation, the efficiency of slow-virus infection HEK293 cell is estimated, as a result as shown in Figure 1, it is seen that efficiency of infection is higher.
Metainfective cell can be cultivated continuously one week, slow to determine by observing expression time and the expression intensity of fluorescence
Infection conditions of the virus to HEK293 cell.The case where being grown during infection according to cell changes liquid in time to cell progress, if any
It needs, 1/3-1/5 can be separated with vitellophag, the complete medium of 0.5mL is added, continue to cultivate 24-48h, to guarantee cell
Good growth conditions.
(2) Puromycin (puromycin) is screened:
1) optimal screening concentration is determined
A. the HEK293 cell (generally in the 70%~80% of confluent cultures vessel bottom) of logarithmic growth phase, with new
Fresh complete medium DMEM is made 1.5 × 105The cell suspension of a/mL.Add cell suspension, every 100 μ of hole into 96 well culture plates
L (makes every hole cell number 1.5 × 104It is a), then add fresh DMEM medium appropriate to every hole, stationary culture mistake in incubator
Night.
B. the puromycin stock solution that concentration is 8mg/mL was diluted to 0.25-2.5 μ with DMEM culture medium respectively in second day
The medical fluid of totally 13 concentration gradients between g/mL is replaced the old culture medium in each hole by grouping respectively.
C. cell viability is checked daily, since the growth of HEK293 cell is too fast, every other day replacement is once mould containing purine
The culture medium of element.
D. observation culture 2-3 days after, can result in the puromycin of all cell deaths Cmin be just used as it is optimal
Screening concentration is used to screen metainfective cell.
2) Puromycin screens infected cell.
A. after virus infection after 48h, the culture medium of the puromycin containing optimal concentration can be used instead to screen NC-HEK293
Cell and MrgprX2-HEK293 cell, while a HEK293 cell controls ware is set up, puromycin is added, as
Whether puromycin effectively compares.
B. the culture medium containing puromycin is every other day used instead, to replace the culture medium containing a large amount of dead cells, until resistance
Group can be identified.As a result see Fig. 2, it is seen that after being screened with puromycin, the HEK293 cell of virus infection LV5-MrgprX2
There are shrinkage, the phenomena of mortality in major part, but has a small amount of cell to be still within adherent growth, as shown in Figure 2 a, obtained to have
The positive MrgprX2-HEK293 cell of puromycin resistance gene, as shown in Figure 2 b.The HEK293 of virus infection LV5-NC is thin
Growth conditions after being screened with puromycin of born of the same parents are as shown in Fig. 2 c.
C. after resisting cell covers with, it is transferred to 10cm culture dish, harvests cell, identifies gene table in mRNA or protein level
Up to situation.Cell is retained simultaneously and carries out secondary culture, is frozen after success to be identified, to be used for subsequent experimental.
The expression of 2.RT-PCR detection MrgprX2 transcriptional level in gained cell.
(1) extraction of total serum IgE:
It is thin that the HEK293 cell being uninfected by, infection NC virus, the HEK293 of MrgprX2 virus are extracted using Trizol reagent
The total serum IgE of born of the same parents.
1) culture medium is exhausted, is gently washed with PBS once, sops up PBS.Add 3mL Trizol by the big culture dish of 10cm, shakes
Under 3-5, then with there is no filiforms under rifle piping and druming mostly, when until rifle point lifting, it is ensured that all (no longer in thick) after cracking,
It is drawn in 1.5mL centrifuge tube, is vortexed or acutely shakes.
2) it is stored at room temperature 5-15 minutes.In 4 DEG C, 12000rpm is centrifuged 10min, takes supernatant, adds according to every milliliter of Trizol
Enter 0.2mL chloroform, Vortex mixing or fiercely shaking 15 seconds are placed at room temperature for 2-3 minutes.
3) in 4 DEG C, 12000rpm is centrifuged 15min, careful to draw the upper strata aqueous phase containing total serum IgE to a new 1.5mL centrifugation
Guan Zhong, every milliliter of Trizol can about draw 0.4-0.5mL, and every pipe is added and the isometric isopropanol of supernatant, reverse to mix for several times,
It places 2 hours within precipitation at room temperature 10 minutes or 4 DEG C.
4) in 4 DEG C, 12000rpm is centrifuged 15min, in the visible gluey RNA precipitate of tube bottom, supernatant is abandoned, per effective
0.8mL75% alcohol is washed (to teetertotter, uniformly supernatant, 75000rpm, 5min, 4 DEG C are removed in centrifugation) twice, and dehydrated alcohol washes one
It is secondary, then (﹥ 5000rpm is centrifuged 1 second) is got rid of with centrifuge, liquid is carefully exhausted with small pipette tips, not encounter RNA precipitate.
5) vacuum is drained or naturally dry 3-5 minutes, and after RNA is slightly dry, the processed 20 μ L of deionized water of DEPC is added
Dissolution precipitating, freezes in -80 DEG C.
6) agarose gel electrophoresis: weighing 0.3g agarose powder, is dissolved in 30mL TEA buffer, under microwave condition
It heats within moderate heat 2 minutes, when temperature is down to 50-60 DEG C, 2 μ L EB is added into solution with rifle and rock uniformly, pour into glue rapidly
It is inserted into drilling in slot and combs drilling, immerses glue in the electrophoretic buffer in electrophoresis tank after being gelled admittedly, by RNA:6 × Loading
Buffer:DEPC water=1:1:4 ratio mixes on sealed membrane, draws mixed liquor with rifle and is added in loading hole, constant pressure (electricity
Stream is adjusted to maximum value) electrophoresis is carried out under conditions of 120V, electrophoresis starts to take out gel after being no more than 15-20 minutes, by gel
It is placed under gel imager, opens ultraviolet light and inspected.The RNA preferably extracted is in the band after gel separates
The brightness of 28S should be twice of 18S, and not occur 5S band.If the RNA extracted meets mentioned above principle, for extracted RNA
Quality is preferable, can carry out subsequent reverse transcription operation.
7) using NanoDrop ND-1000 type it is ultraviolet/visible spectrophotometer measurement RNA purity and content.
(2) reverse transcription RNA is cDNA
Using the PrimeScrip of Takara companyTMRT reagent Kit with gDNA Eraser(Perfect
Real Time) Reverse Transcriptase kit is by the RNA reverse transcription extracted the first chain cDNA of synthesis, and the specific method is as follows:
1) removal genomic DNA reaction:
Reaction mixture is prepared, on ice to guarantee that the accuracy that reaction solution is prepared should be first by reaction when carrying out every reaction
The amount of number+2 prepares Maste Mix, is then dispensed into each reaction tube again, is eventually adding RNA sample.10 μ L reaction systems are matched
System is as follows, can accordingly expand as needed.
After preparing reaction system, finger flicks EP bottom of the tube, is centrifuged 10 seconds, is put into PCR instrument, setting response procedures: 42
DEG C 2min (or room temperature 5min*2), 4 DEG C of ∞.
| Reagent | Usage amount |
| 5×gDNA Eraser Buffer | 2.0μL |
| gDNA Eraser | 1.0μL |
| Toal RNA | *1 |
| RNase Free dH2O | up to 10μL |
* in 1:20 μ L reverse transcription reaction system, the Toal RNA of 1 μ g at most can be used in SYBR Green qPCR method.
* 2: when room temperature reaction, 30 minutes can be extended to.
2) reverse transcription reaction:
Using<SYBR Green qPCR method>in preparing reaction solution on ice, Maste Mix is prepared by the amount of stoichiometric number+2,
Then it dispenses again in 200 μ L reaction tubes*3, reverse transcription reaction is carried out immediately after soft mixing.
After preparing reaction system, finger flicks EP bottom of the tube, is centrifuged 10 seconds, is put into PCR instrument, setting response procedures: 37
℃15min；85℃5sec；4℃∞.The cDNA of synthesis is saved in -20 DEG C or lower temperature.
| Reagent | Usage amount |
| The reaction solution of step 1) | 10.0μL |
| PrimeScript Enzyme Mix Ⅰ | 1.0μL |
| RT Primer Mix | 1.0μL |
| 5×PrimeScript Buffer 2(for real time) | 4.0μL |
| RNase Free dH2O | 4.0μL |
| Toal | 20μL |
* 3: if do not prepared Master Mix, when adding reagent into the reaction solution of step 1, RNase Free is first added
dH2O and 5 × PrimeScript Buffer 2 (for real time) is uniformly mixed, so that the activity of gDNA Eraser is filled
Divide and be suppressed, then add RT Primer Mix, PrimeScript Enzyme Mix I, it is anti-to mix gently progress reverse transcription
It answers.
3) Real Time PCR amplification:
Select SYBR Premix Ex Taq II (Tli RNaseH Plus) kit of Takara company, application
Thermal Cycler Dice Real Time System amplification instrument uses specific primer using the first chain cDNA as template
It is expanded, using the reaction system of 25 μ L, the specific method is as follows:
A. according to the sequence of target gene MrgprX2, design primer is as follows:
Upstream: 5'CAGGACATTGCTGAGGTGGA 3'
Downstream: 5'AGTTCAGCAAATCAGACAGACAGG 3'
Primer is synthesized by Takara company, and target fragment is the long 993bp that can represent MrgprX2 gene expression abundance
MrgprX2 genetic fragment.
B. primer is dissolved in water spare.
C. PCR reaction system is prepared on ice, is formed as follows:
| Reagent | Usage amount | Final concentration |
| SYBR Premix Ex TaqⅡ(Tli RNaseH Plus)(2×) | 12.5μL | 1× |
| PCR Forward Primer(20μM) | 0.5μL | 0.4μM |
| PCR Reverse Primer(20μM) | 0.5μL | 0.4μM |
| RT reaction solution (cDNA solution) | 2.0μL | |
| dH2O (sterile purified water) | 9.5μL | |
| Toal | 25μL |
D. each cell is obtained after PCR amplification in the expression of results of transcriptional level, sees Fig. 3, it is seen that MrgprX2-HEK293
There is significantly MrgprX2 gene compared with HEK293 cell and NC-HEK293 cell in the expression quantity of mRNA level in-site in cell
It improves.
The expression quantity of 3.Western blot detection MrgprX2.
Under the conditions of 4 DEG C, the resistant of culture will be expanded after the HEK293 cell being uninfected by, puromycin screening
MrgprX2-HEK293 cell, NC-HEK293 cell are cracked with RIPA lysate, and Ultrasonic Cell Disruptor is broken, extract the total egg of cell
It is white, and protein content is measured with BCA method.Institute's leach protein through SDS-PAGE electrophoresis, transferring film, closing, be incubated for primary antibody, be incubated for secondary antibody and
With ECL chemiluminescence detection protein expression, the expression of MrgprX2 albumen is detected.As a result as shown in figure 4, shown in swimming lane 1
The MrgprX2 expression quantity of HEK293 cell is significantly lower than recombination MrgprX2-HEK293 cell shown in swimming lane 2.From Western
The result of blot show that the MrgprX2 expression quantity recombinantly expressed in MrgprX2-HEK293 cell significantly improves.
4. calcium imaging technique monitors various Cytoplasmic Cas2+Concentration variation.
(1) preparation of related liquid:
1) preparation of reagent mother liquor:
A. poly-D-lysine: being configured to 0.1mg/mL with sterile tri-distilled water dissolution poly-D-lysine powder, i.e., 0.01%
Poly-D-lysine working solution, matching while using or 4 DEG C maintain up to one liang of week.
17.7 μ L DMSO dissolution is added in b.Fluo-3 (specification 100ug).
C.F-127 takes 5mg that 44.2 μ L DMSO dissolution is added, and is kept in dark place in -20 DEG C.
D.CIB: respectively according to NaCl 125mM, KCl 3mM, CaCl2 2.5mM,MgCl2 0.6mM,HEPES 10mM,
Glucose 20mM,NaHCO31.2mM, Sucrose 20mM prepare the CIB buffer solution of 200mL, adjust pH to 7.4, in
4 DEG C of preservations.
2) preparation of drug used in:
According to set concentration, the mother liquor that will be dissolved in the positive drug C48/80 of DMSO is added in the CIB of respective volume,
It is diluted to the activity of positive drug.
3) preparation of Incubating Solution:
HEK293 cell is attached cell, Incubating Solution are as follows: 0.7 μ L Fluo-3+4 μ L F-127+995.3 μ L CIB.It incubates
It educates liquid and wants ready-to-use.
(2) experimental procedure:
1) poly-D-lysine coated cell plate: though HEK293 cell is attached cell, its is adherent loosely, easily uses pancreatin
Digestion, so inoculation the previous day needs to be coated with 96 orifice plates with poly-D-lysine, it is specific to handle are as follows: poly is added in the every hole of 96 orifice plates and relies
100 μ L of propylhomoserin working solution, coating overnight, are washed 2-3 times for second day with sterile tri-distilled water, and PBS washes 1 time to play balance salt action, note
The amount for washing lotion of anticipating is greater than the amount of coating buffer, super-clean bench ultraviolet irradiation half an hour, and air-dries.
2) inoculating cell: HEK293, NC-HEK293, MrgprX2-HEK293 cell are digested with pancreatin, presses about 5 × 103
96 orifice plates are accessed in a/hole, are put into incubator, and 37 DEG C, 5%CO2Overnight, it is adjacent to cell.
3) it is incubated for: inhaling and abandon culture medium, the 100 μ L of CIB that every hole is heated to 37 DEG C is cleaned 1 time；It inhales and abandons CIB, be protected from light
Under the conditions of be added 100 μ L of Incubating Solution, be placed in incubator and be incubated for 40min.
4) it is monitored under fluorescence microscope: inhaling and abandon Incubating Solution, every hole is added after CIB is cleaned 1 time and abandons supernatant, and CIB is added again
100 μ L are grouped after abandoning CIB is successively inhaled in every hole by cell and 200 μ L of positive drug C48/80 are added under fluorescence microscope blue light, and
It takes pictures immediately, time for exposure 1s, every second beats one is opened, photo opporunity 3min.Monitoring result is as shown in Figure 5.
By being stimulated simultaneously HEK293, NC-HEK293 cell and MrgprX2-HEK293 cell A23187 and PMA,
Obtained intracellular Ca2+ rheologyization is respectively as shown in Fig. 5 a, b, c, it is seen that intracellular calcium ion increases.By with positive drug C48/80
HEK293, NC-HEK293 cell and MrgprX2-HEK293 cell are stimulated respectively, as a result respectively as shown in Fig. 5 d, e, f, it is seen then that
The fluorescence intensity of HEK293, NC-HEK293 cell does not change, and the fluorescence intensity of MrgprX2-HEK293 cell has obviously
Raising, i.e. MrgprX2-HEK293 cell intracellular free calcium level significantly improves, and illustrates that MrgprX2-HEK293 is intracellular
MrgprX2 receptor is related with intracellular free calcium level increase.So far the success of MrgprX2-HEK293 cell construction is confirmed.
The preparation of 5.MrgprX2 high expression membrane receptor stationary phase
(1) MrgprX2 high expresses the preparation of membrane receptor stationary phase
The HEK293-MrgprX2 cell for choosing logarithmic growth phase, using 0.25% trypsase by adherent growth
HEK293-MrgprX2 cell dissociation gets off, and is placed in centrifuge tube, and 1000g is centrifuged 10min under the conditions of 4 DEG C, removes supernatant
Culture solution, sedimentation cell are added after physiological saline is suspended again the 1000g centrifugation 10min under the conditions of 4 DEG C, wash away cell surface
Remaining culture medium, physiological saline cleaning process are repeated 2 times.Backward cell in be added 5mL 50mM Tris-HCl solution,
It is placed in cell Ultrasonic Cell Disruptor.The suspension of cell membrane and organelle is centrifuged 10min under the conditions of 4 DEG C of 1000g, is taken at this time
Supernatant is centrifuged 10min under the conditions of 4 DEG C of 12000g in centrifuge tube, and precipitating is cell membrane, and precipitating is resuspended with physiological saline,
And it is centrifuged 20min under the conditions of 4 DEG C of 12000g again, cell Membrane cleaning 1 time will obtained.Finally obtained cell membrane is sunk
It forms sediment and is suspended with the physiological saline of 5mL, and cell membrane suspension is added to the preactivated macropore silicon of 0.05g under vacuum conditions
It in glue, is placed on magnetic stirring apparatus and stirs 30min in 4 DEG C of conditions, guarantee to stand overnight after cell membrane is mixed well with silica gel, benefit
Cell membrane is combined sufficiently with macro porous silica gel with physisorption, obtains MrgprX2 high expression membrane receptor stationary phase.
(2) MrgprX2 high expresses the screening of membrane receptor Chromatography Models
1) prepared by cell membrane stationary phase
By cell suspension, 5000rpm is centrifuged 10min under the conditions of 4 DEG C, removes the culture solution of supernatant, and precipitating is cell,
It is added after physiological saline is suspended again and is centrifuged in above-mentioned condition, physiological saline cleaning process is repeated 2 times.Add into obtained cell
The Tris-HCl solution for entering 5mL pre-cooling, is placed in ice-bath ultrasonic 30min smudge cells in Ultrasound Instrument, to guarantee the activity of cell membrane.
0.02g silica gel is weighed in tool test tube simultaneously, is placed in 105 DEG C of baking ovens and is activated 30min.After sonicated cells, cell is used
Broken instrument is crushed again, and program is work 3s, interval 1s, and 6 times.Under the conditions of 4 DEG C 1500g be centrifuged 10min, Aspirate supernatant in
In an other centrifuge tube, 12000g is centrifuged 10min under the conditions of 4 DEG C, and obtaining precipitating is cell membrane, precipitating physiological saline weight
It is outstanding, and 12000g is centrifuged 10min under the conditions of 4 DEG C again, obtained cell Membrane cleaning is primary.The precipitating physiology salt of 5mL
Water is suspended, and sucks in 5ml syringe, mixes under the conditions of vacuum is vortexed concussion with activated silica gel, is placed in magnetic agitation
30min is stirred in 4 DEG C of conditions on device, stands overnight, obtains cell membrane stationary phase suspension.
2) preparation of CMC column
Next day, by cell membrane stationary phase suspension be vortexed mix, be transferred in 10mL centrifuge tube, under the conditions of 4 DEG C 2000rpm from
Heart 10min, abandons supernatant, and precipitating, which is added about 5mL physiological saline and is vortexed, to be mixed, and repeats aforesaid operations 2 times, removes and extra do not wrap up
About 5mL physiological saline vortex is added into precipitating and mixes, pours into packing column machine flushed in advance for cell membrane on silica gel
In, mobile phase is water, flow velocity 2.0mL/min, and pressure when filling column is no more than 10MPa, fills column time 5min, can be by cell
Film stationary phase is fitted into column core, and the membrane flexibility column filled is fitted into liquid chromatograph and is used.
(3) chromatographic condition
Shimadzu LC-20A high performance liquid chromatograph (Shimadzu, Japan), includes DGU-20A3 on-line degassing machine, LC-20AB liquid
Phase chromatogram pump, SIL-20A autosampler, CTO-20AC column oven, SPD-M20A autosampler, Shimadzu LC
Labsolution software.
Membrane flexibility condition 1: ultrapure water is mobile phase, the detection of flow velocity 0.2mL/min, PDA detector.
Membrane flexibility condition 2: mobile phase: 50mmol/L PBS；Flow velocity: 0.2mL/min；Column oven: 37 DEG C；PDA inspection
It surveys.
6. the Anaphylactic mediator release test of Sinomenine
(1) the intracorporal histidine of the Gorky of mast cell and basophilic granulocyte is acted on through histidine decarboxylase, is sloughed
The amine substance with vasoactive formed after carboxyl, histamine are generally stored in the lung and skin histology of people, Mei Gexi
The histamine content of born of the same parents is similar, generally 2~5 pg, mainly by causing gas in conjunction with the histamine receptor of target cell surface
The allergic reactions such as road smooth muscle contraction, blood vessel dilatation.
First using standard concentration as X-axis, corresponding absorbance value carries out Logit-Log straight line fitting as Y-axis,
Obtain following curvilinear equation.
P=OD/OD0, q=1-p,
Y=ln (p/q), x=lg (concentration),
Wherein: OD is response value, and OD0 is the mean value for the response value that concentration is 0, then equation are as follows:
Y=a+b*x
Table 1-1 histamine reference substance solution concentration and corresponding absorbance value
Wherein a=4.69239, b=-3.36197, r^2=0.84483.
Table 1-2 histamine standard curve fit value
Acquiring residual sum of squares (RSS) is 1.93324.
It brings the absorbance value of sample to be tested into equation, acquires corresponding Histamine concentrations.
(2) β-hexosaminidase is mast cells activation degranulation marker, β-ammonia of detection Sinomenine induction
Mast cells activation effect is evaluated in the release of base hexosidase.Using Sinomenine concentration as abscissa, β-hexosaminidase is released
Putting rate is ordinate, describes the variation of the increase β-hexosaminidase release rate with Sinomenine concentration；With C48/80
As positive control, buffer is cooked negative control.
1) inoculating cell: the LAD2 cell of logarithmic growth phase is made unicellular of the digestion of 0.25% trypsin solution
Suspension after cell count, is inoculated in (5 × 10 in 96 orifice plates with certain density4A/hole), cell suspension volume is 150 holes μ L/.
Every group sets 4 parallel holes, in 37 DEG C, 5%CO2It is cultivated in incubator.
2) dosing: culture for 24 hours, after cell is adherent, with fresh culture medium dilute hydrochloric acid cucoline and is sufficiently mixed
It is even, use the Compound48/80 of 10 times of fresh culture medium dilution 30mg/mL as positive drug.It inhales and abandons each hole culture medium, every hole
100 μ L of drug solution and positive medical fluid is sequentially added, isometric fresh culture, 37 DEG C of culture 30min are added in negative control group.
3) it takes supernatant to detect: 2000g centrifugation 10min at 4 DEG C of supernatant is drawn, with 0.1% Trition X-100 lysate
Negative control group cell 5min is cracked, 2000g at 4 DEG C of lysate is taken to be centrifuged 10min.1mmol/ is added in 96 clean orifice plates
50 μ L of L beta-amino hexose adds the cell supernatant and negative control group cell of 50 each drug concentrations of μ L as reaction substrate
Lysate, be sufficiently mixed, 37 DEG C of incubators are incubated for 1h, and the sodium carbonate/bicarbonate that 150 μ L 0.1mol/L are then added is whole
Only liquid terminates reaction, selects the wavelength of 405nm to measure the absorbance value in each hole on enzyme-linked immunosorbent assay instrument, records as a result, root
The release rate of each concentration is calculated according to formula.Formula is as follows:
β-hexosaminidase release rate (the %)=administration group cell conditioned medium absorbance/(suction of feminine gender group cell conditioned medium
Luminosity+feminine gender group cell pyrolysis liquid absorbance) × 100%.
As shown in fig. 6, the MrgprX2 high expression membrane receptor stationary phase screening Sinomenine constructed with the present invention, hair
Existing Sinomenine can retain in MrgprX2 high expression membrane receptor stationary phase, and retention time is 35min or so, illustrate salt
Sour cucoline can be in conjunction with MrgprX2.As shown in Figure 7 and Figure 8, find that Sinomenine can stimulate hypertrophy by experiment in vitro
Degranulation reaction occurs for cell, discharges the Anaphylactic mediators such as β hexosaminidase and histamine.The above results show MrgprX2 high table
It can be applied to the screening for causing class allergy component using MrgprX2 as the drug of target spot up to membrane receptor stationary phase.
The above is only presently preferred embodiments of the present invention, is not intended to limit the invention in any way, it is all according to the present invention
Technical spirit any simple modification, change and equivalent structure transformation to the above embodiments, still fall within skill of the present invention
In the protection scope of art scheme.
Nucleotides sequence list
<110>Xi'an Communications University
<120>the highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application
<160> 1
<210> 1
<211> 2130
<212> DNA
<213> MrgprX2
<400> 1
gtttgccagt cccaggaaag cacttctcaa ctcaccaact ccagtagaaa gaagggtgtt 60
aaggggcacc agtggaggtt ttctgagcat ggatccaacc accccggcct ggggaacaga 120
aagtacaaca gtgaatggaa atgaccaagc ccttcttctg ctttgtggca aggagaccct 180
gatcccggtc ttcctgatcc ttttcattgc cctggtcggg ctggtaggaa acgggtttgt 240
gctctggctc ctgggcttcc gcatgcgcag gaacgccttc tctgtctacg tcctcagcct 300
ggccggggcc gacttcctct tcctctgctt ccagattata aattgcctgg tgtacctcag 360
taacttcttc tgttccatct ccatcaattt ccctagcttc ttcaccactg tgatgacctg 420
tgcctacctt gcaggcctga gcatgctgag caccgtcagc accgagcgct gcctgtccgt 480
cctgtggccc atctggtatc gctgccgccg ccccagacac ctgtcagcgg tcgtgtgtgt 540
cctgctctgg gccctgtccc tactgctgag catcttggaa gggaagttct gtggcttctt 600
atttagtgat ggtgactctg gttggtgtca gacatttgat ttcatcactg cagcgtggct 660
gattttttta ttcatggttc tctgtgggtc cagtctggcc ctgctggtca ggatcctctg 720
tggctccagg ggtctgccac tgaccaggct gtacctgacc atcctgctca cagtgctggt 780
gttcctcctc tgcggcctgc cctttggcat tcagtggttc ctaatattat ggatctggaa 840
ggattctgat gtcttatttt gtcatattca tccagtttca gttgtcctgt catctcttaa 900
cagcagtgcc aaccccatca tttacttctt cgtgggctct tttaggaagc agtggcggct 960
gcagcagccg atcctcaagc tggctctcca gagggctctg caggacattg ctgaggtgga 1020
tcacagtgaa ggatgcttcc gtcagggcac cccggagatg tcgagaagca gtctggtgta 1080
gagatggaca gcctctactt ccatcagata tatgtggctt tgagaggcaa ctttgcccct 1140
gtctgtctga tttgctgaac tttctcagtc ctgattttaa aacagttaag agagtccttg 1200
tgaggattaa gtgagacagt gcctatgaaa caaacactaa gtgcagtgtc tctggaactg 1260
ccttactcac aggcttccac cacagcccta tgagagcttt gccaactctg cggtccatga 1320
ctgttcccac ttttaatgaa tcctaccttt cgcagaaggc tgaaagcagg gcagaaaaga 1380
tctacatttc tttggacact gcacttgata gggactcaaa gaatgttata tttttaatta 1440
atttcttttt ctcttccgta caatttctgt ctcaacaaaa ttagaagaat taaatttaaa 1500
actagctcca aaagagcagt cgtctttcat tttggcagac cttagaatat ccccctagct 1560
taataaatct ttgttgaatg gcttaatgaa tgaataaact ggttaatgtt taagttaaac 1620
ctctgaaaag tctccattta ccagatttga gtcactaaat ttattgcttt cactactttt 1680
gaattttgca aacatgaaat taagttttat aattagataa atcaatgtca acacatattt 1740
aaagtttgag gtacactgtc ttcctgtggt ttcctttcac atgccatccc ttaaaatccc 1800
agctacacgc cttcccattc cttccccttt gcctttgttc taatcttccc tctctggggg 1860
ctctctaatt cgtcctggaa gtttccagtg gtcttataga ctccatgttc ttggaggaca 1920
ggctgtatgt cagatttacc ttttattccg aagaactcgg agcatttatt ttgttaatta 1980
aattgcacat atttttaaaa gttacgtgtt ccacagaata aaatactaat tgtaaaaaaa 2040
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2100
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2130
Claims (5)
1. a kind of highly expressed recombinant cell of MrgprX2 identification using MrgprX2 as the application in terms of the class allergy component of target spot,
It is characterized by: the class allergy group is divided into Sinomenine；The recombinant cell is turned using HEK293 cell as host cell
The exogenous expression's carrier for contaminating host cell is the expression vector comprising MrgprX2 full-length gene；The MrgprX2 full-length gene
Nucleotide sequence as shown in SEQIDNO.1.
2. application described in claim 1, it is characterised in that: the expression vector comprising MrgprX2 full-length gene is slow disease
Malicious LV5-MrgprX2.
3. a kind of highly expressed membrane receptor stationary phase of MrgprX2 is in terms of identifying using MrgprX2 as the class allergy component of target spot
Using, it is characterised in that: the class allergy group is divided into Sinomenine；The MrgprX2 high expression membrane receptor stationary phase is by living
The cell membrane for changing the highly expressed recombinant cell of MrgprX2 described in one of silica gel absorption claim 1-2 is made；It is described
The nucleotide sequence of MrgprX2 full-length gene is as shown in SEQIDNO.1.
4. the preparation method of application as claimed in claim 3, the MrgprX2 high expression membrane receptor stationary phase includes following step
It is rapid:
1) cell membrane suspension is prepared
By the highly expressed recombinant cell centrifugation of cultured MrgprX2, cleaning, then under condition of ice bath, by MrgprX2 high table
The recombinant cell ultrasonication reached removes organelle by differential centrifugation, isolates cell membrane, then by cell membrane physiological saline
It is resuspended, cell membrane suspension is made；
2) preparation MrgprX2 high expresses membrane receptor stationary phase
Silica gel activating is placed in tool test tube, under vacuum condition, cell membrane made from step 1) is added into tool test tube
Suspension, vortex oscillation are then allowed to stand overnight, obtain MrgprX2 high expression membrane receptor stationary phase.
5. a kind of highly expressed membrane receptor stationary phase cells membrane chromatography column of MrgprX2 is in identification using MrgprX2 as the class mistake of target spot
Application in terms of quick component, it is characterised in that: the class allergy group is divided into Sinomenine；The highly expressed film of MrgprX2
Receptor stationary phase cells membrane chromatography column MrgprX2 high as described in claim 4 expresses membrane receptor stationary phase through wet method dress post
After be made；The nucleotide sequence of the MrgprX2 full-length gene is as shown in SEQIDNO.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710100941.6A CN106754731B (en) | 2017-02-23 | 2017-02-23 | The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710100941.6A CN106754731B (en) | 2017-02-23 | 2017-02-23 | The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754731A CN106754731A (en) | 2017-05-31 |
| CN106754731B true CN106754731B (en) | 2019-10-11 |
Family
ID=58960284
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710100941.6A Active CN106754731B (en) | 2017-02-23 | 2017-02-23 | The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754731B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107703312A (en) * | 2017-11-15 | 2018-02-16 | 西安交通大学 | The protein marker and method of examination medicine anaphylactoid reaction sensitive group |
| CN108398517A (en) * | 2018-02-11 | 2018-08-14 | 湖南正清制药集团股份有限公司 | A kind of method of potential Allergen in screening Zhengqingfengtongning preparation |
| CN109765324B (en) * | 2018-11-27 | 2021-03-30 | 苏州科技大学 | Screening method of MEK1 protein potential inhibitor |
| CN110204607B (en) * | 2019-05-31 | 2021-04-20 | 西安交通大学 | Dominant antigen epitope polypeptide of anti-Mrgprx 2 antibody and application thereof |
| CN110204606B (en) * | 2019-05-31 | 2021-04-20 | 西安交通大学 | Polypeptide for preparing rabbit polyclonal antibody and application thereof |
| CN110229227B (en) * | 2019-05-31 | 2021-05-28 | 西安交通大学 | Polypeptide for preparing ELISA mouse monoclonal coating antibody and rabbit polyclonal detection antibody and application thereof |
| CN110229228B (en) * | 2019-05-31 | 2021-05-28 | 西安交通大学 | Polypeptide with immunogenicity to anaphylactoid reaction specific receptor MRGPRX2 protein and application thereof |
| CN110240643B (en) * | 2019-05-31 | 2021-05-28 | 西安交通大学 | Polypeptide for preparing anaphylactoid reaction double-antibody sandwich kit paired antibody and application thereof |
| CN116855503B (en) * | 2023-08-30 | 2023-12-08 | 上海益诺思生物技术股份有限公司 | Stable transgenic cell strain over-expressing MRGPRX2 and construction method and application thereof |
-
2017
- 2017-02-23 CN CN201710100941.6A patent/CN106754731B/en active Active
Non-Patent Citations (6)
| Title |
|---|
| Dual action of neurokinin-1 antagonists on Mas-related GPCRs;Ehsan Azimi;《JCI Insight》;20161006;第1卷(第16期);图1-3图注，方法部分 * |
| In silico design of novel probes for the atypical opioid receptor MRGPRX2;Katherine Lansu;《nature CHEMICAL BIOLOGY》;20170313;第13卷;全文 * |
| MRGPRX2 is essential for sinomenine hydrochloride induced anaphylactoid reactions;Rui Liu;《Biochemical Pharmacology》;20171004;第146卷;全文 * |
| New method of screening allergenic components from Shuanghuanglian injection: With RBL-2H3/CMC model online HPLC/MS system;Shengli Han;《Journal of Pharmaceutical and Biomedical Analysis》;20131014;第88卷;摘要，2.4部分 * |
| 一种提高细胞膜色谱精确性和灵敏性的方法;王瑜;《南方医科大学学报》;20091231;第29卷(第12期);摘要，引言，实验方法2.1-2.3，结果 * |
| 细胞膜色谱固定相的制备条件优化研究;赵新超;《天津药学》;20170430;第29卷(第2期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754731A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106754731B (en) | The highly expressed recombinant cell of MrgprX2 and MrgprX2 high expression membrane receptor stationary phase and preparation method and application | |
| CN104814984A (en) | Applications of alphavirus in preparation of anti-tumor drugs | |
| CN105368859B (en) | A kind of Chimeric antigen receptor hCD87-CAR and slow virus and plasmid and its application for being loaded with hCD87-CAR gene structure | |
| CN108619503A (en) | A kind of pig circular ring virus genetic engineering subunit vaccine and the preparation method and application thereof | |
| CN108285891A (en) | The high metastatic human hepatoma cell strain of Luc-GFP labels and its application in liver cancer model in situ | |
| CN106867967A (en) | The LM3 cell lines and its construction method of Midkine stable low-expressions | |
| CN106350533A (en) | Anti-PD-L1-CAR-T, and preparation method and application thereof | |
| CN109022584B (en) | A kind of molecular marker of the cancer of the esophagus and application thereof | |
| CN103333858B (en) | Gleevec-resistant gastrointestinal stromal tumor cell line, method thereof, and nude mouse transplantation tumor model thereof | |
| CN106867968A (en) | The SMCC-7721 cell lines and construction method of YBX1 stabilization expression | |
| CN105950628A (en) | Long non-coding RNA (Ribose Nucleic Acid) and application thereof to diagnosis/treatment of non-small-cell lung cancer | |
| CN108004322A (en) | A kind of applications of lncRNA in adenocarcinoma of lung is diagnosed and/or treated | |
| CN105671004A (en) | Method for cultivating hepatitis E viruses | |
| CN103215267B (en) | Suppress siRNA and its application of influenza virus related gene | |
| CN105535975A (en) | Applications of vesicle-associated membrane protein 1 in prevention and treatment of enterovirus 71 infection | |
| CN105963682B (en) | Application of the guanine nucleotide binding protein 5 in preparation antiviral drugs | |
| CN108950079A (en) | Triple fluorescent PCR surveys the primed probe group and kit of Tibet Orbivirus, Yunnan Orbivirus and Sa Siwuwazhali Orbivirus | |
| CN108118061A (en) | Epinephelus coioides innate immunity receptor TLR22 genes and its carrier for expression of eukaryon and application | |
| CN113684190A (en) | Circovirus type 3 double-copy full-length gene infectious clone plasmid and construction method and application thereof | |
| CN105288655A (en) | Application of vacuolar protein sorting 4A to preparing medicines for preventing or treating enterovirus type 71 infection | |
| CN106018809A (en) | Reagent kit for detecting clear renal cell carcinoma | |
| CN104634976A (en) | Human cytomegalovirus active infection rapid detection method and reagent kit for detection method | |
| CN105435245B (en) | Application of the calcium integrin Binding Protein 1 in prevention and treatment enterovirns type 71 infection | |
| CN109266684A (en) | A method of building pathogen infection sensitive animal model | |
| CN109136267A (en) | BVDV ErnsThe method of the ox of albumen and antibody and screening BVDV infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |