CN106632660B - TCR for recognizing NY-ESO-1 antigen short peptide - Google Patents

TCR for recognizing NY-ESO-1 antigen short peptide Download PDF

Info

Publication number
CN106632660B
CN106632660B CN201610958444.5A CN201610958444A CN106632660B CN 106632660 B CN106632660 B CN 106632660B CN 201610958444 A CN201610958444 A CN 201610958444A CN 106632660 B CN106632660 B CN 106632660B
Authority
CN
China
Prior art keywords
tcr
chain
amino acid
seq
ser
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610958444.5A
Other languages
Chinese (zh)
Other versions
CN106632660A (en
Inventor
李懿
相瑞瑞
吴万里
林燕梅
李思韵
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xiangxue Life Science Technology (Guangdong) Co.,Ltd.
Original Assignee
GUANGZHOU XIANGXUE PHARMACEUTICAL CO Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by GUANGZHOU XIANGXUE PHARMACEUTICAL CO Ltd filed Critical GUANGZHOU XIANGXUE PHARMACEUTICAL CO Ltd
Publication of CN106632660A publication Critical patent/CN106632660A/en
Application granted granted Critical
Publication of CN106632660B publication Critical patent/CN106632660B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4632—T-cell receptors [TCR]; antibody T-cell receptor constructs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464484—Cancer testis antigens, e.g. SSX, BAGE, GAGE or SAGE
    • A61K39/464488—NY-ESO
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/867—Retroviral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Mycology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention provides a T Cell Receptor (TCR) capable of specifically binding a short peptide SLLMWITQC derived from the NY-ESO-1 antigen, which can form a complex with HLA A0201 and be presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Description

TCR for recognizing NY-ESO-1 antigen short peptide
Technical Field
The invention relates to a TCR capable of recognizing NY-ESO-1 antigen short peptide, NY-ESO-1 specific T cells obtained by transducing the TCR, and application of the T cells in preventing and treating NY-ESO-1 related diseases.
Background
NY-ESO-1 belongs to a tumor-Testis Antigen (CTA) family, can be expressed in Testis and ovary tissues and various different types of tumor tissues, but is not expressed in other normal tissues, and is a tumor Antigen with stronger specificity. NY-ESO-1 is an endogenous antigen that is degraded into small polypeptides upon intracellular production and is presented to the cell surface in a complex with MHC (major histocompatibility Complex) molecules. SLLMWITQC is a short peptide derived from NY-ESO-1 antigen, and is a target for the treatment of NY-ESO-1 related diseases. NY-ESO-1 was shown to be expressed in a variety of tumor tissues, with very high expression in neuroblastoma (Rodolfo M, et al, Cancer Res,2003,63(20): 6948-. For the treatment of the above diseases, chemotherapy, radiotherapy and the like can be used, but both of them cause damages to normal cells themselves.
T cell adoptive immunotherapy is the transfer of reactive T cells specific for a target cell antigen into a patient to act on the target cell. The T Cell Receptor (TCR) is a membrane protein on the surface of T cells that recognizes a corresponding short peptide antigen on the surface of a target cell. In the immune system, the direct physical contact between T cells and Antigen Presenting Cells (APC) is initiated by the binding of antigen short peptide specific TCR and short peptide-major histocompatibility complex (pMHC complex), and then other cell membrane surface molecules of the T cells and APC interact to cause a series of subsequent cell signaling and other physiological reactions, so that T cells with different antigen specificities exert immune effects on their target cells. Therefore, those skilled in the art have made an effort to isolate a TCR specific for the NY-ESO-1 antigen short peptide and to transduce the TCR into T cells to obtain T cells specific for the NY-ESO-1 antigen short peptide, thereby allowing them to play a role in cellular immunotherapy.
Disclosure of Invention
The invention aims to provide a T cell receptor for recognizing NY-ESO-1 antigen short peptide.
In a first aspect of the invention, there is provided a T Cell Receptor (TCR) capable of binding to the SLLMWITQC-HLA A0201 complex.
In another preferred embodiment, the TCR comprises a TCR alpha chain variable domain and a TCR beta chain variable domain, the amino acid sequence of CDR3 of the TCR alpha chain variable domain is ATDANGKII (SEQ ID NO: 12); and/or the amino acid sequence of CDR3 of the variable domain of the TCR beta chain is ASSLGSNEQY (SEQ ID NO: 15).
In another preferred embodiment, the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:
α CDR1- TSINN (SEQ ID NO:10)
α CDR2- IRSNERE (SEQ ID NO:11)
alpha CDR3-ATDANGKII (SEQ ID NO: 12); and/or
The 3 complementarity determining regions of the TCR β chain variable domain are:
β CDR1- SGHDY (SEQ ID NO:13)
β CDR2- FNNNVP (SEQ ID NO:14)
β CDR3- ASSLGSNEQY (SEQ ID NO:15)。
in another preferred embodiment, the TCR comprises a TCR alpha chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1, and a TCR beta chain variable domain; and/or the TCR β chain variable domain is identical to SEQ ID NO:5 an amino acid sequence having at least 90% sequence identity.
In another preferred embodiment, the TCR comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1.
In another preferred embodiment, the TCR comprises the beta chain variable domain amino acid sequence SEQ ID NO 5.
In another preferred embodiment, the TCR is an α β heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.
In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO:3 and/or the beta chain amino acid sequence of the TCR is SEQ ID NO 7.
In another preferred embodiment, the TCR is soluble.
In another preferred embodiment, the TCR is single chain.
In another preferred embodiment, the TCR is formed by linking an α chain variable domain to a β chain variable domain via a peptide linker.
In another preferred embodiment, the TCR has one or more mutations in amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 of the α chain variable region, and/or in the penultimate 3-, 5-, or 7-position of the short peptide amino acid of the α chain J gene; and/or the TCR has one or more mutations in beta chain variable region amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 th, and/or beta chain J gene short peptide amino acid penultimate 2,4 or 6 th, wherein the amino acid position numbering is according to the position numbering listed in IMGT (international immunogenetic information system).
In another preferred embodiment, the α chain variable domain amino acid sequence of the TCR comprises SEQ ID NO 32 and/or the β chain variable domain amino acid sequence of the TCR comprises SEQ ID NO 34.
In another preferred embodiment, the amino acid sequence of the TCR is SEQ ID NO 30.
In another preferred embodiment, the TCR comprises (a) all or part of a TCR α chain, excluding the transmembrane domain; and (b) all or part of a TCR β chain, excluding the transmembrane domain;
and (a) and (b) each comprise a functional variable domain, or comprise a functional variable domain and at least a portion of the TCR chain constant domain.
In another preferred embodiment, the cysteine residues form an artificial disulfide bond between the alpha and beta chain constant domains of the TCR.
In another preferred embodiment, the cysteine residues forming the artificial disulfide bond in the TCR are substituted at one or more groups of sites selected from the group consisting of:
thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;
thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;
tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01;
thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;
ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;
arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;
pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and
tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.
In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO 26 and/or the β chain amino acid sequence of the TCR is SEQ ID NO 28.
In another preferred embodiment, the TCR comprises an artificial interchain disulfide bond between the α chain variable region and the β chain constant region.
In another preferred embodiment, the cysteine residues that form the artificial interchain disulfide bond in the TCR replace one or more groups of sites selected from the group consisting of:
amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01;
amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01;
amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC2 x 01 exon 1; or
Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01.
In another preferred embodiment, the TCR comprises an alpha chain variable domain and a beta chain variable domain and all or part of the beta chain constant domain, excluding the transmembrane domain, but which does not comprise an alpha chain constant domain, the alpha chain variable domain of the TCR forming a heterodimer with the beta chain.
In another preferred embodiment, the TCR has a conjugate attached to the C-or N-terminus of the alpha and/or beta chain.
In another preferred embodiment, the conjugate that binds to the T cell receptor is a detectable label, a therapeutic agent, a PK modifying moiety or a combination of any of these. Preferably, the therapeutic agent is an anti-CD 3 antibody.
In a second aspect of the invention, there is provided a multivalent TCR complex comprising at least two TCR molecules, and wherein at least one of the TCR molecules is a TCR according to the first aspect of the invention.
In a third aspect of the invention, there is provided a nucleic acid molecule comprising a nucleic acid sequence encoding a TCR molecule according to the first aspect of the invention, or the complement thereof.
In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence encoding the variable domain of the TCR α chain SEQ ID NO:2 or SEQ ID NO: 33.
In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:6 or SEQ ID NO 35.
In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence encoding the TCR α chain SEQ ID NO:4 and/or comprises the nucleotide sequence encoding the TCR β chain SEQ ID NO: 8.
in a fourth aspect of the invention, there is provided a vector comprising a nucleic acid molecule according to the third aspect of the invention; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector.
In a fifth aspect of the invention, there is provided an isolated host cell comprising a vector according to the fourth aspect of the invention or a genome into which has been integrated an exogenous nucleic acid molecule according to the third aspect of the invention.
In a sixth aspect of the invention, there is provided a cell which transduces a nucleic acid molecule according to the third aspect of the invention or a vector according to the fourth aspect of the invention; preferably, the cell is a T cell or a stem cell.
In a seventh aspect of the invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to the first aspect of the invention, a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention.
In an eighth aspect, the invention provides the use of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, for the manufacture of a medicament for the treatment of a tumour or an autoimmune disease.
In a ninth aspect of the invention, there is provided a method of treating a disease comprising administering to a subject in need thereof an amount of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, or a pharmaceutical composition according to the seventh aspect of the invention;
preferably, the disease is a tumor, preferably the tumor comprises neuroblastoma, sarcoma, melanoma, prostate cancer, bladder cancer, breast cancer, multiple myeloma, hepatocellular carcinoma, oral squamous carcinoma, esophageal cancer, as well as gastric cancer, lung cancer, head and neck squamous cell carcinoma, colon cancer, ovarian cancer, and the like.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
Drawings
FIG. 1a, FIG. 1b, FIG. 1c, FIG. 1d, FIG. 1e and FIG. 1f are the amino acid sequence of the TCR α chain variable domain, the nucleotide sequence of the TCR α chain variable domain, the amino acid sequence of the TCR α chain, the nucleotide sequence of the TCR α chain, the amino acid sequence of the TCR α chain with leader sequence and the nucleotide sequence of the TCR α chain with leader sequence, respectively.
Fig. 2a, fig. 2b, fig. 2c, fig. 2d, fig. 2e and fig. 2f are a TCR β chain variable domain amino acid sequence, a TCR β chain variable domain nucleotide sequence, a TCR β chain amino acid sequence, a TCR β chain nucleotide sequence, a TCR β chain amino acid sequence with a leader sequence and a TCR β chain nucleotide sequence with a leader sequence, respectively.
FIG. 3 is CD8 of monoclonal cells+And tetramer-PE double positive staining results.
Fig. 4a and 4b are the amino acid and nucleotide sequences, respectively, of a soluble TCR α chain.
Fig. 5a and 5b are the amino acid and nucleotide sequences, respectively, of a soluble TCR β chain.
Figure 6 is a gel diagram of the soluble TCR obtained after purification. The leftmost lane is reducing gel, the middle lane is molecular weight marker (marker), and the rightmost lane is non-reducing gel.
FIGS. 7a and 7b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR.
FIGS. 8a and 8b are the amino acid and nucleotide sequences, respectively, of a single chain TCR α chain.
Fig. 9a and 9b are the amino acid and nucleotide sequences, respectively, of a single chain TCR β chain.
FIGS. 10a and 10b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR linker sequence (linker).
FIG. 11 is a gel diagram of the soluble single chain TCR obtained after purification.
FIG. 12 is a BIAcore kinetic profile of binding of soluble TCRs of the invention to SLLMWITQC-HLA A0201 complex.
FIG. 13 is a BIAcore kinetic profile of binding of soluble single chain TCRs of the invention to SLLMWITQC- -HLA A0201 complex.
FIG. 14 shows that cells transduced with a TCR of the invention have a killing effect on target cells expressing the relevant antigen, but have substantially no killing effect on target cells not expressing the relevant antigen.
Detailed Description
The present inventors have made extensive and intensive studies to find a TCR capable of specifically binding to the NY-ESO-1 antigen short peptide SLLMWITQC (SEQ ID NO:9) which can form a complex with HLA A0201 and be presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.
Term(s) for
MHC molecules are proteins of the immunoglobulin superfamily, which may be MHC class I or class II molecules. Therefore, it is specific for antigen presentation, different individuals have different MHC, and different short peptides in one protein antigen can be presented on the cell surface of respective APC. Human MHC is commonly referred to as an HLA gene or HLA complex.
The T Cell Receptor (TCR), is the only receptor for a specific antigenic peptide presented on the Major Histocompatibility Complex (MHC). In the immune system, direct physical contact between T cells and Antigen Presenting Cells (APCs) is initiated by the binding of antigen-specific TCRs to pMHC complexes, and then other cell membrane surface molecules of both T cells and APCs interact, which causes a series of subsequent cell signaling and other physiological reactions, thereby allowing T cells of different antigen specificities to exert immune effects on their target cells.
TCRs are cell membrane surface glycoproteins that exist as heterodimers from either the α chain/β chain or the γ chain/δ chain. In 95% of T cells the TCR heterodimer consists of α and β chains, while 5% of T cells have TCRs consisting of γ and δ chains. Native α β heterodimeric TCRs have an α chain and a β chain, which constitute subunits of an α β heterodimeric TCR. Broadly, each of the α and β chains comprises a variable region, a linker region and a constant region, and the β chain also typically contains a short diversity region between the variable region and the linker region, but the diversity region is often considered to be part of the linker region. Each variable region comprises 3 CDRs (complementarity determining regions) CDR1, CDR2 and CDR3, which are chimeric in framework structures (framework regions). The CDR regions determine the binding of the TCR to the pMHC complex, where CDR3 is recombined from variable and connecting regions, referred to as hypervariable regions. The α and β chains of a TCR are generally regarded as having two "domains" each, namely a variable domain and a constant domain, the variable domain being made up of linked variable regions and linking regions. The sequences of TCR constant domains can be found in public databases of the international immunogenetic information system (IMGT), such as the constant domain sequence of the α chain of the TCR molecule is "TRAC 01", the constant domain sequence of the β chain of the TCR molecule is "TRBC 1 01" or "TRBC 2 01". In addition, the α and β chains of the TCR also comprise a transmembrane region and a cytoplasmic region, the cytoplasmic region being very short.
In the present invention, the terms "polypeptide of the invention", "TCR of the invention", "T cell receptor of the invention" are used interchangeably.
Natural interchain disulfide bond and artificial interchain disulfide bond
A set of disulfide bonds, referred to herein as "native interchain disulfide bonds," exist between the C α and C β chains of the membrane proximal region of native TCRs. In the present invention, the artificially introduced interchain covalent disulfide bond whose position is different from that of the natural interchain disulfide bond is referred to as an "artificial interchain disulfide bond".
For convenience of description of the positions of disulfide bonds, the positions of the amino acid sequences of TRAC 01 and TRBC1 × 01 or TRBC2 × 01 are numbered in the order from the N-terminus to the C-terminus, such as in TRBC1 × 01 or TRBC2 × 01, and the 60 th amino acid in the order from the N-terminus to the C-terminus is P (proline), and thus in the present invention it can be described as Pro60 of TRBC1 × 01 or TRBC2 × 01 exon 1, and also as the 60 th amino acid of TRBC1 × 01 or TRBC2 × 01 exon 1, and as in 737bc 3 × 01 or TRBC2 × 01, and the 61 th amino acid in the order from the N-terminus to the C-terminus is Q (glutamine), and thus in the present invention it can be described as TRBC1 × 01 or TRBC 6301 × 01, or TRBC 8501, and similarly as TRBC 8261 or glbc 891. In the present invention, the position numbering of the amino acid sequences of the variable regions TRAV and TRBV follows the position numbering listed in IMGT. If an amino acid in TRAV, the position listed in IMGT is numbered 46, it is described herein as the 46 th amino acid of TRAV, and so on. In the present invention, the sequence position numbers of other amino acids are specifically described.
Detailed Description
TCR molecules
During antigen processing, antigens are degraded within cells and then carried to the cell surface by MHC molecules. T cell receptors are capable of recognizing peptide-MHC complexes on the surface of antigen presenting cells. Accordingly, in a first aspect the invention provides a TCR molecule capable of binding to the SLLMWITQC-HLA a0201 complex. Preferably, the TCR molecule is isolated or purified. The α and β chains of the TCR each have 3 Complementarity Determining Regions (CDRs).
In a preferred embodiment of the invention, the α chain of the TCR comprises CDRs having the amino acid sequence:
α CDR1- TSINN (SEQ ID NO:10)
α CDR2- IRSNERE (SEQ ID NO:11)
alpha CDR3-ATDANGKII (SEQ ID NO: 12); and/or
The 3 complementarity determining regions of the TCR β chain variable domain are:
β CDR1- SGHDY (SEQ ID NO:13)
β CDR2- FNNNVP (SEQ ID NO:14)
β CDR3- ASSLGSNEQY (SEQ ID NO:15)。
chimeric TCRs can be prepared by embedding the above-described amino acid sequences of the CDR regions of the invention into any suitable framework. One skilled in the art can design or synthesize a TCR molecule with the corresponding function based on the CDR regions disclosed herein, so long as the framework structure is compatible with the CDR regions of the TCR of the invention. Thus, the TCR molecules of the invention are those which comprise the above-described α and/or β chain CDR region sequences and any suitable framework structure. The TCR α chain variable domain of the invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID No. 1; and/or the TCR β chain variable domain of the invention is a variant of SEQ ID NO:5, having at least 90%, preferably 95%, more preferably 98% sequence identity.
In a preferred embodiment of the invention, the TCR molecules of the invention are heterodimers consisting of α and β chains. In particular, in one aspect the α chain of the heterodimeric TCR molecules comprises a variable domain and a constant domain, the α chain variable domain amino acid sequence comprising CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) of the above-described α chain. Preferably, the TCR molecule comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1. More preferably, the amino acid sequence of the α chain variable domain of the TCR molecule is SEQ ID NO 1. In another aspect, the β chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, and the β chain variable domain amino acid sequence comprises CDR1(SEQ ID NO:13), CDR2(SEQ ID NO: 14), and CDR3(SEQ ID NO:15) of the above-described β chain. Preferably, the TCR molecule comprises the beta chain variable domain amino acid sequence SEQ ID NO 5. More preferably, the amino acid sequence of the β chain variable domain of the TCR molecule is SEQ ID NO 5.
In a preferred embodiment of the invention, the TCR molecules of the invention are single chain TCR molecules consisting of part or all of the α chain and/or part or all of the β chain. Single chain TCR molecules are described in Chung et al (1994) Proc. Natl. Acad. Sci. USA 91, 12654-. From the literature, those skilled in the art are readily able to construct single chain TCR molecules comprising the CDRs regions of the invention. In particular, the single chain TCR molecule comprises V α, V β and C β, preferably linked in order from N-terminus to C-terminus.
The alpha chain variable domain amino acid sequence of the single chain TCR molecule comprises the CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) of the alpha chain described above. Preferably, the single chain TCR molecule comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1. More preferably, the α chain variable domain amino acid sequence of the single chain TCR molecule is SEQ ID NO 1. The amino acid sequence of the beta chain variable domain of the single chain TCR molecule comprises the CDR1(SEQ ID NO:13), CDR2(SEQ ID NO: 14) and CDR3(SEQ ID NO:15) of the above-described beta chain. Preferably, the single chain TCR molecule comprises the beta chain variable domain amino acid sequence SEQ ID NO 5. More preferably, the amino acid sequence of the β chain variable domain of the single chain TCR molecule is SEQ ID NO 5.
In a preferred embodiment of the invention, the constant domain of the TCR molecules of the invention is a human constant domain. The human constant domain amino acid sequences are known to those skilled in the art or can be obtained by consulting published databases of relevant books or IMGT (international immunogenetic information system). For example, the constant domain sequence of the α chain of the TCR molecules of the invention can be "TRAC 01", and the constant domain sequence of the β chain of the TCR molecules can be "TRBC 1 01" or "TRBC 2 01". Arg at position 53 of the amino acid sequence given in TRAC 01 of IMGT, here denoted: TRAC × 01 Arg53 of exon 1, and so on. Preferably, the amino acid sequence of the α chain of the TCR molecule of the invention is SEQ ID NO 3 and/or the amino acid sequence of the β chain is SEQ ID NO 7.
Naturally occurring TCRs are membrane proteins that are stabilized by their transmembrane regions. Like immunoglobulins (antibodies) as antigen recognition molecules, TCRs can also be developed for diagnostic and therapeutic applications, where soluble TCR molecules are required. Soluble TCR molecules do not include their transmembrane regions. Soluble TCRs have a wide range of uses, not only for studying the interaction of TCRs with pmhcs, but also as diagnostic tools for detecting infections or as markers for autoimmune diseases. Similarly, soluble TCRs can be used to deliver therapeutic agents (e.g., cytotoxic or immunostimulatory compounds) to cells presenting a specific antigen, and in addition, soluble TCRs can be conjugated to other molecules (e.g., anti-CD 3 antibodies) to redirect T cells to target them to cells presenting a particular antigen. The invention also obtains soluble TCR with specificity to NY-ESO-1 antigen short peptide.
To obtain a soluble TCR, in one aspect, the inventive TCR may be one in which an artificial disulfide bond is introduced between residues of the constant domains of its alpha and beta chains. Cysteine residues form an artificial interchain disulfide bond between the alpha and beta chain constant domains of the TCR. Cysteine residues may be substituted for other amino acid residues at appropriate positions in native TCRs to form artificial interchain disulfide bonds. For example, a disulfide bond is formed by substituting Thr48 of exon 1 of TRAC × 01 and a cysteine residue of Ser57 of exon 1 of TRBC1 × 01 or TRBC2 × 01. Other sites for introducing cysteine residues to form disulfide bonds may also be: thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1; tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01; thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1; ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1; arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1; pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; or Tyr10 and TRBC1 and 01 of TRAC 01 exon 1 or Glu20 of TRBC2 and 01 exon 1. I.e., a cysteine residue, in place of any of the above-described alpha and beta chain constant domains. The TCR constant domains of the invention may be truncated at one or more of their C-termini by up to 50, or up to 30, or up to 15, or up to 10, or up to 8 or fewer amino acids, so as not to include a cysteine residue for the purpose of deleting the native disulphide bond, or by mutating the cysteine residue forming the native disulphide bond to another amino acid.
As described above, the TCRs of the invention may comprise artificial disulfide bonds introduced between residues of the constant domains of their alpha and beta chains. It should be noted that the TCRs of the invention may each contain both TRAC constant domain sequences and TRBC1 or TRBC2 constant domain sequences, with or without the artificial disulfide bonds introduced as described above between the constant domains. The TRAC constant domain sequence and TRBC1 or TRBC2 constant domain sequences of the TCR may be linked by the native disulfide bond present in the TCR.
To obtain a soluble TCR, on the other hand, the inventive TCR also comprises a TCR having a mutation in its hydrophobic core region, preferably a mutation that enables an improved stability of the inventive soluble TCR, as described in the patent publication WO 2014/206304. Such TCRs may be mutated at the following variable domain hydrophobic core positions: (alpha and/or beta chain) variable region amino acid positions 11, 13, 19, 21, 53, 76, 89, 91, 94, and/or positions 3,5,7 of the reciprocal amino acid position of the short peptide of the alpha chain J gene (TRAJ), and/or positions 2,4,6 of the reciprocal amino acid position of the short peptide of the beta chain J gene (TRBJ), wherein the position numbering of the amino acid sequence is according to the position numbering listed in the International immunogenetic information System (IMGT). The above-mentioned international system of immunogenetics information is known to the skilled person and the position numbering of the amino acid residues of the different TCRs in IMGT can be derived from this database.
The TCR with the mutated hydrophobic core region of the invention can be a stable soluble single chain TCR formed by connecting the variable domains of the alpha and beta chains of the TCR by a flexible peptide chain. It should be noted that the flexible peptide chain of the present invention can be any peptide chain suitable for linking the TCR α and β chain variable domains. The single-chain soluble TCR constructed as in example 4 of the invention has an alpha chain variable domain amino acid sequence of SEQ ID NO. 32 and an encoded nucleotide sequence of SEQ ID NO. 33; the amino acid sequence of the beta chain variable domain is SEQ ID NO. 34, and the coded nucleotide sequence is SEQ ID NO. 35.
In addition, for stability, patent document 201510260322.4 also discloses that the introduction of an artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR can significantly improve the stability of the TCR. Thus, the high affinity TCRs of the invention may also contain an artificial interchain disulfide bond between the α chain variable region and the β chain constant region. Specifically, the cysteine residues that form the artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR are substituted for: amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01; amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01; amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC2 x 01 exon 1; or amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01. Preferably, such a TCR may comprise (i) all or part of a TCR α chain, excluding its transmembrane domain, and (ii) all or part of a TCR β chain, excluding its transmembrane domain, wherein (i) and (ii) both comprise the variable domain and at least part of the constant domain of the TCR chain, the α chain forming a heterodimer with the β chain. More preferably, such a TCR may comprise the a chain variable domain and the β chain variable domain and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the a chain constant domain, the a chain variable domain of the TCR forming a heterodimer with the β chain.
The TCRs of the invention may also be provided in the form of multivalent complexes. Multivalent TCR complexes of the invention comprise polymers formed by association of two, three, four or more TCRs of the invention, such as might be produced as a tetramer using the tetrameric domain of p53, or a complex formed by association of a plurality of TCRs of the invention with another molecule. The TCR complexes of the invention can be used to track or target cells presenting a particular antigen in vitro or in vivo, and can also be used to generate intermediates for other multivalent TCR complexes having such applications.
The TCRs of the invention may be used alone or in covalent or other association, preferably covalently, with a conjugate. The conjugates include a detectable label (for diagnostic purposes, wherein the TCR is used to detect the presence of cells presenting the SLLMWITQC-HLA a0201 complex), a therapeutic agent, a PK (protein kinase) modifying moiety, or a combination of any of the above.
Detectable labels for diagnostic purposes include, but are not limited to: a fluorescent or luminescent label, a radioactive label, an MRI (magnetic resonance imaging) or CT (computed tomography) contrast agent, or an enzyme capable of producing a detectable product.
Therapeutic agents that may be associated or conjugated with the TCRs of the invention include, but are not limited to: 1. radionuclides (Koppe et al, 2005, Cancer metastasis reviews (Cancer metastasis) 24, 539); 2. biotoxicity (Chaudhary et al, 1989, Nature 339, 394; Epel et al, 2002, Cancer Immunology and Immunotherapy 51, 565); 3. cytokines such as IL-2 and the like (Gillies et al, 1992, Proc. Natl. Acad. Sci. USA (PNAS)89, 1428; Card et al, 2004, Cancer Immunology and Immunotherapy)53, 345; Halin et al, 2003, Cancer Research 63, 3202); 4. antibody Fc fragment (Mosquera et al, 2005, Journal Of Immunology 174, 4381); 5. antibody scFv fragments (Zhu et al, 1995, International Journal of Cancer 62,319); 6. gold nanoparticles/nanorods (Lapotko et al, 2005, Cancer letters 239, 36; Huang et al, 2006, Journal of the American Chemical Society 128, 2115); 7. viral particles (Peng et al, 2004, Gene therapy 11, 1234); 8. liposomes (Mamot et al, 2005, Cancer research 65, 11631); 9. nano magnetic particles; 10. prodrug activating enzymes (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 11. chemotherapeutic agents (e.g., cisplatin) or nanoparticles in any form, and the like.
In addition, the TCRs of the invention may also be hybrid TCRs comprising sequences derived from more than one species. For example, studies have shown that murine TCRs are more efficiently expressed in human T cells than human TCRs. Thus, the inventive TCR may comprise a human variable domain and a murine constant domain. The drawback of this approach is the possibility of eliciting an immune response. Thus, there should be a regulatory regimen to immunosuppresse when it is used for adoptive T cell therapy to allow for the engraftment of murine expressing T cells.
It should be understood that the amino acid names herein are expressed in terms of international single-letter or three-letter english letters, and the single-letter english letter and three-letter english letters of the amino acid names correspond to the following relationships: ala (A), Arg (R), Asn (N), Asp (D), Cys (C), Gln (Q), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y) and Val (V).
Nucleic acid molecules
A second aspect of the invention provides a nucleic acid molecule encoding a TCR molecule of the first aspect of the invention or a portion thereof, which may be one or more CDRs, variable domains of the alpha and/or beta chains, and the alpha and/or beta chains.
The nucleotide sequence encoding the α chain CDR regions of the TCR molecules of the first aspect of the invention is as follows:
α CDR1- actagtataaacaat (SEQ ID NO:16)
α CDR2- atacgttcaaatgaaagagag (SEQ ID NO:17)
α CDR3- gctacggacgcaaacggcaagatcatc (SEQ ID NO:18)
the nucleotide sequence encoding the β chain CDR regions of the TCR molecules of the first aspect of the invention is as follows:
β CDR1- tcaggacacgactac (SEQ ID NO:19)
β CDR2- tttaacaacaacgttccg (SEQ ID NO:20)
β CDR3- gccagcagtttagggagcaacgagcagtac (SEQ ID NO:21)
thus, the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR alpha chain of the invention comprises SEQ ID NO 16, 17 and 18 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR beta chain of the invention comprises SEQ ID NO 19, 20 and 21.
The nucleotide sequence of the nucleic acid molecule of the invention may be single-stranded or double-stranded, the nucleic acid molecule may be RNA or DNA, and may or may not comprise an intron. Preferably, the nucleotide sequence of the nucleic acid molecule of the invention does not comprise an intron but is capable of encoding a polypeptide of the invention, e.g. the nucleotide sequence of the nucleic acid molecule of the invention encoding a TCR alpha chain variable domain of the invention comprises SEQ ID NO 2 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding a TCR beta chain variable domain of the invention comprises SEQ ID NO 6. Alternatively, the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR α chain variable domain of the invention comprises SEQ ID NO 33 and/or the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR β chain variable domain of the invention comprises SEQ ID NO 35. More preferably, the nucleotide sequence of the nucleic acid molecule of the invention comprises SEQ ID NO. 4 and/or SEQ ID NO. 8. Alternatively, the nucleotide sequence of the nucleic acid molecule of the invention is SEQ ID NO. 31.
It will be appreciated that, due to the degeneracy of the genetic code, different nucleotide sequences may encode the same polypeptide. Thus, the nucleic acid sequence encoding the TCR of the present invention may be identical to or a degenerate variant of the nucleic acid sequences shown in the figures of the present invention. As illustrated by one of the examples herein, a "degenerate variant" refers to a nucleic acid sequence that encodes a protein sequence having SEQ ID NO. 1, but differs from the sequence of SEQ ID NO. 2.
The nucleotide sequence may be codon optimized. Different cells differ in the utilization of specific codons, and the expression level can be increased by changing the codons in the sequence according to the type of the cell. Codon usage tables for mammalian cells as well as for various other organisms are well known to those skilled in the art.
The full-length sequence of the nucleic acid molecule of the present invention or a fragment thereof can be obtained by, but not limited to, PCR amplification, recombination, or artificial synthesis. At present, DNA sequences encoding the TCRs of the invention (or fragments or derivatives thereof) have been obtained entirely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. The DNA may be the coding strand or the non-coding strand.
Carrier
The invention also relates to vectors comprising the nucleic acid molecules of the invention, including expression vectors, i.e. constructs capable of expression in vivo or in vitro. Commonly used vectors include bacterial plasmids, bacteriophages and animal and plant viruses.
Viral delivery systems include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, baculoviral vectors.
Preferably, the vector can transfer the nucleotide of the invention into a cell, for example a T cell, such that the cell expresses a TCR specific for the NY-ESO-1 antigen. Ideally, the vector should be capable of sustained high level expression in T cells.
Cells
The invention also relates to genetically engineered host cells that have been engineered with the vectors or coding sequences of the invention. The host cell comprises a vector of the invention or has integrated into its chromosome a nucleic acid molecule of the invention. The host cell is selected from: prokaryotic and eukaryotic cells, such as E.coli, yeast cells, CHO cells, and the like.
In addition, the invention also includes isolated cells, particularly T cells, that express the TCRs of the invention. The T cell may be derived from a T cell isolated from a subject, or may be part of a mixed population of cells isolated from a subject, such as a population of Peripheral Blood Lymphocytes (PBLs). For example, the cells may be isolated from Peripheral Blood Mononuclear Cells (PBMC), which may be CD4+Helper T cell or CD8+Cytotoxic T cells. The cell may be in CD4+Helper T cell/CD 8+A mixed population of cytotoxic T cells. Generally, the cells can be activated with an antibody (e.g., an anti-CD 3 or anti-CD 28 antibody) to render them more amenable to transfection, e.g., transfection with a vector comprising a nucleotide sequence encoding a TCR molecule of the invention.
Alternatively, the cell of the invention may also be or be derived from a stem cell, such as a Hematopoietic Stem Cell (HSC). Gene transfer to HSCs does not result in TCR expression on the cell surface, since the CD3 molecule is not expressed on the stem cell surface. However, when stem cells differentiate into lymphoid precursors (lymphoid precursors) that migrate to the thymus, expression of the CD3 molecule will initiate expression of the introduced TCR molecule on the surface of the thymocytes.
There are many methods suitable for T cell transfection using DNA or RNA encoding the TCR of the invention (e.g., Robbins et al, (2008) J.Immunol.180: 6116-. T cells expressing the TCRs of the invention may be used for adoptive immunotherapy. Those skilled in the art will be able to recognize many suitable methods for adoptive therapy (e.g., Rosenberg et al, (2008) Nat Rev Cancer8 (4): 299-308).
NY-ESO-1 antigen related diseases
The invention also relates to a method of treating and/or preventing a NY-ESO-1 related disease in a subject comprising the step of adoptively transferring NY-ESO-1 specific T cells to the subject. The NY-ESO-1 specific T cells recognize SLLMWITQC-HLA A0201 complex.
The NY-ESO-1 specific T cells of the invention can be used for treating any NY-ESO-1 related diseases presenting NY-ESO-1 antigen short peptide SLLMWITQC-HLA A0201 complex, including but not limited to tumors, preferably the tumors comprise neuroblastoma, sarcoma, melanoma, prostate cancer, bladder cancer, breast cancer, multiple myeloma, hepatocellular carcinoma, oral squamous carcinoma, esophageal cancer, gastric cancer, lung cancer, head and neck squamous cell carcinoma, colon cancer, ovarian cancer and the like.
Method of treatment
Treatment may be effected by isolating T cells from patients or volunteers suffering from a disease associated with the NY-ESO-1 antigen and introducing the TCR of the invention into such T cells, followed by reinfusion of these genetically engineered cells into the patient. Accordingly, the present invention provides a method of treating a NY-ESO-1 related disorder comprising infusing into a patient isolated T cells expressing a TCR according to the invention, preferably, the T cells are derived from the patient themselves. Generally, this involves (1) isolating T cells from the patient, (2) transducing T cells in vitro with a nucleic acid molecule of the invention or a nucleic acid molecule capable of encoding a TCR molecule of the invention, and (3) infusing the genetically modified T cells into the patient. The number of cells isolated, transfected and transfused can be determined by a physician.
The main advantages of the invention are:
(1) the TCR can be combined with the NY-ESO-1 antigen short peptide complex SLLMWITQC-HLA A0201, and cells transduced with the TCR can be specifically activated and have strong killing effect on target cells.
The following specific examples further illustrate the invention. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not indicated in the following examples, are generally carried out according to conventional conditions, for example as described in Sambrook and Russell et al, Molecular Cloning: A Laboratory Manual (third edition) (2001) CSHL Press, or according to the conditions as recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.
Example 1 cloning of NY-ESO-1 antigen short peptide-specific T cells
Peripheral Blood Lymphocytes (PBLs) from healthy volunteers of genotype HLA-A0201 were stimulated using the synthetic short peptide SLLMWITQC (SEQ ID NO.: 9; Baisheng Gene technologies, Beijing). The SLLMWITQC short peptide and HLA-A0201 with biotin label are renatured to prepare pHLA haploid. These haploids were combined with streptavidin labeled with PE (BD Co.) to form PE-labeled tetramers, which were sorted for double positive anti-CD 8-APC cells. The sorted cells were expanded and subjected to secondary sorting as described above, followed by single cloning by limiting dilution. Monoclonal cells were stained with tetramer and double positive clones were selected as shown in FIG. 3.
Example 2 construction of TCR Gene and vector for obtaining NY-ESO-1 antigen short peptide specific T cell clone
Using Quick-RNATMMiniPrep (ZYMO research) extracts total RNA from the T cell clone specific to the antigen short peptide SLLMWITQC and restricted by HLA-A0201 selected in example 1. Synthesis of cDNA Using clontech, the primers used in the SMART RACE cDNA amplification kit were designed to preserve the C-terminal region of the human TCR gene. The sequences were cloned into the T vector (TAKARA) and sequenced. It should be noted that the sequence is a complementary sequence, not including introns. The alpha chain and beta chain sequence structures of the TCR expressed by the double positive clone are respectively shown in figure 1 and figure 2 by sequencing, and figure 1a, figure 1b, figure 1c, figure 1d, figure 1e and figure 1f are respectively a TCR alpha chain variable domain amino acid sequence, a TCR alpha chain variable domain nucleotide sequence, a TCR alpha chain amino acid sequence, a TCR alpha chain nucleotide sequence, a TCR alpha chain amino acid sequence with a leader sequence and a TCR alpha chain nucleotide sequence with the leader sequence; fig. 2a, fig. 2b, fig. 2c, fig. 2d, fig. 2e and fig. 2f are a TCR β 0 chain variable domain amino acid sequence, a TCR β 1 chain variable domain nucleotide sequence, a TCR β 2 chain amino acid sequence, a TCR β 3 chain nucleotide sequence, a TCR β chain amino acid sequence with a leader sequence and a TCR β chain nucleotide sequence with a leader sequence, respectively.
The alpha chain was identified to comprise CDRs with the following amino acid sequences:
α CDR1- TSINN (SEQ ID NO:10)
α CDR2- IRSNERE (SEQ ID NO:11)
α CDR3- ATDANGKII (SEQ ID NO:12)
the beta chain comprises CDRs having the following amino acid sequences:
β CDR1-SGHDY (SEQ ID NO:13)
β CDR2-FNNNVP (SEQ ID NO:14)
β CDR3-ASSLGSNEQY (SEQ ID NO:15)
the full length genes for the TCR α and β chains were cloned into the lentiviral expression vector pllenti (addendum) by overlap (overlap) PCR, respectively. The method specifically comprises the following steps: the TCR alpha chain and the TCR beta chain are connected by overlap PCR to obtain the TCR alpha-2A-TCR beta segment. And (3) carrying out enzyme digestion and connection on the lentivirus expression vector and the TCR alpha-2A-TCR beta to obtain pLenti-TRA-2A-TRB-IRES-NGFR plasmid. As a control, a lentiviral vector pLenti-eGFP expressing eGFP was also constructed. The pseudovirus was then packaged again at 293T/17.
Example 3 expression, refolding and purification of NY-ESO-1 antigen short peptide-specific soluble TCR
To obtain soluble TCR molecules, the α and β chains of the TCR molecules of the invention may comprise only the variable and part of the constant domains thereof, respectively, and a cysteine residue has been introduced into the constant domains of the α and β chains, respectively, to form artificial interchain disulfide bonds, at the positions Thr48 of exon 1 TRAC × 01 and Ser57 of exon 1 TRBC2 × 01, respectively; the amino acid sequence and nucleotide sequence of the alpha chain are shown in FIGS. 4a and 4b, respectively, and the amino acid sequence and nucleotide sequence of the beta chain are shown in FIGS. 5a and 5b, respectively, and the introduced cysteine residues are shown in bold and underlined letters. The above-mentioned gene sequences of interest for the TCR alpha and beta chains were synthesized and inserted into the expression vector pET28a + (Novagene) by standard methods described in Molecular Cloning A Laboratory Manual (third edition, Sambrook and Russell), and the upstream and downstream Cloning sites were NcoI and NotI, respectively. The insert was confirmed by sequencing without error.
The expression vectors of TCR alpha and beta chains are transformed into expression bacteria BL21(DE3) by chemical transformation method, and the bacteria are grown in LB culture solution and OD600Inclusion bodies formed after expression of the α and β chains of the TCR were extracted by BugBuster Mix (Novagene) and washed repeatedly with BugBuster solution several times at 0.6 final induction with final concentration of 0.5mM IPTG, and finally dissolved in 6M guanidine hydrochloride, 10mM Dithiothreitol (DTT),10mM ethylenediaminetetraacetic acid (EDTA),20mM Tris (pH 8.1).
The TCR α and β chains after lysis were separated by 1: 1 was rapidly mixed in 5M urea, 0.4M arginine, 20mM Tris (pH 8.1),3.7mM cystamine,6.6mM β -mercaptamine (4 ℃) to a final concentration of 60 mg/mL. After mixing, the solution was dialyzed against 10 volumes of deionized water (4 ℃ C.) and after 12 hours, the deionized water was changed to a buffer (20mM Tris, pH 8.0) and dialysis was continued at 4 ℃ for 12 hours. The solution after completion of dialysis was filtered through a 0.45. mu.M filter and then purified by an anion exchange column (HiTrap Q HP,5ml, GE Healthcare). The TCR eluted with peaks containing successfully renatured α and β dimers was confirmed by SDS-PAGE gel. The TCR was subsequently further purified by gel filtration chromatography (HiPrep 16/60, Sephacryl S-100 HR, GE Healthcare). The purity of the purified TCR was greater than 90% as determined by SDS-PAGE and the concentration was determined by BCA. The SDS-PAGE gel of the soluble TCR of the invention is shown in FIG. 6.
Example 4 Generation of soluble Single chain TCR specific for NY-ESO-1 antigen short peptides
According to the disclosure of WO2014/206304, the variable domains of TCR α and β chains in example 2 were constructed as a stable soluble single-chain TCR molecule linked by a short flexible peptide (linker) using site-directed mutagenesis. The amino acid sequence and the nucleotide sequence of the single-chain TCR molecule are shown in FIG. 7a and FIG. 7b, respectively. The amino acid sequence and nucleotide sequence of the alpha chain variable domain are shown in FIG. 8a and FIG. 8b, respectively; the amino acid sequence and nucleotide sequence of its beta-chain variable domain are shown in FIG. 9a and FIG. 9b, respectively; the amino acid sequence and the nucleotide sequence of the linker sequence are shown in FIG. 10a and FIG. 10b, respectively.
The target gene was digested simultaneously with Nco I and Not I, and ligated with pET28a vector digested simultaneously with Nco I and Not I. Transforming the ligation product to E.coli DH5 alpha, coating LB plate containing kanamycin, inverting and culturing overnight at 37 ℃, selecting positive clone to carry out PCR screening, sequencing positive recon, extracting recombinant plasmid to transform to E.coli BL21(DE3) after determining the sequence is correct, and using the recombinant plasmid for expression.
Example 5 expression, renaturation and purification of soluble Single-chain TCR specific for NY-ESO-1 antigen short peptides
The BL21(DE3) colony containing the recombinant plasmid pET28 a-template strand prepared in example 4 was inoculated in its entirety into LB medium containing kanamycin, cultured at 37 ℃ to OD600 of 0.6 to 0.8, IPTG was added to a final concentration of 0.5mM, and the culture was continued at 37 ℃ for 4 hours. The cell pellet was harvested by centrifugation at 5000rpm for 15min, the cell pellet was lysed by Bugbuster Master Mix (Merck), inclusion bodies were recovered by centrifugation at 6000rpm for 15min, washed with Bugbuster (Merck) to remove cell debris and membrane components, and centrifuged at 6000rpm for 15min to collect the inclusion bodies. The inclusion bodies were dissolved in buffer (20mM Tris-HCl pH 8.0,8M urea), the insoluble material was removed by high speed centrifugation, the supernatant was quantified by BCA method and split charged, and stored at-80 ℃ for further use.
To 5mg of solubilized single-chain TCR inclusion body protein, 2.5mL of buffer (6M Gua-HCl, 50mM Tris-HCl pH 8.1, 100mM NaCl, 10mM EDTA) was added, DTT was added to a final concentration of 10mM, and treatment was carried out at 37 ℃ for 30 min. The treated single-chain TCR was added dropwise to 125mL of renaturation buffer (100mM Tris-HCl pH 8.1,0.4M L-arginine, 5M urea, 2mM EDTA,6.5mM beta-mercaptoethylamine, 1.87mM Cystamine) with a syringe, stirred at 4 ℃ for 10min, and then the renaturation solution was filled into a cellulose membrane dialysis bag with a cut-off of 4kDa, and the bag was placed in 1L of precooled water and stirred slowly at 4 ℃ overnight. After 17 hours, the dialysate was changed to 1L of pre-chilled buffer (20mM Tris-HCl pH 8.0), dialysis was continued at 4 ℃ for 8h, and then dialysis was continued overnight with the same fresh buffer. After 17 hours, the sample was filtered through a 0.45 μ M filter, vacuum degassed and then passed through an anion exchange column (HiTrap Q HP, GE Healthcare), the protein was purified using a 0-1M NaCl linear gradient eluent formulated in 20mM Tris-HCl pH 8.0, the collected fractions were subjected to SDS-PAGE analysis, the fractions containing single-stranded TCR were concentrated and then further purified using a gel filtration column (Superdex 7510/300, GE Healthcare), and the target fraction was also subjected to SDS-PAGE analysis.
The eluted fractions for BIAcore analysis were further tested for purity using gel filtration. The conditions are as follows: the chromatographic column Agilent Bio SEC-3(300A, phi 7.8X 300mM) and the mobile phase are 150mM phosphate buffer solution, the flow rate is 0.5mL/min, the column temperature is 25 ℃, and the ultraviolet detection wavelength is 214 nm.
The SDS-PAGE gel of the soluble single-chain TCR obtained by the invention is shown in FIG. 11.
Example 6 binding characterization
BIAcore analysis
This example demonstrates that soluble TCR molecules of the invention are capable of specifically binding the SLLMWITQC-HLA A0201 complex.
The binding activity of the TCR molecules obtained in examples 3 and 5 to the SLLMWITQC-HLA A0201 complex was measured using a BIAcore T200 real-time assay system. Anti-streptavidin antibody (GenScript) was added to coupling buffer (10mM sodium acetate buffer, pH 4.77), and then the antibody was passed through CM5 chip previously activated with EDC and NHS to immobilize the antibody on the chip surface, and finally the unreacted activated surface was blocked with ethanolamine hydrochloric acid solution to complete the coupling process at a coupling level of about 15,000 RU.
The low concentration of streptavidin through the coated chip surface, then SLLMWITQC-HLA A0201 complex flow through the detection channel, another channel as a reference channel, and then 0.05mM biotin at 10 u L/min flow rate through the chip for 2min, closed streptavidin residual binding sites.
The SLLMWITQC-HLA A0201 complex is prepared as follows:
a. purification of
Collecting 100ml E.coli liquid for inducing expression of heavy chain or light chain, centrifuging at 4 ℃ for 10min at 8000g, washing the thalli once with 10ml PBS, then resuspending the thalli with 5ml BugBuster Master Mix Extraction Reagents (Merck) by vigorous shaking, rotatably incubating at room temperature for 20min, centrifuging at 4 ℃ for 15min at 6000g, discarding supernatant, and collecting inclusion body.
Resuspending the inclusion bodies in 5ml of BugBuster Master Mix, and rotary incubating at room temperature for 5 min; adding 30ml of 10-fold diluted BugBuster, uniformly mixing, and centrifuging at 4 ℃ at 6000g for 15 min; discarding the supernatant, adding 30ml of 10-fold diluted BugBuster to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, repeating twice, adding 30ml of 20mM Tris-HCl pH 8.0 to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, finally dissolving the inclusion bodies by using 20mM Tris-HCl 8M urea, detecting the purity of the inclusion bodies by SDS-PAGE, and detecting the concentration by using a BCA kit.
b. Renaturation
The synthesized short peptide SLLMWITQC (Beijing Saibance Gene technology Co., Ltd.) was dissolved in DMSO to a concentration of 20 mg/ml. Inclusion of light and heavy chains was solubilized with 8M Urea, 20mM Tris pH 8.0, 10mM DTT and further denatured by addition of 3M guanidine hydrochloride, 10mM sodium acetate, 10mM EDTA prior to renaturation. SLLMWITQC peptide was added to renaturation buffer (0.4M L-arginine, 100mM Tris pH 8.3, 2mM EDTA, 0.5mM oxidative glutathione, 5mM reduced glutathione, 0.2mM PMSF, cooled to 4 ℃) at 25mg/L (final concentration), followed by the addition of 20mg/L light chain and 90mg/L heavy chain in sequence (final concentration, heavy chain was added in three portions, 8 h/time), and renaturation was performed at 4 ℃ for at least 3 days until completion, and SDS-PAGE checked for success or failure of the renaturation.
c. Purification after renaturation
The renaturation buffer was replaced by dialysis against 10 volumes of 20mM Tris pH 8.0, at least twice to reduce the ionic strength of the solution sufficiently. After dialysis, the protein solution was filtered through a 0.45 μm cellulose acetate filter and then loaded onto a HiTrap Q HP (GE general electric) anion exchange column (5ml bed volume). The protein was eluted using an Akta purifier (GE general electric) with a 0-400mM NaCl linear gradient prepared in 20mM Tris pH 8.0, pMHC was eluted at about 250mM NaCl, the peak fractions were collected, and the purity was checked by SDS-PAGE.
d. Biotinylation of the compound
The purified pMHC molecules were concentrated using Millipore ultrafiltration tubes while displacing the buffer to 20mM Tris pH 8.0, followed by addition of biotinylation reagent 0.05M Bicine pH 8.3, 10mM ATP, 10mM MgOAc, 50. mu. M D-Biotin, 100. mu.g/ml BirA enzyme (GST-BirA), incubation of the mixture overnight at room temperature, and SDS-PAGE to determine the completion of biotinylation.
e. Purification of biotinylated complexes
The biotinylated pMHC molecules were concentrated to 1ml using Millipore ultrafiltration tubes, the biotinylated pMHC was purified by gel filtration chromatography, and HiPrep was pre-equilibrated with filtered PBS using Akta purifier (GE general electric Co., Ltd.)TM16/60S 200 HR column (GE general electric) was loaded with 1ml of concentrated biotinylated pMHC molecules and then eluted with PBS at a flow rate of 1 ml/min. Biotinylated pMHC molecules appeared as a unimodal elution at approximately 55 ml. The fractions containing the protein were pooled, concentrated using Millipore ultrafiltration tubes, protein concentration was determined by BCA (Thermo), and biotinylated pMHC molecules were stored in aliquots at-80 ℃ by addition of the protease inhibitor cocktail (Roche).
Kinetic parameters are calculated by using BIAcore Evaluation software, and kinetic maps of the soluble TCR molecule and the soluble single-chain TCR molecule combined with the SLLMWITQC-HLA A0201 complex are obtained and are respectively shown in FIG. 12 and FIG. 13. The map shows that the soluble TCR molecule and the soluble single-chain TCR molecule obtained by the invention can be combined with the SLLMWITQC-HLA A0201 complex. Meanwhile, the method is used for detecting the binding activity of the soluble TCR molecule and the short peptides of other unrelated antigens and the HLA complex, and the result shows that the TCR molecule is not bound with other unrelated antigens.
Example 7 killing of cells transduced with a TCR of the invention
This example demonstrates the killing function of cells transduced with the TCR of the invention by measuring LDH release by non-radioactive cytotoxicity assays.
Methods for detecting cell function using LDH release assays are well known to those skilled in the art. The LDH assay of this example uses isolated PBL cells from the blood of healthy volunteers as effector cells to transfect TCRs with lentiviruses. Target cell lines were A375(3525), MEL624(1605), NCI-H1650(2) and MEL526(4) cells. According to nanostring results, among them, A375(3525) and MEL624(1605) expressed NY-ESO-1 antigen. NCI-H1650(2) and MEL526(4) expressed substantially no NY-ESO-1 antigen as a control.
LDH plates were first prepared. On day 1 of the experiment, the components of the experiment were added to the plate in the following order: medium regulates Effector cells to 2X 106Individual cells/ml, media adjusted each target cell line to 5X 105Individual cells/ml. Mixing well, and collecting 100 μ L of target cell line 5X 105One cell/ml (i.e., 50,000 cells/well), 100 μ L effector cells 2X 106One cell/ml (i.e., 200,000 cells/well) was added to the corresponding well and three replicate wells were set. Meanwhile, an effector cell spontaneous hole, a target cell maximum hole, a volume correction control hole and a culture medium background control hole are arranged. Incubation overnight (37 ℃, 5% CO)2). On day 2 of the experiment, color development was detected, and after termination of the reaction, the absorbance was recorded at 490nm using a microplate reader (Bioteck). The results of the experiment are shown in FIG. 14, where cells transduced with a TCR of the invention have a killing effect on target cells expressing the relevant antigen, but have substantially no killing effect on target cells not expressing the relevant antigen.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
-1435 sequence Listing
<110> Guangzhou Xiangxue pharmaceutical products Co., Ltd
<120> TCR for recognizing NY-ESO-1 antigen short peptide
<130> P2016-1815
<150> CN201510751225.5
<151> 2015-11-04
<160> 37
<170> PatentIn version 3.5
<210> 1
<211> 110
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> TCR alpha chain variable Domain
<400> 1
Ser Gln Gln Gly Glu Glu Asp Pro Gln Ala Leu Ser Ile Gln Glu Gly
1 5 10 15
Glu Asn Ala Thr Met Asn Cys Ser Tyr Lys Thr Ser Ile Asn Asn Leu
20 25 30
Gln Trp Tyr Arg Gln Asn Ser Gly Arg Gly Leu Val His Leu Ile Leu
35 40 45
Ile Arg Ser Asn Glu Arg Glu Lys His Ser Gly Arg Leu Arg Val Thr
50 55 60
Leu Asp Thr Ser Lys Lys Ser Ser Ser Leu Leu Ile Thr Ala Ser Arg
65 70 75 80
Ala Ala Asp Thr Ala Ser Tyr Phe Cys Ala Thr Asp Ala Asn Gly Lys
85 90 95
Ile Ile Phe Gly Lys Gly Thr Arg Leu His Ile Leu Pro Asn
100 105 110
<210> 2
<211> 330
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> TCR alpha chain variable Domain
<400> 2
agtcaacagg gagaagagga tcctcaggcc ttgagcatcc aggagggtga aaatgccacc 60
atgaactgca gttacaaaac tagtataaac aatttacagt ggtatagaca aaattcaggt 120
agaggccttg tccacctaat tttaatacgt tcaaatgaaa gagagaaaca cagtggaaga 180
ttaagagtca cgcttgacac ttccaagaaa agcagttcct tgttgatcac ggcttcccgg 240
gcagcagaca ctgcttctta cttctgtgct acggacgcaa acggcaagat catctttgga 300
aaagggacac gacttcatat tctccccaat 330
<210> 3
<211> 250
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> TCR alpha chain
<400> 3
Ser Gln Gln Gly Glu Glu Asp Pro Gln Ala Leu Ser Ile Gln Glu Gly
1 5 10 15
Glu Asn Ala Thr Met Asn Cys Ser Tyr Lys Thr Ser Ile Asn Asn Leu
20 25 30
Gln Trp Tyr Arg Gln Asn Ser Gly Arg Gly Leu Val His Leu Ile Leu
35 40 45
Ile Arg Ser Asn Glu Arg Glu Lys His Ser Gly Arg Leu Arg Val Thr
50 55 60
Leu Asp Thr Ser Lys Lys Ser Ser Ser Leu Leu Ile Thr Ala Ser Arg
65 70 75 80
Ala Ala Asp Thr Ala Ser Tyr Phe Cys Ala Thr Asp Ala Asn Gly Lys
85 90 95
Ile Ile Phe Gly Lys Gly Thr Arg Leu His Ile Leu Pro Asn Ile Gln
100 105 110
Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys Ser Ser Asp
115 120 125
Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr Asn Val Ser
130 135 140
Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr Val Leu Asp
145 150 155 160
Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn
165 170 175
Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro
180 185 190
Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu
195 200 205
Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu
210 215 220
Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn
225 230 235 240
Leu Leu Met Thr Leu Arg Leu Trp Ser Ser
245 250
<210> 4
<211> 750
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> TCR alpha chain
<400> 4
agtcaacagg gagaagagga tcctcaggcc ttgagcatcc aggagggtga aaatgccacc 60
atgaactgca gttacaaaac tagtataaac aatttacagt ggtatagaca aaattcaggt 120
agaggccttg tccacctaat tttaatacgt tcaaatgaaa gagagaaaca cagtggaaga 180
ttaagagtca cgcttgacac ttccaagaaa agcagttcct tgttgatcac ggcttcccgg 240
gcagcagaca ctgcttctta cttctgtgct acggacgcaa acggcaagat catctttgga 300
aaagggacac gacttcatat tctccccaat atccagaacc ctgaccctgc cgtgtaccag 360
ctgagagact ctaaatccag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 420
acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaaac tgtgctagac 480
atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 540
gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 600
gaaagttcct gtgatgtcaa gctggtcgag aaaagctttg aaacagatac gaacctaaac 660
tttcaaaacc tgtcagtgat tgggttccga atcctcctcc tgaaagtggc cgggtttaat 720
ctgctcatga cgctgcggct gtggtccagc 750
<210> 5
<211> 112
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> TCR beta chain variable domain
<400> 5
Asp Ala Gly Val Ile Gln Ser Pro Arg His Glu Val Thr Glu Met Gly
1 5 10 15
Gln Glu Val Thr Leu Arg Cys Lys Pro Ile Ser Gly His Asp Tyr Leu
20 25 30
Phe Trp Tyr Arg Gln Thr Met Met Arg Gly Leu Glu Leu Leu Ile Tyr
35 40 45
Phe Asn Asn Asn Val Pro Ile Asp Asp Ser Gly Met Pro Glu Asp Arg
50 55 60
Phe Ser Ala Lys Met Pro Asn Ala Ser Phe Ser Thr Leu Lys Ile Gln
65 70 75 80
Pro Ser Glu Pro Arg Asp Ser Ala Val Tyr Phe Cys Ala Ser Ser Leu
85 90 95
Gly Ser Asn Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr
100 105 110
<210> 6
<211> 336
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> TCR beta chain variable domain
<400> 6
gatgctggag ttatccagtc accccggcac gaggtgacag agatgggaca agaagtgact 60
ctgagatgta aaccaatttc aggacacgac taccttttct ggtacagaca gaccatgatg 120
cggggactgg agttgctcat ttactttaac aacaacgttc cgatagatga ttcagggatg 180
cccgaggatc gattctcagc taagatgcct aatgcatcat tctccactct gaagatccag 240
ccctcagaac ccagggactc agctgtgtac ttctgtgcca gcagtttagg gagcaacgag 300
cagtacttcg ggccgggcac caggctcacg gtcaca 336
<210> 7
<211> 291
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> TCR beta chain
<400> 7
Asp Ala Gly Val Ile Gln Ser Pro Arg His Glu Val Thr Glu Met Gly
1 5 10 15
Gln Glu Val Thr Leu Arg Cys Lys Pro Ile Ser Gly His Asp Tyr Leu
20 25 30
Phe Trp Tyr Arg Gln Thr Met Met Arg Gly Leu Glu Leu Leu Ile Tyr
35 40 45
Phe Asn Asn Asn Val Pro Ile Asp Asp Ser Gly Met Pro Glu Asp Arg
50 55 60
Phe Ser Ala Lys Met Pro Asn Ala Ser Phe Ser Thr Leu Lys Ile Gln
65 70 75 80
Pro Ser Glu Pro Arg Asp Ser Ala Val Tyr Phe Cys Ala Ser Ser Leu
85 90 95
Gly Ser Asn Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr
100 105 110
Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro
115 120 125
Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu
130 135 140
Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn
145 150 155 160
Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys
165 170 175
Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu
180 185 190
Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys
195 200 205
Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp
210 215 220
Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg
225 230 235 240
Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser
245 250 255
Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala
260 265 270
Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp
275 280 285
Ser Arg Gly
290
<210> 8
<211> 873
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> TCR beta chain
<400> 8
gatgctggag ttatccagtc accccggcac gaggtgacag agatgggaca agaagtgact 60
ctgagatgta aaccaatttc aggacacgac taccttttct ggtacagaca gaccatgatg 120
cggggactgg agttgctcat ttactttaac aacaacgttc cgatagatga ttcagggatg 180
cccgaggatc gattctcagc taagatgcct aatgcatcat tctccactct gaagatccag 240
ccctcagaac ccagggactc agctgtgtac ttctgtgcca gcagtttagg gagcaacgag 300
cagtacttcg ggccgggcac caggctcacg gtcacagagg acctgaaaaa cgtgttccca 360
cccgaggtcg ctgtgtttga gccatcagaa gcagagatct cccacaccca aaaggccaca 420
ctggtgtgcc tggccacagg cttctacccc gaccacgtgg agctgagctg gtgggtgaat 480
gggaaggagg tgcacagtgg ggtcagcaca gacccgcagc ccctcaagga gcagcccgcc 540
ctcaatgact ccagatactg cctgagcagc cgcctgaggg tctcggccac cttctggcag 600
aacccccgca accacttccg ctgtcaagtc cagttctacg ggctctcgga gaatgacgag 660
tggacccagg atagggccaa acctgtcacc cagatcgtca gcgccgaggc ctggggtaga 720
gcagactgtg gcttcacctc cgagtcttac cagcaagggg tcctgtctgc caccatcctc 780
tatgagatct tgctagggaa ggccaccttg tatgccgtgc tggtcagtgc cctcgtgctg 840
atggccatgg tcaagagaaa ggattccaga ggc 873
<210> 9
<211> 9
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> antigen short peptide
<400> 9
Ser Leu Leu Met Trp Ile Thr Gln Cys
1 5
<210> 10
<211> 5
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> α CDR1
<400> 10
Thr Ser Ile Asn Asn
1 5
<210> 11
<211> 7
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> α CDR2
<400> 11
Ile Arg Ser Asn Glu Arg Glu
1 5
<210> 12
<211> 9
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> α CDR3
<400> 12
Ala Thr Asp Ala Asn Gly Lys Ile Ile
1 5
<210> 13
<211> 5
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> β CDR1
<400> 13
Ser Gly His Asp Tyr
1 5
<210> 14
<211> 6
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> β CDR2
<400> 14
Phe Asn Asn Asn Val Pro
1 5
<210> 15
<211> 10
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> β CDR3
<400> 15
Ala Ser Ser Leu Gly Ser Asn Glu Gln Tyr
1 5 10
<210> 16
<211> 15
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> α CDR1
<400> 16
actagtataa acaat 15
<210> 17
<211> 21
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> α CDR2
<400> 17
atacgttcaa atgaaagaga g 21
<210> 18
<211> 27
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> α CDR3
<400> 18
gctacggacg caaacggcaa gatcatc 27
<210> 19
<211> 15
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> β CDR1
<400> 19
tcaggacacg actac 15
<210> 20
<211> 18
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> β CDR2
<400> 20
tttaacaaca acgttccg 18
<210> 21
<211> 30
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> β CDR3
<400> 21
gccagcagtt tagggagcaa cgagcagtac 30
<210> 22
<211> 270
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> TCR alpha chain having leader sequence
<400> 22
Met Glu Thr Leu Leu Gly Val Ser Leu Val Ile Leu Trp Leu Gln Leu
1 5 10 15
Ala Arg Val Asn Ser Gln Gln Gly Glu Glu Asp Pro Gln Ala Leu Ser
20 25 30
Ile Gln Glu Gly Glu Asn Ala Thr Met Asn Cys Ser Tyr Lys Thr Ser
35 40 45
Ile Asn Asn Leu Gln Trp Tyr Arg Gln Asn Ser Gly Arg Gly Leu Val
50 55 60
His Leu Ile Leu Ile Arg Ser Asn Glu Arg Glu Lys His Ser Gly Arg
65 70 75 80
Leu Arg Val Thr Leu Asp Thr Ser Lys Lys Ser Ser Ser Leu Leu Ile
85 90 95
Thr Ala Ser Arg Ala Ala Asp Thr Ala Ser Tyr Phe Cys Ala Thr Asp
100 105 110
Ala Asn Gly Lys Ile Ile Phe Gly Lys Gly Thr Arg Leu His Ile Leu
115 120 125
Pro Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser
130 135 140
Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln
145 150 155 160
Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys
165 170 175
Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val
180 185 190
Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn
195 200 205
Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys
210 215 220
Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn
225 230 235 240
Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val
245 250 255
Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser
260 265 270
<210> 23
<211> 810
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> TCR alpha chain having leader sequence
<400> 23
atggaaactc tcctgggagt gtctttggtg attctatggc ttcaactggc tagggtgaac 60
agtcaacagg gagaagagga tcctcaggcc ttgagcatcc aggagggtga aaatgccacc 120
atgaactgca gttacaaaac tagtataaac aatttacagt ggtatagaca aaattcaggt 180
agaggccttg tccacctaat tttaatacgt tcaaatgaaa gagagaaaca cagtggaaga 240
ttaagagtca cgcttgacac ttccaagaaa agcagttcct tgttgatcac ggcttcccgg 300
gcagcagaca ctgcttctta cttctgtgct acggacgcaa acggcaagat catctttgga 360
aaagggacac gacttcatat tctccccaat atccagaacc ctgaccctgc cgtgtaccag 420
ctgagagact ctaaatccag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 480
acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaaac tgtgctagac 540
atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 600
gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 660
gaaagttcct gtgatgtcaa gctggtcgag aaaagctttg aaacagatac gaacctaaac 720
tttcaaaacc tgtcagtgat tgggttccga atcctcctcc tgaaagtggc cgggtttaat 780
ctgctcatga cgctgcggct gtggtccagc 810
<210> 24
<211> 310
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> TCR beta chain having leader sequence
<400> 24
Met Asp Ser Trp Thr Leu Cys Cys Val Ser Leu Cys Ile Leu Val Ala
1 5 10 15
Lys His Thr Asp Ala Gly Val Ile Gln Ser Pro Arg His Glu Val Thr
20 25 30
Glu Met Gly Gln Glu Val Thr Leu Arg Cys Lys Pro Ile Ser Gly His
35 40 45
Asp Tyr Leu Phe Trp Tyr Arg Gln Thr Met Met Arg Gly Leu Glu Leu
50 55 60
Leu Ile Tyr Phe Asn Asn Asn Val Pro Ile Asp Asp Ser Gly Met Pro
65 70 75 80
Glu Asp Arg Phe Ser Ala Lys Met Pro Asn Ala Ser Phe Ser Thr Leu
85 90 95
Lys Ile Gln Pro Ser Glu Pro Arg Asp Ser Ala Val Tyr Phe Cys Ala
100 105 110
Ser Ser Leu Gly Ser Asn Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu
115 120 125
Thr Val Thr Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val
130 135 140
Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu
145 150 155 160
Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp
165 170 175
Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln
180 185 190
Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser
195 200 205
Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His
210 215 220
Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp
225 230 235 240
Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala
245 250 255
Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly
260 265 270
Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr
275 280 285
Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys
290 295 300
Arg Lys Asp Ser Arg Gly
305 310
<210> 25
<211> 930
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> TCR beta chain having leader sequence
<400> 25
atggactcct ggaccctctg ctgtgtgtcc ctttgcatcc tggtagcaaa gcacacagat 60
gctggagtta tccagtcacc ccggcacgag gtgacagaga tgggacaaga agtgactctg 120
agatgtaaac caatttcagg acacgactac cttttctggt acagacagac catgatgcgg 180
ggactggagt tgctcattta ctttaacaac aacgttccga tagatgattc agggatgccc 240
gaggatcgat tctcagctaa gatgcctaat gcatcattct ccactctgaa gatccagccc 300
tcagaaccca gggactcagc tgtgtacttc tgtgccagca gtttagggag caacgagcag 360
tacttcgggc cgggcaccag gctcacggtc acagaggacc tgaaaaacgt gttcccaccc 420
gaggtcgctg tgtttgagcc atcagaagca gagatctccc acacccaaaa ggccacactg 480
gtgtgcctgg ccacaggctt ctaccccgac cacgtggagc tgagctggtg ggtgaatggg 540
aaggaggtgc acagtggggt cagcacagac ccgcagcccc tcaaggagca gcccgccctc 600
aatgactcca gatactgcct gagcagccgc ctgagggtct cggccacctt ctggcagaac 660
ccccgcaacc acttccgctg tcaagtccag ttctacgggc tctcggagaa tgacgagtgg 720
acccaggata gggccaaacc tgtcacccag atcgtcagcg ccgaggcctg gggtagagca 780
gactgtggct tcacctccga gtcttaccag caaggggtcc tgtctgccac catcctctat 840
gagatcttgc tagggaaggc caccttgtat gccgtgctgg tcagtgccct cgtgctgatg 900
gccatggtca agagaaagga ttccagaggc 930
<210> 26
<211> 203
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> soluble TCR alpha chain
<400> 26
Ser Gln Gln Gly Glu Glu Asp Pro Gln Ala Leu Ser Ile Gln Glu Gly
1 5 10 15
Glu Asn Ala Thr Met Asn Cys Ser Tyr Lys Thr Ser Ile Asn Asn Leu
20 25 30
Gln Trp Tyr Arg Gln Asn Ser Gly Arg Gly Leu Val His Leu Ile Leu
35 40 45
Ile Arg Ser Asn Glu Arg Glu Lys His Ser Gly Arg Leu Arg Val Thr
50 55 60
Leu Asp Thr Ser Lys Lys Ser Ser Ser Leu Leu Ile Thr Ala Ser Arg
65 70 75 80
Ala Ala Asp Thr Ala Ser Tyr Phe Cys Ala Thr Asp Ala Asn Gly Lys
85 90 95
Ile Ile Phe Gly Lys Gly Thr Arg Leu His Ile Leu Pro Asn Ile Gln
100 105 110
Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys Ser Ser Asp
115 120 125
Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr Asn Val Ser
130 135 140
Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Cys Val Leu Asp
145 150 155 160
Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn
165 170 175
Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro
180 185 190
Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser
195 200
<210> 27
<211> 609
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> soluble TCR alpha chain
<400> 27
agccagcagg gcgaagaaga tcctcaggcc ttgagcatcc aggagggtga aaatgccacc 60
atgaactgca gttacaaaac tagtataaac aatttacagt ggtatagaca aaattcaggt 120
agaggccttg tccacctaat tttaatacgt tcaaatgaaa gagagaaaca cagtggaaga 180
ttaagagtca cgcttgacac ttccaagaaa agcagttcct tgttgatcac ggcttcccgg 240
gcagcagaca ctgcttctta cttctgtgct acggacgcaa acggcaagat catctttgga 300
aaagggacac gacttcatat tctccccaat atccagaacc ctgaccctgc cgtgtaccag 360
ctgagagact ctaagtcgag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 420
acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaatg tgtgctagac 480
atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 540
gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 600
gaaagttcc 609
<210> 28
<211> 242
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> soluble TCR beta chain
<400> 28
Asp Ala Gly Val Ile Gln Ser Pro Arg His Glu Val Thr Glu Met Gly
1 5 10 15
Gln Glu Val Thr Leu Arg Cys Lys Pro Ile Ser Gly His Asp Tyr Leu
20 25 30
Phe Trp Tyr Arg Gln Thr Met Met Arg Gly Leu Glu Leu Leu Ile Tyr
35 40 45
Phe Asn Asn Asn Val Pro Ile Asp Asp Ser Gly Met Pro Glu Asp Arg
50 55 60
Phe Ser Ala Lys Met Pro Asn Ala Ser Phe Ser Thr Leu Lys Ile Gln
65 70 75 80
Pro Ser Glu Pro Arg Asp Ser Ala Val Tyr Phe Cys Ala Ser Ser Leu
85 90 95
Gly Ser Asn Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr
100 105 110
Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro
115 120 125
Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu
130 135 140
Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn
145 150 155 160
Gly Lys Glu Val His Ser Gly Val Cys Thr Asp Pro Gln Pro Leu Lys
165 170 175
Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Ala Leu Ser Ser Arg Leu
180 185 190
Arg Val Ser Ala Thr Phe Trp Gln Asp Pro Arg Asn His Phe Arg Cys
195 200 205
Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp
210 215 220
Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg
225 230 235 240
Ala Asp
<210> 29
<211> 726
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> soluble TCR beta chain
<400> 29
gatgcgggcg tgattcagtc accccggcac gaggtgacag agatgggaca agaagtgact 60
ctgagatgta aaccaatttc aggacacgac taccttttct ggtacagaca gaccatgatg 120
cggggactgg agttgctcat ttactttaac aacaacgttc cgatagatga ttcagggatg 180
cccgaggatc gattctcagc taagatgcct aatgcatcat tctccactct gaagatccag 240
ccctcagaac ccagggactc agctgtgtac ttctgtgcca gcagtttagg gagcaacgag 300
cagtacttcg ggccgggcac caggctcacg gtcacagagg acctgaaaaa cgtgttccca 360
cccgaggtcg ctgtgtttga gccatcagaa gcagagatct cccacaccca aaaggccaca 420
ctggtgtgcc tggccaccgg tttctacccc gaccacgtgg agctgagctg gtgggtgaat 480
gggaaggagg tgcacagtgg ggtctgcaca gacccgcagc ccctcaagga gcagcccgcc 540
ctcaatgact ccagatacgc tctgagcagc cgcctgaggg tctcggccac cttctggcag 600
gacccccgca accacttccg ctgtcaagtc cagttctacg ggctctcgga gaatgacgag 660
tggacccagg atagggccaa acccgtcacc cagatcgtca gcgccgaggc ctggggtaga 720
gcagac 726
<210> 30
<211> 245
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> Single-chain TCR
<400> 30
Ser Gln Gln Gly Glu Glu Asp Pro Gln Ala Leu Ser Ile Gln Glu Gly
1 5 10 15
Glu Asn Val Thr Ile Asn Cys Ser Tyr Lys Thr Ser Ile Asn Asn Leu
20 25 30
Gln Trp Tyr Arg Gln Asn Ser Gly Arg Gly Leu Val His Leu Ile Leu
35 40 45
Ile Arg Ser Asn Glu Arg Glu Lys His Ser Gly Arg Leu Arg Val Thr
50 55 60
Leu Asp Thr Ser Lys Lys Ser Ser Ser Leu Glu Ile Thr Ala Val Arg
65 70 75 80
Pro Ala Asp Thr Ala Ser Tyr Phe Cys Ala Thr Asp Ala Asn Gly Lys
85 90 95
Ile Ile Phe Gly Lys Gly Thr Arg Leu His Ile Leu Pro Gly Gly Gly
100 105 110
Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser
115 120 125
Glu Gly Gly Thr Gly Asp Ala Gly Val Thr Gln Ser Pro Arg His Glu
130 135 140
Ser Val Glu Met Gly Gln Glu Val Thr Leu Arg Cys Lys Pro Ile Ser
145 150 155 160
Gly His Asp Tyr Leu Phe Trp Tyr Arg Gln Thr Pro Lys Arg Gly Leu
165 170 175
Glu Leu Leu Ile Tyr Phe Asn Asn Asn Val Pro Ile Asp Asp Ser Gly
180 185 190
Met Pro Glu Asp Arg Phe Ser Ala Lys Met Pro Asn Ala Ser Phe Ser
195 200 205
Thr Leu Lys Ile Gln Pro Val Glu Pro Arg Asp Ser Ala Val Tyr Phe
210 215 220
Cys Ala Ser Ser Leu Gly Ser Asn Glu Gln Tyr Phe Gly Pro Gly Thr
225 230 235 240
Arg Leu Thr Val Thr
245
<210> 31
<211> 735
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> Single-chain TCR
<400> 31
tctcaacaag gtgaagaaga tccgcaggcc ctgagtattc aagaaggtga aaatgtgacc 60
atcaactgct cttacaaaac gagtatcaac aatctgcagt ggtaccgtca aaattctggc 120
cgcggtctgg ttcatctgat tctgatccgt tccaacgaac gcgaaaaaca ctcaggccgt 180
ctgcgcgtta ccctggatac cagcaaaaaa tcttctagtc tggaaatcac cgcagtccgt 240
ccggcagata cggcaagcta tttttgtgca accgacgcta atggtaaaat tatcttcggc 300
aaaggtaccc gcctgcatat tctgccgggc ggtggctccg aaggtggcgg ttcagaaggc 360
ggtggctcgg aaggtggcgg tagcgaaggc ggtaccggtg atgcgggtgt cacgcagtct 420
ccgcgtcatg aaagtgtgga aatgggccaa gaagttacgc tgcgctgcaa accgatcagc 480
ggtcacgact acctgttttg gtaccgtcag accccgaaac gcggcctgga actgctgatc 540
tacttcaaca ataacgttcc gattgatgac tcgggtatgc cggaagatcg ttttagcgcg 600
aaaatgccga atgcctcgtt cagcacgctg aaaattcagc cggtcgaacc gcgtgactcc 660
gcagtgtatt tttgtgcttc ctcactgggc agtaacgaac agtacttcgg cccgggtacc 720
cgtctgaccg tgacg 735
<210> 32
<211> 109
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> Single-chain TCR alpha chain
<400> 32
Ser Gln Gln Gly Glu Glu Asp Pro Gln Ala Leu Ser Ile Gln Glu Gly
1 5 10 15
Glu Asn Val Thr Ile Asn Cys Ser Tyr Lys Thr Ser Ile Asn Asn Leu
20 25 30
Gln Trp Tyr Arg Gln Asn Ser Gly Arg Gly Leu Val His Leu Ile Leu
35 40 45
Ile Arg Ser Asn Glu Arg Glu Lys His Ser Gly Arg Leu Arg Val Thr
50 55 60
Leu Asp Thr Ser Lys Lys Ser Ser Ser Leu Glu Ile Thr Ala Val Arg
65 70 75 80
Pro Ala Asp Thr Ala Ser Tyr Phe Cys Ala Thr Asp Ala Asn Gly Lys
85 90 95
Ile Ile Phe Gly Lys Gly Thr Arg Leu His Ile Leu Pro
100 105
<210> 33
<211> 327
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> Single-chain TCR alpha chain
<400> 33
tctcaacaag gtgaagaaga tccgcaggcc ctgagtattc aagaaggtga aaatgtgacc 60
atcaactgct cttacaaaac gagtatcaac aatctgcagt ggtaccgtca aaattctggc 120
cgcggtctgg ttcatctgat tctgatccgt tccaacgaac gcgaaaaaca ctcaggccgt 180
ctgcgcgtta ccctggatac cagcaaaaaa tcttctagtc tggaaatcac cgcagtccgt 240
ccggcagata cggcaagcta tttttgtgca accgacgcta atggtaaaat tatcttcggc 300
aaaggtaccc gcctgcatat tctgccg 327
<210> 34
<211> 112
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> Single chain TCR beta chain
<400> 34
Asp Ala Gly Val Thr Gln Ser Pro Arg His Glu Ser Val Glu Met Gly
1 5 10 15
Gln Glu Val Thr Leu Arg Cys Lys Pro Ile Ser Gly His Asp Tyr Leu
20 25 30
Phe Trp Tyr Arg Gln Thr Pro Lys Arg Gly Leu Glu Leu Leu Ile Tyr
35 40 45
Phe Asn Asn Asn Val Pro Ile Asp Asp Ser Gly Met Pro Glu Asp Arg
50 55 60
Phe Ser Ala Lys Met Pro Asn Ala Ser Phe Ser Thr Leu Lys Ile Gln
65 70 75 80
Pro Val Glu Pro Arg Asp Ser Ala Val Tyr Phe Cys Ala Ser Ser Leu
85 90 95
Gly Ser Asn Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr
100 105 110
<210> 35
<211> 336
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> Single chain TCR beta chain
<400> 35
gatgcgggtg tcacgcagtc tccgcgtcat gaaagtgtgg aaatgggcca agaagttacg 60
ctgcgctgca aaccgatcag cggtcacgac tacctgtttt ggtaccgtca gaccccgaaa 120
cgcggcctgg aactgctgat ctacttcaac aataacgttc cgattgatga ctcgggtatg 180
ccggaagatc gttttagcgc gaaaatgccg aatgcctcgt tcagcacgct gaaaattcag 240
ccggtcgaac cgcgtgactc cgcagtgtat ttttgtgctt cctcactggg cagtaacgaa 300
cagtacttcg gcccgggtac ccgtctgacc gtgacg 336
<210> 36
<211> 24
<212> PRT
<213> Artificial sequence (artificial)
<220>
<223> Single-chain TCR linker sequence
<400> 36
Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly
1 5 10 15
Gly Gly Ser Glu Gly Gly Thr Gly
20
<210> 37
<211> 72
<212> DNA
<213> Artificial sequence (artificial)
<220>
<223> Single-chain TCR linker sequence
<400> 37
ggcggtggct ccgaaggtgg cggttcagaa ggcggtggct cggaaggtgg cggtagcgaa 60
ggcggtaccg gt 72

Claims (36)

1. A T Cell Receptor (TCR), wherein the TCR is capable of binding to the SLLMWITQC-HLA a0201 complex;
and, the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:
αCDR1-TSINN(SEQ ID NO:10)
αCDR2-IRSNERE(SEQ ID NO:11)
alpha CDR3-ATDANGKII (SEQ ID NO: 12); and
the 3 complementarity determining regions of the TCR β chain variable domain are:
βCDR1-SGHDY(SEQ ID NO:13)
βCDR2-FNNNVP(SEQ ID NO:14)
βCDR3-ASSLGSNEQY(SEQ ID NO:15)。
2. a TCR as claimed in claim 1 which comprises a TCR α chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1 and a TCR β chain variable domain; and/or the TCR β chain variable domain is identical to SEQ ID NO:5 an amino acid sequence having at least 90% sequence identity.
3. A TCR as claimed in claim 1 which comprises the α chain variable domain amino acid sequence SEQ ID NO 1.
4. A TCR as claimed in claim 1 which comprises the β chain variable domain amino acid sequence SEQ ID NO 5.
5. A TCR as claimed in claim 1 which is an α β heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.
6. A TCR as claimed in claim 5 wherein the α chain amino acid sequence of the TCR is SEQ ID NO:3 and/or the beta chain amino acid sequence of the TCR is SEQ ID NO 7.
7. A TCR as claimed in any one of claims 1 to 4 which is soluble.
8. A TCR as claimed in claim 7 which is single chain.
9. A TCR as claimed in claim 8 which is formed by the α chain variable domain linked to the β chain variable domain by a peptide linker sequence.
10. A TCR as claimed in claim 9 which has one or more mutations in the alpha chain variable region amino acid 11, 13, 19, 21, 53, 76, 89, 91 or 94 and/or the alpha chain J gene short peptide amino acid penultimate 3, penultimate 5 or penultimate 7 position; and/or the TCR has one or more mutations in beta chain variable region amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 th, and/or beta chain J gene short peptide amino acid penultimate 2,4 or 6 th, wherein the amino acid position numbering is according to the position numbering listed in IMGT (international immunogenetic information system).
11. A TCR as claimed in claim 10 wherein the amino acid sequence of the α chain variable domain of the TCR is as set out in SEQ ID No. 32 and/or the amino acid sequence of the β chain variable domain of the TCR is as set out in SEQ ID No. 34.
12. A TCR as claimed in claim 11 which has the amino acid sequence SEQ ID No. 30.
13. A TCR as claimed in claim 7 which comprises (a) all or part of the TCR α chain, excluding the transmembrane domain; and (b) all or part of a TCR β chain, excluding the transmembrane domain;
and (a) and (b) each comprise a functional variable domain.
14. A TCR as claimed in claim 13 wherein (a) and (b) each further comprise at least a portion of the constant domain of the TCR chain.
15. A TCR as claimed in claim 14 in which the cysteine residues form an artificial disulphide bond between the α and β chain constant domains of the TCR.
16. A TCR as claimed in claim 15 wherein the cysteine residues which form the artificial disulphide bond in the TCR are substituted at one or more groups selected from:
thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;
thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;
tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01;
thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;
ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;
arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;
pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and
tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.
17. A TCR as claimed in claim 16 wherein the α chain amino acid sequence of the TCR is SEQ ID No. 26 and/or the β chain amino acid sequence of the TCR is SEQ ID No. 28.
18. A TCR as claimed in claim 14 which comprises an artificial interchain disulphide bond between the α chain variable region and the β chain constant region of the TCR.
19. A TCR as claimed in claim 18 wherein the cysteine residues which form the artificial interchain disulphide bond in the TCR are substituted at one or more groups selected from:
amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01;
amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01;
amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC2 x 01 exon 1; or
Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01.
20. A TCR as claimed in claim 18 or claim 19 which comprises the α chain variable domain and the β chain variable domain and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the α chain constant domain, the α chain variable domain of the TCR forming a heterodimer with the β chain.
21. A TCR as claimed in claim 1 wherein a conjugate is attached to the C-or N-terminus of the α and/or β chains of the TCR.
22. A TCR as claimed in claim 21 wherein the conjugate to which the TCR is bound is a detectable label, a therapeutic agent, a PK modifying moiety or a combination thereof.
23. A TCR as claimed in claim 22 wherein the therapeutic agent is an anti-CD 3 antibody.
24. A multivalent TCR complex comprising at least two TCR molecules, and wherein at least one TCR molecule is a TCR as claimed in any one of claims 1 to 23.
25. A nucleic acid molecule comprising a nucleic acid sequence encoding a TCR according to any one of claims 1 to 23, or the complement thereof.
26. The nucleic acid molecule of claim 25, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO: 33.
27. The nucleic acid molecule of claim 25 or 26, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:6 or SEQ ID NO 35.
28. The nucleic acid molecule of claim 25, comprising the nucleotide sequence encoding a TCR α chain of SEQ ID NO:4 and/or comprises the nucleotide sequence encoding the TCR β chain SEQ ID NO: 8.
29. a vector comprising the nucleic acid molecule of any one of claims 25-28.
30. The vector of claim 29, wherein said vector is a viral vector.
31. The vector of claim 30, wherein said vector is a lentiviral vector.
32. An isolated host cell comprising the vector of any one of claims 29-31 or having integrated into its chromosome an exogenous nucleic acid molecule of any one of claims 25-28.
33. A cell transduced with the nucleic acid molecule of any one of claims 25 to 28 or the vector of any one of claims 29 to 31.
34. The cell of claim 33, wherein the cell is a T cell or a stem cell.
35. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to any one of claims 1 to 23, a TCR complex according to claim 24 or a cell according to claim 33 or 34.
36. Use of a TCR as claimed in any one of claims 1 to 23, or a TCR complex as claimed in claim 24 or a cell as claimed in claim 33 or 34, in the manufacture of a medicament for the treatment of a tumour.
CN201610958444.5A 2015-11-04 2016-11-03 TCR for recognizing NY-ESO-1 antigen short peptide Active CN106632660B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201510751225 2015-11-04
CN2015107512255 2015-11-04

Publications (2)

Publication Number Publication Date
CN106632660A CN106632660A (en) 2017-05-10
CN106632660B true CN106632660B (en) 2021-01-29

Family

ID=58661724

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610958444.5A Active CN106632660B (en) 2015-11-04 2016-11-03 TCR for recognizing NY-ESO-1 antigen short peptide

Country Status (2)

Country Link
CN (1) CN106632660B (en)
WO (1) WO2017076308A1 (en)

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108117596B (en) * 2016-11-29 2023-08-29 香雪生命科学技术（广东）有限公司 High affinity TCR against NY-ESO
CN108948184B (en) * 2017-05-22 2021-04-23 香雪生命科学技术（广东）有限公司 T cell receptor for recognizing PRAME antigen-derived short peptide
CN109251244B (en) * 2017-07-13 2021-10-26 中国科学院广州生物医药与健康研究院 TCR (T cell receptor) for recognizing LMP1 antigen derived from EBV (Epstein-Barr Virus) membrane protein
CA3072569A1 (en) * 2017-08-11 2019-02-14 Tribiotica Llc Methods for generating epitopes for binding to recognition molecules by templated assembly
MX2020004185A (en) * 2017-09-27 2021-01-08 Univ Southern California Novel platforms for co-stimulation, novel car designs and other enhancements for adoptive cellular therapy.
CN109836489A (en) * 2017-11-25 2019-06-04 深圳宾德生物技术有限公司 It is a kind of to target the T cell receptor of NY-ESO-1, T cell receptor gene modification T cell and its preparation method and application
EP4424710A2 (en) * 2018-02-26 2024-09-04 Medigene Immunotherapies GmbH Nyeso tcr
US20220152104A1 (en) * 2019-03-04 2022-05-19 University Health Network T cell receptors and methods of use thereof
CA3142513A1 (en) 2019-06-25 2020-12-30 Gilead Sciences, Inc. Flt3l-fc fusion proteins and methods of use
CN112300268B (en) * 2019-08-02 2023-02-28 香雪生命科学技术（广东）有限公司 High affinity T cell receptors recognizing the NY-ESO-1 antigen
CN112442118B (en) * 2019-08-30 2023-02-14 深圳普瑞金生物药业股份有限公司 TCR and application thereof
CN117964757A (en) 2020-02-14 2024-05-03 吉利德科学公司 Antibodies and fusion proteins that bind CCR8 and uses thereof
CN113880953A (en) * 2020-07-01 2022-01-04 华夏英泰（北京）生物技术有限公司 T cell antigen receptor, polymer compound thereof, preparation method and application thereof
TW202406932A (en) 2020-10-22 2024-02-16 美商基利科學股份有限公司 Interleukin-2-fc fusion proteins and methods of use
AU2021426928A1 (en) 2021-02-09 2023-09-21 Liyang Tcr Biotherapeutics Co.Ltd Tcr and application thereof
TW202313094A (en) 2021-05-18 2023-04-01 美商基利科學股份有限公司 Methods of using flt3l-fc fusion proteins
WO2023122615A1 (en) 2021-12-22 2023-06-29 Gilead Sciences, Inc. Ikaros zinc finger family degraders and uses thereof
WO2023122581A2 (en) 2021-12-22 2023-06-29 Gilead Sciences, Inc. Ikaros zinc finger family degraders and uses thereof
IL315083A (en) 2022-03-17 2024-10-01 Gilead Sciences Inc Ikaros zinc finger family degraders and uses thereof
AU2023256670A1 (en) 2022-04-21 2024-10-17 Gilead Sciences, Inc. Kras g12d modulating compounds
US20240116928A1 (en) 2022-07-01 2024-04-11 Gilead Sciences, Inc. Cd73 compounds
US20240254118A1 (en) 2022-12-22 2024-08-01 Gilead Sciences, Inc. Prmt5 inhibitors and uses thereof

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1989153A (en) * 2004-05-19 2007-06-27 阿维德克斯有限公司 High affinity ny-eso t cell receptor
WO2008037943A1 (en) * 2006-09-29 2008-04-03 Medigene Limited Cells transformed with nucleic acid encoding ny-eso t cell receptors
EP2016102A2 (en) * 2006-05-03 2009-01-21 Government of the United States of America, Represented by the Secretary, Department of Health and Human Services Chimeric t cell receptors and related materials and methods of use
CN101381402A (en) * 2008-10-20 2009-03-11 中国人民解放军第三军医大学 NY-ESO-1 tumour antigen mimic epitope and use thereof
CN101389652A (en) * 2005-05-25 2009-03-18 麦迪金有限公司 T cell receptors which specifically bind to VYGFVRACL-HLA-A24
CN104507963A (en) * 2012-05-22 2015-04-08 美国卫生和人力服务部 Murine anti-NY-ESO-1 T cell receptors
CN104829733A (en) * 2015-05-25 2015-08-12 广州科锐特生物科技有限公司 Chimeric antigen receptor with stable antigen binding units, method for preparing chimeric antigen receptor and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006031221A1 (en) * 2004-09-13 2006-03-23 Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Compositions comprising t cell receptors and methods of use thereof
EP2408819A2 (en) * 2009-03-20 2012-01-25 Ludwig Institute for Cancer Research Ltd High affinity t-cell receptor-like ny-eso-1 peptide antibodies, methods, and uses thereof
JP6464140B2 (en) * 2013-03-13 2019-02-06 ヘルス リサーチ インコーポレイテッドＨｅａｌｔｈ Ｒｅｓｅａｒｃｈ， Ｉｎｃ． Compositions and methods for using recombinant T cell receptors to directly recognize tumor antigens

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1989153A (en) * 2004-05-19 2007-06-27 阿维德克斯有限公司 High affinity ny-eso t cell receptor
CN101389652A (en) * 2005-05-25 2009-03-18 麦迪金有限公司 T cell receptors which specifically bind to VYGFVRACL-HLA-A24
EP2016102A2 (en) * 2006-05-03 2009-01-21 Government of the United States of America, Represented by the Secretary, Department of Health and Human Services Chimeric t cell receptors and related materials and methods of use
WO2008037943A1 (en) * 2006-09-29 2008-04-03 Medigene Limited Cells transformed with nucleic acid encoding ny-eso t cell receptors
CN101381402A (en) * 2008-10-20 2009-03-11 中国人民解放军第三军医大学 NY-ESO-1 tumour antigen mimic epitope and use thereof
CN104507963A (en) * 2012-05-22 2015-04-08 美国卫生和人力服务部 Murine anti-NY-ESO-1 T cell receptors
CN104829733A (en) * 2015-05-25 2015-08-12 广州科锐特生物科技有限公司 Chimeric antigen receptor with stable antigen binding units, method for preparing chimeric antigen receptor and application thereof

Also Published As

Publication number Publication date
WO2017076308A1 (en) 2017-05-11
CN106632660A (en) 2017-05-10

Similar Documents

Publication Publication Date Title
CN106632660B (en) TCR for recognizing NY-ESO-1 antigen short peptide
CN110950949B (en) T cell receptor for recognizing SSX2 antigen
CN107197625B (en) T cell receptor for recognizing NY-ESO-1 antigen short peptide
CN112646024B (en) T cell receptor for identifying KRAS mutation and coding sequence thereof
CN106749620B (en) T cell receptor for recognizing MAGE-A1 antigen short peptide
CN106831978B (en) T cell receptor recognizing PRAME antigen
CN110343166B (en) T cell receptor recognizing AFP antigen short peptides
CN110343167B (en) T cell receptor recognizing SSX2 antigen short peptide
CN110776562B (en) T cell receptor for identifying AFP antigen
CN109575121B (en) T cell receptor recognizing AFP antigen short peptides
CN110577591B (en) T cell receptor for identifying AFP antigen short peptide and its coding sequence
CN106632658B (en) TCR for recognizing NY-ESO-1 antigen short peptide
CN113321726A (en) T cell receptor for identifying HPV
JP2022549994A (en) T-cell receptor that recognizes short peptides of the SSX2 antigen
CN108264550B (en) TCR (T cell receptor) for recognizing PRAME (platelet-derived antigen) antigen short peptide
CN113321727A (en) T cell receptor for identifying AFP antigen short peptide and its coding sequence
CN113321725A (en) T cell receptor for identifying AFP
CN108948184B (en) T cell receptor for recognizing PRAME antigen-derived short peptide
CN109400697B (en) TCR (T cell receptor) for identifying PRAME (platelet-activating antigen) short peptide and related composition thereof
CN110627894B (en) T cell receptor for recognizing NY-ESO-1 antigen short peptide and coding sequence thereof
CN110407927B (en) TCR (T cell receptor) capable of recognizing AFP (alpha fetoprotein) antigen
CN109400696B (en) TCR for identifying PRAME antigen short peptide
CN110577590B (en) TCR capable of recognizing AFP antigen and encoding nucleic acid thereof
CN108929378B (en) T cell receptor for recognizing PRAME antigen and nucleic acid for encoding receptor
CN109575120B (en) TCR for identifying PRAME antigen short peptide and coding sequence thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20171026

Address after: 510663, No. 2, Jinfeng Road, Science Town, Guangzhou hi tech Industrial Development Zone, Guangdong province (first)

Applicant after: Guangdong Xiangxue precision medical technology Co Ltd

Address before: 510663 Guangdong city of Guangzhou province Luogang District Science City Jinfeng Road No. 2

Applicant before: Guangzhou Xiangxue Pharmaceutical Co., ltd.

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20210408

Address after: 519031 2715 office building, no.3000 Huandao East Road, Hengqin New District, Zhuhai City, Guangdong Province

Patentee after: Xiangxue Life Science Technology (Guangdong) Co.,Ltd.

Address before: 510663 No.2, jinfengyuan Road, Science City, Guangzhou hi tech Industrial Development Zone, Guangdong Province

Patentee before: GUANGZHOU XIANGXUE PHARMACEUTICAL Co.,Ltd.

TR01 Transfer of patent right