CN106632658B - TCR for recognizing NY-ESO-1 antigen short peptide - Google Patents

Abstract

The present invention provides a T cell receptor (TCR) capable of specifically binding to the short peptide SLLMWITQC derived from the NY-ESO-1 antigen, which can form a complex with HLA A0201 and be presented to cells together surface. The present invention also provides a nucleic acid molecule encoding the TCR and a vector comprising the nucleic acid molecule. In addition, the present invention also provides cells transduced with the TCR of the present invention.

Description

TCR Recognizing NY-ESO-1 Antigen Peptide

technical field

The present invention relates to TCRs capable of recognizing short peptides derived from NY-ESO-1 antigens, the present invention also relates to NY-ESO-1-specific T cells obtained by transducing the above-mentioned TCRs, and their use in the prevention and treatment of NY-ESO-1 1 Use in related diseases.

Background technique

NY-ESO-1 belongs to the cancer-testis antigen (Cancer-Testis Antigen, CTA) family, which can be expressed in testis, ovarian tissue and many different types of tumor tissues, but not in other normal tissues. Strong tumor antigens. NY-ESO-1 is an endogenous antigen, which is degraded into small molecule polypeptides after being generated in cells, and combined with MHC (major histocompatibility complex) molecules to form complexes, which are presented to the cell surface. SLLMWITQC is a short peptide derived from the NY-ESO-1 antigen and is a target for the treatment of NY-ESO-1-related diseases. Studies have shown that NY-ESO-1 is expressed in a variety of tumor tissues, in neuroblastoma (Rodolfo M, et al., Cancer Res, 2003, 63(20):6948-6955), sarcoma (Jungbhth A et al., Int J Cancer, 2001, 94(2):252-256), malignant melanoma (Barrow C, et al., Clin Cancer Res, 2006, 12(3Pt 1):764-771) very High expression, at the same time in prostate cancer, bladder cancer, breast cancer, multiple myeloma, hepatocellular carcinoma, oral squamous cell carcinoma (Ries J, et al., Anticancer RES, 2009, 29(12): 5125-5130), And esophageal cancer (Fujita S, Clin Cancer Res, 2004, 10 (19): 6551-6558) also has a higher expression. For the treatment of the above diseases, chemotherapy and radiation therapy can be used, but they will cause damage to their own normal cells.

T cell adoptive immunotherapy is the transfer of T cells specific for target cell antigens into the patient's body, so that they can play a role against the target cells. T cell receptor (TCR) is a membrane protein on the surface of T cells that can recognize short antigenic peptides on the surface of the corresponding target cells. In the immune system, direct physical contact between T cells and antigen presenting cells (APCs) is triggered by the binding of antigen peptide-specific TCRs to the peptide-major histocompatibility complex (pMHC complex), and then T cells and The other cell membrane surface molecules of the two APCs interact, causing a series of subsequent cell signaling and other physiological responses, so that T cells with different antigen specificities can exert immune effects on their target cells. Therefore, those skilled in the art are devoted to isolating TCRs specific for NY-ESO-1 antigenic short peptides, and transducing the TCRs into T cells to obtain T cells specific for NY-ESO-1 antigenic short peptides , thus making them useful in cellular immunotherapy.

SUMMARY OF THE INVENTION

The object of the present invention is to provide a T cell receptor that recognizes the NY-ESO-1 antigenic short peptide.

The first aspect of the present invention provides a T cell receptor (TCR), the TCR can bind to the SLLMWITQC-HLAA0201 complex.

In another preferred embodiment, the TCR comprises a TCRα chain variable domain and a TCRβ chain variable domain, and the amino acid sequence of CDR3 of the TCRα chain variable domain is AGFMDSNYQLI (SEQ ID NO: 12); and/or the The amino acid sequence of CDR3 of the variable domain of the TCR beta chain is ASSLGGSVLH (SEQ ID NO: 15).

In another preferred embodiment, the three complementarity determining regions (CDRs) of the variable domain of the TCRα chain are:

αCDR1-SIFNT (SEQ ID NO: 10)

αCDR2-LYKAGEL (SEQ ID NO: 11)

αCDR3-AGFMDSNYQLI (SEQ ID NO: 12); and/or

The three complementarity determining regions of the TCRβ chain variable domain are:

βCDR1-SGHVS (SEQ ID NO: 13)

βCDR2-FQNEAQ (SEQ ID NO: 14)

βCDR3-ASSLGGSVLH (SEQ ID NO: 15).

In another preferred embodiment, the TCR comprises a TCRα chain variable domain and a TCRβ chain variable domain, and the TCRα chain variable domain is an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 1; and/ Or the TCR beta chain variable domain is an amino acid sequence with at least 90% sequence identity to SEQ ID NO:5.

In another preferred embodiment, the TCR comprises the α chain variable domain amino acid sequence of SEQ ID NO: 1.

In another preferred embodiment, the TCR comprises a beta chain variable domain amino acid sequence of SEQ ID NO:5.

In another preferred embodiment, the TCR is an αβ heterodimer, which comprises a TCRα chain constant region TRAC*01 and a TCRβ chain constant region TRBC1*01 or TRBC2*01.

In another preferred embodiment, the amino acid sequence of the α chain of the TCR is SEQ ID NO: 3 and/or the amino acid sequence of the β chain of the TCR is SEQ ID NO: 7.

In another preferred embodiment, the TCR is soluble.

In another preferred embodiment, the TCR is a single chain.

In another preferred embodiment, the TCR is formed by linking the α chain variable domain and the β chain variable domain through a peptide linker sequence.

In another preferred embodiment, the TCR is at the 11th, 13th, 19th, 21st, 53rd, 76th, 89th, 91st, or 94th amino acid position of the α chain variable region, and/or the reciprocal amino acid of the α chain J gene short peptide has one or more mutations in position 3, 5 from the bottom, or 7 from the bottom; and/or the TCR is at amino acids 11, 13, 19, 21, 53, 76, 89, 91 of the beta chain variable region , or position 94, and/or one or more mutations in the penultimate amino acid position 2, 4 or 6 of the β-chain J gene short peptide, wherein the amino acid positions are numbered according to IMGT (International Information on Immunogenetics) system) listed in the position number.

In another preferred embodiment, the amino acid sequence of the α-chain variable domain of the TCR comprises SEQ ID NO:32 and/or the amino acid sequence of the β-chain variable domain of the TCR comprises SEQ ID NO:34.

In another preferred embodiment, the amino acid sequence of the TCR is SEQ ID NO:30.

In another preferred embodiment, the TCR comprises (a) all or part of the TCRα chain excluding the transmembrane domain; and (b) all or part of the TCRβ chain excluding the transmembrane domain;

And (a) and (b) each comprise a functional variable domain, or comprise a functional variable domain and at least a portion of the TCR chain constant domain.

In another preferred embodiment, cysteine residues form an artificial disulfide bond between the constant domains of the α and β chains of the TCR.

In another preferred embodiment, the cysteine residues forming artificial disulfide bonds in the TCR are substituted with one or more sites selected from the following groups:

Thr48 in exon 1 of TRAC*01 and Ser57 in exon 1 of TRBC1*01 or TRBC2*01;

Thr45 in exon 1 of TRAC*01 and Ser77 in exon 1 of TRBC1*01 or TRBC2*01;

Tyr10 of exon 1 of TRAC*01 and Ser17 of exon 1 of TRBC1*01 or TRBC2*01;

Thr45 of exon 1 of TRAC*01 and Asp59 of exon 1 of TRBC1*01 or TRBC2*01;

Ser15 of exon 1 of TRAC*01 and Glu15 of exon 1 of TRBC1*01 or TRBC2*01;

Arg53 in exon 1 of TRAC*01 and Ser54 in exon 1 of TRBC1*01 or TRBC2*01;

Pro89 of exon 1 of TRAC*01 and Ala19 of exon 1 of TRBC1*01 or TRBC2*01; and

Tyr10 of exon 1 of TRAC*01 and Glu20 of exon 1 of TRBC1*01 or TRBC2*01.

In another preferred embodiment, the amino acid sequence of the α chain of the TCR is SEQ ID NO:26 and/or the amino acid sequence of the β chain of the TCR is SEQ ID NO:28.

In another preferred embodiment, an artificial interchain disulfide bond is contained between the variable region of the α chain and the constant region of the β chain of the TCR.

In another preferred embodiment, it is characterized in that the cysteine residues that form artificial interchain disulfide bonds in the TCR are substituted with one or more sites selected from the following groups:

Amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1*01 or TRBC2*01;

Amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1*01 or TRBC2*01;

Amino acid 46 of TRAV and amino acid 61 of exon 1 of TRBC1*01 or TRBC2*01; or

Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1*01 or TRBC2*01.

In another preferred embodiment, the TCR comprises an α-chain variable domain and a β-chain variable domain and all or part of the β-chain constant domain except the transmembrane domain, but it does not comprise an α-chain constant domain, and the TCR The α chain variable domain forms a heterodimer with the β chain.

In another preferred embodiment, a conjugate is bound to the C- or N-terminus of the α chain and/or the β chain of the TCR.

In another preferred embodiment, the conjugate bound to the T cell receptor is a detectable label, a therapeutic agent, a PK modification moiety or a combination of any of these substances. Preferably, the therapeutic agent is an anti-CD3 antibody.

The second aspect of the present invention provides a multivalent TCR complex comprising at least two TCR molecules, and at least one of the TCR molecules is the TCR described in the first aspect of the present invention.

The third aspect of the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding the TCR molecule described in the first aspect of the present invention or a complementary sequence thereof.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 33 encoding the variable domain of the TCRα chain.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 6 or SEQ ID NO: 35 encoding the variable domain of the TCRβ chain.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:4 encoding the TCRα chain and/or the nucleotide sequence of SEQ ID NO:8 encoding the TCRβ chain.

The fourth aspect of the present invention provides a vector, which contains the nucleic acid molecule described in the third aspect of the present invention; preferably, the vector is a viral vector; more preferably, the vector is a viral vector viral vector.

The fifth aspect of the present invention provides an isolated host cell, wherein the host cell contains the vector described in the fourth aspect of the present invention or the exogenous nucleic acid molecule described in the third aspect of the present invention is integrated into the genome .

The sixth aspect of the present invention provides a cell that transduces the nucleic acid molecule described in the third aspect of the present invention or the vector described in the fourth aspect of the present invention; preferably, the cell is a T cell or a stem cell .

A seventh aspect of the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier, the TCR described in the first aspect of the present invention, the TCR complex described in the second aspect of the present invention, the present The nucleic acid molecule of the third aspect of the present invention, the vector of the fourth aspect of the present invention, or the cell of the sixth aspect of the present invention.

The eighth aspect of the present invention provides the T cell receptor of the first aspect of the present invention, or the TCR complex of the second aspect of the present invention, the nucleic acid molecule of the third aspect of the present invention, and the fourth aspect of the present invention. The use of the vector described in the aspect, or the cell described in the sixth aspect of the present invention, is used to prepare a medicament for treating tumors or autoimmune diseases.

The ninth aspect of the present invention provides a method for treating a disease, comprising administering an appropriate amount of the T cell receptor described in the first aspect of the present invention or the TCR complex described in the second aspect of the present invention to a subject in need of treatment , the nucleic acid molecule described in the third aspect of the present invention, the vector described in the fourth aspect of the present invention, or the cell described in the sixth aspect of the present invention, or the pharmaceutical composition described in the seventh aspect of the present invention;

Preferably, the disease is a tumor, preferably the tumor includes neuroblastoma, sarcoma, melanoma, prostate cancer, bladder cancer, breast cancer, multiple myeloma, hepatocellular carcinoma, oral squamous cell carcinoma, and esophageal cancer As well as gastric cancer, lung cancer, head and neck squamous cell carcinoma, colon cancer, ovarian cancer, etc.

It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described in the following (eg, the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, it is not repeated here.

Description of drawings

Fig. 1a, Fig. 1b, Fig. 1c, Fig. 1d, Fig. 1e and Fig. 1f are respectively the amino acid sequence of TCRα chain variable domain, the nucleotide sequence of TCRα chain variable domain, the amino acid sequence of TCRα chain, the nucleotide sequence of TCRα chain, with The amino acid sequence of the TCRα chain of the leader sequence and the nucleotide sequence of the TCRα chain with the leader sequence.

Figure 2a, Figure 2b, Figure 2c, Figure 2d, Figure 2e and Figure 2f are the amino acid sequence of the variable domain of the TCRβ chain, the nucleotide sequence of the variable domain of the TCRβ chain, the amino acid sequence of the TCRβ chain, and the nucleotide sequence of the TCRβ chain, respectively. The amino acid sequence of the TCR beta chain of the leader sequence and the nucleotide sequence of the TCR beta chain with the leader sequence.

Figure 3 shows the results of CD8 ⁺ and tetramer-PE double positive staining of monoclonal cells.

Figure 4a and Figure 4b show the amino acid sequence and nucleotide sequence of the soluble TCRα chain, respectively.

Figure 5a and Figure 5b are the amino acid sequence and nucleotide sequence of the soluble TCR beta chain, respectively.

Figure 6 is a gel image of the soluble TCR obtained after purification. The leftmost lane is the reducing gel, the middle lane is the molecular weight marker, and the rightmost lane is the non-reducing gel.

Figure 7a and Figure 7b show the amino acid sequence and nucleotide sequence of the single-chain TCR, respectively.

Figure 8a and Figure 8b are the amino acid sequence and nucleotide sequence of the single-chain TCRα chain, respectively.

Figures 9a and 9b are the amino acid sequence and nucleotide sequence of the single-stranded TCR beta chain, respectively.

Figures 10a and 10b are the amino acid sequence and nucleotide sequence of the single-stranded TCR linker, respectively.

Figure 11 is a gel image of the soluble single-chain TCR obtained after purification. The left lane is the molecular weight marker and the right lane is the non-reducing gel.

Figure 12 is a BIAcore kinetic map of the binding of the soluble TCR of the present invention to the SLLMWITQC-HLA A0201 complex.

Figure 13 is a BIAcore kinetic map of the binding of the soluble single-chain TCR of the present invention to the SLLMWITQC--HLA A0201 complex.

Detailed ways

After extensive and in-depth research, the inventors found a TCR that can specifically bind to the NY-ESO-1 antigen short peptide SLLMWITQC (SEQ ID NO: 9), which can form a complex with HLA A0201 and together presented to the cell surface. The present invention also provides a nucleic acid molecule encoding the TCR and a vector comprising the nucleic acid molecule. In addition, the present invention also provides cells transduced with the TCR of the present invention.

the term

MHC molecules are proteins of the immunoglobulin superfamily and can be class I or class II MHC molecules. Therefore, it is specific for antigen presentation, and different individuals have different MHCs, which can present different short peptides in a protein antigen to their respective APC cell surfaces. The human MHC is often referred to as the HLA gene or HLA complex.

The T cell receptor (TCR) is the only receptor for specific antigenic peptides presented on the major histocompatibility complex (MHC). In the immune system, direct physical contact between T cells and antigen-presenting cells (APCs) is triggered by the binding of antigen-specific TCRs to pMHC complexes, and then other cell membrane surface molecules of both T cells and APCs interact. It causes a series of subsequent cell signaling and other physiological responses, so that T cells with different antigen specificities exert immune effects on their target cells.

TCR is a glycoprotein on the surface of the cell membrane that exists in the form of heterodimers of α chain/β chain or γ chain/δ chain. TCR heterodimers consist of alpha and beta chains in 95% of T cells, whereas 5% of T cells have TCRs composed of gamma and delta chains. A native αβ heterodimeric TCR has an α chain and a β chain, and the α chain and the β chain constitute the subunits of the αβ heterodimeric TCR. Broadly speaking, the alpha and beta chains each contain a variable region, a linker region, and a constant region, and the beta chain usually also contains a short variable region between the variable region and the linker region, but the variable region is often regarded as the linker region a part of. Each variable region comprises 3 CDRs (complementarity determining regions), CDR1, CDR2 and CDR3, chimeric in framework regions. The CDR region determines the binding of TCR to the pMHC complex, and CDR3 is recombined from the variable region and the linker region, which is called the hypervariable region. The alpha and beta chains of a TCR are generally viewed as having two "domains" each, a variable domain and a constant domain, the variable domains being composed of linked variable and linking regions. The sequences of the TCR constant domains can be found in the public database of the International Information System for Immunogenetics (IMGT). 01" or "TRBC2*01". In addition, the α and β chains of TCR also contain a transmembrane region and a cytoplasmic region, and the cytoplasmic region is very short.

In the present invention, the terms "polypeptide of the present invention", "TCR of the present invention", "T cell receptor of the present invention" are used interchangeably.

Natural interchain disulfide bonds and artificial interchain disulfide bonds

There is a set of disulfide bonds between the Cα and Cβ chains in the near-membrane region of the native TCR, which are referred to as "native interchain disulfide bonds" in the present invention. In the present invention, the artificially introduced interchain covalent disulfide bond whose position is different from that of the natural interchain disulfide bond is referred to as "artificial interchain disulfide bond".

For the convenience of describing the position of the disulfide bond, the position numbers of the amino acid sequences of TRAC*01 and TRBC1*01 or TRBC2*01 in the present invention are numbered sequentially from the N-terminus to the C-terminus, such as TRBC1*01 or TRBC2*01 , the 60th amino acid in the sequence from the N-terminus to the C-terminus is P (proline), then in the present invention, it can be described as Pro60 of exon 1 of TRBC1*01 or TRBC2*01, or it can be described as Pro60 of exon 1 of TRBC1*01 It is expressed as the 60th amino acid of exon 1 of TRBC1*01 or TRBC2*01, and in TRBC1*01 or TRBC2*01, the 61st amino acid in the sequence from the N-terminus to the C-terminus is Q (glutamate). amide), in the present invention, it can be described as Gln61 of TRBC1*01 or TRBC2*01 exon 1, or it can be described as the 61st amino acid of TRBC1*01 or TRBC2*01 exon 1, other And so on. In the present invention, the position numbers of the amino acid sequences of the variable regions TRAV and TRBV are numbered according to the position numbers listed in IMGT. For example, for a certain amino acid in TRAV, the position number listed in IMGT is 46, then it is described as the 46th amino acid of TRAV in the present invention, and so on. In the present invention, if the sequence position numbering of other amino acids has special instructions, the special instructions are followed.

Detailed description of the invention

TCR molecule

During antigen processing, the antigen is degraded within the cell and then carried to the cell surface by MHC molecules. T cell receptors recognize peptide-MHC complexes on the surface of antigen-presenting cells. Accordingly, a first aspect of the present invention provides a TCR molecule capable of binding the SLLMWITQC-HLA A0201 complex. Preferably, the TCR molecule is isolated or purified. The alpha and beta chains of this TCR each have three complementarity determining regions (CDRs).

In a preferred embodiment of the present invention, the alpha chain of the TCR comprises a CDR having the following amino acid sequence:

αCDR1-SIFNT (SEQ ID NO: 10)

αCDR2-LYKAGEL (SEQ ID NO: 11)

αCDR3-AGFMDSNYQLI (SEQ ID NO: 12); and/or

The three complementarity determining regions of the TCRβ chain variable domain are:

βCDR1-SGHVS (SEQ ID NO: 13)

βCDR2-FQNEAQ (SEQ ID NO: 14)

βCDR3-ASSLGGSVLH (SEQ ID NO: 15).

Chimeric TCRs can be prepared by inserting the above-described amino acid sequences of the CDR regions of the present invention into any suitable framework structure. As long as the framework structure is compatible with the CDR regions of the TCR of the present invention, those skilled in the art can design or synthesize TCR molecules with corresponding functions based on the CDR regions disclosed in the present invention. Accordingly, the TCR molecule of the present invention refers to a TCR molecule comprising the above-mentioned alpha and/or beta chain CDR region sequences and any suitable framework structure. The TCRα chain variable domain of the present invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID NO: 1; and/or the TCRβ chain variable domain of the present invention is an amino acid sequence with SEQ ID NO: 1 NO:5 has an amino acid sequence of at least 90%, preferably 95%, more preferably 98% sequence identity.

In a preferred embodiment of the present invention, the TCR molecule of the present invention is a heterodimer composed of α and β chains. Specifically, on the one hand, the α chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, and the amino acid sequence of the α chain variable domain comprises CDR1 (SEQ ID NO: 10), CDR2 (SEQ ID NO: 10) and CDR2 (SEQ ID NO: 10) of the above-mentioned α chain. ID NO: 11) and CDR3 (SEQ ID NO: 12). Preferably, the TCR molecule comprises the alpha chain variable domain amino acid sequence of SEQ ID NO:1. More preferably, the amino acid sequence of the α chain variable domain of the TCR molecule is SEQ ID NO: 1. On the other hand, the β chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, and the amino acid sequence of the β chain variable domain comprises CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 13) of the above-mentioned β chain NO: 14) and CDR3 (SEQ ID NO: 15). Preferably, the TCR molecule comprises the beta chain variable domain amino acid sequence of SEQ ID NO:5. More preferably, the amino acid sequence of the beta chain variable domain of the TCR molecule is SEQ ID NO:5.

In a preferred embodiment of the present invention, the TCR molecule of the present invention is a single-chain TCR molecule composed of part or all of the α chain and/or part or all of the β chain. A description of single-chain TCR molecules can be found in Chung et al (1994) Proc. Natl. Acad. Sci. USA 91, 12654-12658. Those skilled in the art can readily construct single-chain TCR molecules comprising the CDRs regions of the present invention as described in the literature. Specifically, the single-chain TCR molecule comprises Vα, Vβ and Cβ, preferably linked in order from the N-terminus to the C-terminus.

The α-chain variable domain amino acid sequence of the single-chain TCR molecule comprises CDR1 (SEQ ID NO: 10), CDR2 (SEQ ID NO: 11) and CDR3 (SEQ ID NO: 12) of the above-mentioned α chain. Preferably, the single-chain TCR molecule comprises the alpha chain variable domain amino acid sequence of SEQ ID NO:1. More preferably, the amino acid sequence of the α-chain variable domain of the single-chain TCR molecule is SEQ ID NO: 1. The beta chain variable domain amino acid sequence of the single-chain TCR molecule comprises CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 14) and CDR3 (SEQ ID NO: 15) of the above beta chain. Preferably, the single-chain TCR molecule comprises the beta chain variable domain amino acid sequence of SEQ ID NO:5. More preferably, the amino acid sequence of the beta chain variable domain of the single-chain TCR molecule is SEQ ID NO:5.

In a preferred embodiment of the present invention, the constant domain of the TCR molecule of the present invention is a human constant domain. Those skilled in the art know or can obtain the human constant domain amino acid sequence by consulting relevant books or the public database of IMGT (International Immunogenetics Information System). For example, the constant domain sequence of the alpha chain of the TCR molecule of the present invention can be "TRAC*01", and the constant domain sequence of the beta chain of the TCR molecule can be "TRBC1*01" or "TRBC2*01". The 53rd position of the amino acid sequence given in TRAC*01 of IMGT is Arg, which is represented here as: Arg53 of exon 1 of TRAC*01, and so on. Preferably, the amino acid sequence of the α chain of the TCR molecule of the present invention is SEQ ID NO:3, and/or the amino acid sequence of the β chain is SEQ ID NO:7.

The naturally occurring TCR is a membrane protein that is stabilized by its transmembrane region. Like immunoglobulins (antibodies) as antigen recognition molecules, TCRs can also be developed for diagnostic and therapeutic applications, where soluble TCR molecules need to be obtained. Soluble TCR molecules do not include their transmembrane domains. Soluble TCR has a wide range of uses, not only to study the interaction of TCR with pMHC, but also as a diagnostic tool to detect infection or as a marker for autoimmune diseases. Similarly, soluble TCRs can be used to deliver therapeutic agents (eg, cytotoxic or immunostimulatory compounds) to cells presenting specific antigens, and in addition, soluble TCRs can bind to other molecules (eg, anti-CD3 antibodies) to redirect T cells so that they target cells presenting specific antigens. The present invention also obtains a soluble TCR specific for the NY-ESO-1 antigenic short peptide.

To obtain soluble TCRs, in one aspect, the TCRs of the invention may be TCRs in which artificial disulfide bonds are introduced between residues of their alpha and beta chain constant domains. Cysteine residues form artificial interchain disulfide bonds between the constant domains of the alpha and beta chains of the TCR. Cysteine residues can be substituted for other amino acid residues at appropriate sites in the native TCR to form artificial interchain disulfide bonds. For example, substitution of Thr48 of exon 1 of TRAC*01 and substitution of cysteine residues of Ser57 of exon 1 of TRBC1*01 or TRBC2*01 to form a disulfide bond. Other sites where cysteine residues are introduced to form disulfide bonds can also be: Thr45 in exon 1 of TRAC*01 and Ser77 in exon 1 of TRBC1*01 or TRBC2*01; exon 1 of TRAC*01 1 Tyr10 and TRBC1*01 or Ser17 of TRBC2*01 exon 1; Thr45 of TRAC*01 exon 1 and Asp59 of TRBC1*01 or TRBC2*01 exon 1; TRAC*01 exon 1 Ser15 and Glu15 in exon 1 of TRBC1*01 or TRBC2*01; Arg53 in exon 1 of TRAC*01 and Ser54 in exon 1 of TRBC1*01 or TRBC2*01; Pro89 and exon 1 of TRAC*01 Ala19 of exon 1 of TRBC1*01 or TRBC2*01; or Tyr10 of exon 1 of TRAC*01 and Glu20 of exon 1 of TRBC1*01 or TRBC2*01. That is, cysteine residues are substituted for any set of sites in the constant domains of the alpha and beta chains described above. One or more C-termini of the TCR constant domains of the invention may be truncated by up to 50, or up to 30, or up to 15, or up to 10, or up to 8 or fewer amino acids so that they do not include The purpose of deleting the natural disulfide bond can be achieved by the cysteine residue, or by mutating the cysteine residue forming the natural disulfide bond into another amino acid to achieve the above purpose.

As mentioned above, the TCRs of the present invention may contain artificial disulfide bonds introduced between residues of their alpha and beta chain constant domains. It should be noted that the TCRs of the invention may contain both a TRAC constant domain sequence and a TRBC1 or TRBC2 constant domain sequence, with or without the artificial disulfide bonds introduced above between the constant domains. The TRAC constant domain sequence of the TCR and the TRBC1 or TRBC2 constant domain sequence may be linked by natural disulfide bonds present in the TCR.

In order to obtain a soluble TCR, on the other hand, the TCR of the present invention also includes a TCR with mutation in its hydrophobic core region, and the mutation of these hydrophobic core regions is preferably a mutation that can improve the stability of the soluble TCR of the present invention, such as in Publication No. Described in the patent document of WO2014/206304. Such a TCR may be mutated at the following variable domain hydrophobic core positions: (alpha and/or beta chain) variable domain amino acids 11, 13, 19, 21, 53, 76, 89, 91, 94, and/or Or the alpha chain J gene (TRAJ) short peptide amino acid position 3,5,7 from the bottom, and/or the beta chain J gene (TRBJ) short peptide amino acid position 2,4,6 from the bottom, where the position number of the amino acid sequence Numbered by position as listed in the International Information System on Immunogenetics (IMGT). Those skilled in the art are aware of the above-mentioned International Immunogenetics Information System, and can obtain the position numbers of amino acid residues of different TCRs in IMGT according to the database.

In the present invention, the mutated TCR in the hydrophobic core region can be a stable soluble single-chain TCR composed of a flexible peptide chain linking the variable domains of the α and β chains of the TCR. It should be noted that the flexible peptide chain in the present invention can be any peptide chain suitable for linking the variable domains of TCRα and β chain. For the single-chain soluble TCR constructed in Example 4 of the present invention, the amino acid sequence of the α chain variable domain is SEQ ID NO: 32, and the encoded nucleotide sequence is SEQ ID NO: 33; the amino acid sequence of the β chain variable domain is SEQ ID NO: 33; is SEQ ID NO:34, and the encoded nucleotide sequence is SEQ ID NO:35.

In addition, in terms of stability, Patent Document 201510260322.4 also discloses that the introduction of artificial interchain disulfide bonds between the α chain variable region and the β chain constant region of TCR can significantly improve the stability of TCR. Therefore, the high-affinity TCR of the present invention may also contain artificial interchain disulfide bonds between the variable region of the α chain and the constant region of the β chain. Specifically, the cysteine residue that forms an artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR is substituted for: amino acid 46 of TRAV and TRBC1*01 or TRBC2* 01 amino acid 60 of exon 1; TRAV amino acid 47 and TRBC1*01 or TRBC2*01 exon 1 amino acid 61; TRAV 46 amino acid and TRBC1*01 or TRBC2*01 exon Amino acid 61 of exon 1; or amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1*01 or TRBC2*01. Preferably, such a TCR may comprise (i) all or part of the TCR alpha chain excluding its transmembrane domain, and (ii) all or part of the TCR beta chain excluding its transmembrane domain, wherein (i) and (ii) ) both contain the variable domain and at least a part of the constant domain of the TCR chain, and the α chain and the β chain form a heterodimer. More preferably, such a TCR may contain an alpha chain variable domain and a beta chain variable domain and all or part of the beta chain constant domain except the transmembrane domain, but it does not contain the alpha chain constant domain, the alpha chain of the TCR. The chain variable domains form heterodimers with beta chains.

The TCRs of the present invention may also be provided in the form of multivalent complexes. The multivalent TCR complexes of the present invention comprise two, three, four or more multimers formed by combining the TCRs of the present invention, for example, the tetramerization domain of p53 can be used to generate tetramers, or multiple A complex formed by combining a TCR of the present invention with another molecule. The TCR complexes of the present invention can be used to track or target cells presenting specific antigens in vitro or in vivo, as well as to generate intermediates for other multivalent TCR complexes with such applications.

The TCR of the present invention can be used alone, or can be combined with the conjugate in a covalent or other manner, preferably in a covalent manner. The conjugate includes a detectable label (for diagnostic purposes, wherein the TCR is used to detect the presence of cells presenting the SLLMWITQC-HLA A0201 complex), a therapeutic agent, a PK (protein kinase) modification moiety, or any of the above combination or conjugation.

Detectable labels for diagnostic purposes include, but are not limited to, fluorescent or luminescent labels, radiolabels, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or capable of producing detectable products enzyme.

Therapeutic agents that can be conjugated or conjugated to the TCR of the present invention include, but are not limited to: 1. radionuclides (Koppe et al., 2005, Cancer metastas reviews 24, 539); 2. biotoxicity (Chaudhary et al., 1989, Nature 339, 394; Epel et al, 2002, Cancer Immunology and Immunotherapy 51, 565); 3. Cytokines such as IL-2, etc. (Gillies et al, 1992, National Academy of Sciences Journal (PNAS) 89, 1428; Card et al, 2004, Cancer Immunology and Immunotherapy 53, 345; Halin et al, 2003, Cancer Research 63, 3202); 4. Antibody Fc fragments ( Mosquera et al, 2005, The Journal of Immunology 174, 4381); 5. Antibody scFv fragments (Zhu et al, 1995, International Journal of Cancer 62, 319); 6. Gold nanoparticles/nanorods (Lapotko et al, 2005, Cancer letters 239, 36; Huang et al, 2006, Journal of the American Chemical Society 128, 2115); 7. Viral particles (Peng et al, 2004, Gene therapy (Gene therapy) 11, 1234); 8. Liposomes (Mamot et al., 2005, Cancer research 65, 11631); 9. Nanomagnetic particles; 10. Prodrug-activating enzymes (eg, DT-cardiac enzyme (DTD) or biphenyl hydrolase-like protein (BPHL)); 11. chemotherapeutic agents (eg, cisplatin) or nanoparticles in any form, etc.

Additionally, the TCRs of the present invention may also be hybrid TCRs comprising sequences derived from more than one species. For example, studies have shown that murine TCRs are more efficiently expressed in human T cells than human TCRs. Thus, the TCRs of the present invention may comprise human variable domains and murine constant domains. The downside of this approach is the potential to elicit an immune response. Therefore, there should be a regulatory regime for immunosuppression when it is used in adoptive T cell therapy to allow engraftment of murine expressing T cells.

It should be understood that the names of amino acids in this paper are represented by the international single English letter or three English letters, and the correspondence between the single English letter and the three English letters of the amino acid name is as follows: Ala(A), Arg(R), Asn(N), Asp(D), Cys(C), Gln(Q), Glu(E), Gly(G), His(H), Ile(I), Leu(L), Lys(K), Met(M), Phe(F), Pro(P), Ser(S), Thr(T), Trp(W), Tyr(Y), Val(V).

nucleic acid molecule

A second aspect of the invention provides a nucleic acid molecule encoding a TCR molecule of the first aspect of the invention, or a portion thereof, which portion may be one or more CDRs, variable domains of alpha and/or beta chains, and alpha chains and/or or beta chains.

The nucleotide sequence encoding the α chain CDR region of the TCR molecule according to the first aspect of the present invention is as follows:

αCDR1- agcatatttaacacc (SEQ ID NO: 16)

αCDR2- ttatataaggctggtgaattg (SEQ ID NO: 17)

αCDR3- gctggcttcatggatagcaactatcagttaatc (SEQ ID NO: 18)

The nucleotide sequence encoding the beta chain CDR region of the TCR molecule according to the first aspect of the present invention is as follows:

βCDR1- tcgggtcatgtatcc (SEQ ID NO: 19)

βCDR2- ttccagaatgaagctcaa (SEQ ID NO:20)

βCDR3- gccagcagcttagggggctctgtgctccac (SEQ ID NO: 21)

Accordingly, the nucleotide sequences of the nucleic acid molecules of the present invention encoding the TCR alpha chains of the present invention include SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, and/or the core of the nucleic acid molecules of the present invention encoding the TCR beta chains of the present invention The nucleotide sequences include SEQ ID NO:19, SEQ ID NO:20 and SEQ ID NO:21.

The nucleotide sequence of the nucleic acid molecule of the invention may be single-stranded or double-stranded, the nucleic acid molecule may be RNA or DNA, and may or may not contain introns. Preferably, the nucleotide sequence of the nucleic acid molecule of the present invention does not contain introns but is capable of encoding the polypeptide of the present invention, for example, the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR alpha chain of the present invention includes SEQ ID NO: 2 and /or the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR beta chain of the present invention comprises SEQ ID NO:6. Alternatively, the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR alpha chain of the present invention includes SEQ ID NO: 33 and/or the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR beta chain of the present invention includes SEQ ID NO: 33 NO: 35. More preferably, the nucleotide sequence of the nucleic acid molecule of the invention comprises SEQ ID NO:4 and/or SEQ ID NO:8. Alternatively, the nucleotide sequence of the nucleic acid molecule of the present invention is SEQ ID NO:31.

It will be appreciated that due to the degeneracy of the genetic code, different nucleotide sequences can encode the same polypeptide. Accordingly, the nucleic acid sequences encoding the TCRs of the present invention may be identical or degenerate variants of the nucleic acid sequences shown in the figures of the present invention. To illustrate with one of the examples in the present invention, "degenerate variant" refers to a nucleic acid sequence that encodes a protein sequence of SEQ ID NO: 1, but differs from the sequence of SEQ ID NO: 2.

The nucleotide sequence may be codon-optimized. Different cells differ in the use of specific codons. Depending on the type of cell, the codons in the sequence can be changed to increase the amount of expression. Codon usage tables for mammalian cells, as well as various other organisms, are well known to those skilled in the art.

The full-length sequence of the nucleic acid molecule of the present invention or a fragment thereof can generally be obtained by, but not limited to, PCR amplification method, recombinant method or artificial synthesis method. At present, the DNA sequences encoding the TCRs of the present invention (or fragments thereof, or derivatives thereof) can be obtained entirely by chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or eg vectors) and cells known in the art. DNA can be the coding or non-coding strand.

carrier

The present invention also relates to vectors comprising the nucleic acid molecules of the present invention, including expression vectors, ie constructs capable of in vivo or in vitro expression. Commonly used vectors include bacterial plasmids, bacteriophages, and animal and plant viruses.

Viral delivery systems include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, herpesvirus vectors, retroviral vectors, lentiviral vectors, baculovirus vectors.

Preferably, the vector can transfer the nucleotides of the invention into cells, such as T cells, such that the cells express a TCR specific for the NY-ESO-1 antigen. Ideally, the vector should be able to express consistently high levels in T cells.

cell

The present invention also relates to host cells genetically engineered with the vectors or coding sequences of the present invention. The host cell contains the vector of the present invention or the nucleic acid molecule of the present invention is integrated into the chromosome. The host cell is selected from: prokaryotic cells and eukaryotic cells, such as E. coli, yeast cells, CHO cells, and the like.

In addition, the present invention also includes isolated cells, in particular T cells, expressing the TCRs of the present invention. The T cells can be derived from T cells isolated from the subject, or can be part of a mixed population of cells isolated from the subject, such as a peripheral blood lymphocyte (PBL) population. For example, the cells can be isolated from peripheral blood mononuclear cells (PBMCs) and can be CD4 ⁺ helper T cells or CD8 ⁺ cytotoxic T cells. The cells can be in a mixed population of CD4 ⁺ helper T cells/CD8 ⁺ cytotoxic T cells. Typically, the cells can be activated with antibodies (eg, anti-CD3 or anti-CD28 antibodies) to render them more receptive to transfection, eg, with a vector comprising a nucleotide sequence encoding a TCR molecule of the invention dye.

Alternatively, the cells of the invention may also be or derived from stem cells, such as hematopoietic stem cells (HSCs). Gene transfer to HSCs does not result in TCR expression on the cell surface because the CD3 molecule is not expressed on the surface of stem cells. However, when stem cells differentiate into lymphoid precursors that migrate to the thymus, expression of the CD3 molecule will initiate expression of the introduced TCR molecule on the surface of the thymocytes.

There are a number of methods suitable for transfection of T cells with DNA or RNA encoding the TCRs of the invention (eg, Robbins et al., (2008) J. Immunol. 180:6116-6131). T cells expressing the TCR of the present invention can be used for adoptive immunotherapy. Those skilled in the art are aware of many suitable methods for adopting adoptive therapy (eg, Rosenberg et al., (2008) Nat RevCancer 8(4):299-308).

NY-ESO-1 antigen-related diseases

The present invention also relates to a method of treating and/or preventing a disease associated with NY-ESO-1 in a subject comprising the step of adoptively transferring NY-ESO-1 specific T cells to the subject. The NY-ESO-1-specific T cells recognized the SLLMWITQC-HLA A0201 complex.

The NY-ESO-1 specific T cells of the present invention can be used to treat any NY-ESO-1 related diseases that present the NY-ESO-1 antigen short peptide SLLMWITQC-HLA A0201 complex. Including but not limited to tumors, preferably the tumors include neuroblastoma, sarcoma, melanoma, prostate cancer, bladder cancer, breast cancer, multiple myeloma, hepatocellular carcinoma, oral squamous cell carcinoma, esophageal cancer and gastric cancer, lung cancer , head and neck squamous cell carcinoma, colon cancer, ovarian cancer, etc.

treatment method

It can be carried out by isolating T cells from patients or volunteers with NY-ESO-1 antigen-related diseases, introducing the TCR of the present invention into the above T cells, and then infusing these genetically engineered cells back into the patient. treat. Therefore, the present invention provides a method for the treatment of NY-ESO-1 related diseases, comprising infusing the isolated T cells expressing the TCR of the present invention, preferably, the T cells are derived from the patient itself, into the patient. Typically, this involves (1) isolating T cells from a patient, (2) transducing T cells in vitro with a nucleic acid molecule of the invention or a nucleic acid molecule capable of encoding a TCR molecule of the invention, and (3) infusing genetically engineered T cells into a patient in vivo. The number of cells isolated, transfected, and reinfused can be determined by the physician.

The main advantages of the present invention are:

(1) The TCR of the present invention can bind to the NY-ESO-1 antigen short peptide complex SLLMWITQC-HLA A0201, and the cells transduced with the TCR of the present invention can be specifically activated and have a strong killing effect on target cells.

The following specific examples further illustrate the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental method of unreceipted specific conditions in the following examples, usually according to conventional conditions, such as (Sambrook and Russell et al, Molecular Cloning: Laboratory Manual (Molecular Cloning-A Laboratory Manual) (Third Edition) (2001) CSHL Press ), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise indicated. Percentages and parts are by weight unless otherwise indicated. The experimental materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

Example 1 Cloning of NY-ESO-1 antigen peptide-specific T cells

Peripheral blood lymphocytes (PBL) from healthy volunteers with HLA-A0201 genotype were stimulated with the synthetic short peptide SLLMWITQC (SEQ ID NO.: 9; Beijing Saibaisheng Gene Technology Co., Ltd.). The SLLMWITQC peptide was renatured with biotin-labeled HLA-A0201 to prepare pHLA haploids. These haploids were combined with PE-labeled streptavidin (BD) to form PE-labeled tetramers, and the tetramers and anti-CD8-APC double positive cells were sorted. Sorted cells were expanded and subjected to secondary sorting as described above, followed by monocloning by limiting dilution. Monoclonal cells were stained with tetramers, and the screened double-positive clones were shown in Figure 3.

Example 2 Construction of TCR gene and vector for obtaining NY-ESO-1 antigen peptide-specific T cell clones

The total RNA of the antigen short peptide SLLMWITQC-specific and HLA-A0201-restricted T cell clone screened in Example 1 was extracted with Quick-RNA ^™ MiniPrep (ZYMO research). The cDNA was synthesized using the SMART RACE cDNA amplification kit from clontech, and the primers used were designed in the C-terminal conserved region of the human TCR gene. The sequence was cloned into T vector (TAKARA) for sequencing. It should be noted that this sequence is complementary and does not contain introns. After sequencing, the sequence structures of the α chain and β chain of TCR expressed by the double-positive clone are shown in Figure 1 and Figure 2, respectively. Figure 1a, Figure 1b, Figure 1c, Figure 1d, Figure 1e, and Figure 1f show that the TCRα chain can be Variable domain amino acid sequence, TCRα chain variable domain nucleotide sequence, TCRα chain amino acid sequence, TCRα chain nucleotide sequence, TCRα chain amino acid sequence with leader sequence and TCRα chain nucleotide sequence with leader sequence; Figure 2a, Figure 2b, Figure 2c, Figure 2d, Figure 2e, and Figure 2f are the amino acid sequence of the variable domain of the TCRβ chain, the nucleotide sequence of the variable domain of the TCRβ chain, the amino acid sequence of the TCRβ chain, the nucleotide sequence of the TCRβ chain, and the nucleotide sequence of the TCRβ chain with a leader sequence, respectively. TCRβ chain amino acid sequence and TCRβ chain nucleotide sequence with leader sequence.

The alpha chain was identified as comprising CDRs with the following amino acid sequence:

αCDR1-SIFNT (SEQ ID NO: 10)

αCDR2-LYKAGEL (SEQ ID NO: 11)

αCDR3-AGFMDSNYQLI (SEQ ID NO: 12)

The beta chain contains CDRs with the following amino acid sequence:

βCDR1-SGHVS (SEQ ID NO: 13)

βCDR2-FQNEAQ (SEQ ID NO: 14)

βCDR3-ASSLGGSVLH (SEQ ID NO: 15)

The full-length genes of the TCR alpha chain and beta chain were cloned into the lentiviral expression vector pLenti (addgene), respectively, by overlapping PCR. Specifically, the TCRα-2A-TCRβ fragment was obtained by ligating the full-length genes of the TCRα chain and the TCRβ chain by overlap PCR. The pLenti-TRA-2A-TRB-IRES-NGFR plasmid was obtained by ligating the lentiviral expression vector and TCRα-2A-TCRβ restriction enzyme. As a control, a lentiviral vector pLenti-eGFP expressing eGFP was also constructed. Afterwards, 293T/17 was used to package the pseudovirus.

Example 3 Expression, Refolding and Purification of NY-ESO-1 Antigen Short Peptide-Specific Soluble TCR

In order to obtain a soluble TCR molecule, the α and β chains of the TCR molecule of the present invention can respectively contain only their variable domains and part of their constant domains, and a cysteine residue is introduced into the constant domains of the α and β chains respectively. In order to form an artificial interchain disulfide bond, the positions of introducing cysteine residues are Thr48 of exon 1 of TRAC*01 and Ser57 of exon 1 of TRBC2*01; the amino acid sequence of its α chain is the same as that of nucleotides. The sequences are shown in Fig. 4a and Fig. 4b, respectively, the amino acid sequence and nucleotide sequence of the β chain are shown in Fig. 5a and Fig. 5b, respectively, and the introduced cysteine residues are shown in bold and underlined letters. The target gene sequences of the above TCR α and β chains were synthesized and inserted into the expression vector pET28a+ (Novagene ), the upstream and downstream cloning sites are NcoI and NotI, respectively. The insert was confirmed by sequencing.

The expression vectors of TCR α and β chains were transformed into expressing bacteria BL21 (DE3) by chemical transformation, the bacteria were grown in LB medium, and induced with a final concentration of 0.5 mM IPTG at OD ₆₀₀ = 0.6, the α and β chains of TCR were expressed The inclusion bodies formed later were extracted by BugBuster Mix (Novagene) and washed repeatedly with BugBuster solution. The inclusion bodies were finally dissolved in 6M guanidine hydrochloride, 10mM dithiothreitol (DTT), 10mM ethylenediaminetetraacetic acid (EDTA). ) in 20 mM Tris (pH 8.1).

The dissolved TCRα and β chains were rapidly mixed in 5M urea, 0.4M arginine, 20mM Tris (pH 8.1), 3.7mM cystamine, 6.6mM β-mercapoethylamine (4°C) at a mass ratio of 1:1, the final concentration was 60 mg/mL. After mixing, the solution was dialyzed in 10 times the volume of deionized water (4°C), and after 12 hours, the deionized water was changed to buffer (20 mM Tris, pH 8.0) and dialyzed at 4°C for 12 hours. After the dialysis was completed, the solution was filtered through a 0.45 μM filter membrane and purified by an anion exchange column (HiTrap Q HP, 5 ml, GE Healthcare). The eluted peaks of TCR containing successfully renatured α and β dimers were confirmed by SDS-PAGE gel. The TCR was then further purified by gel filtration chromatography (HiPrep 16/60, Sephacryl S-100HR, GE Healthcare). The purity of the purified TCR was more than 90% determined by SDS-PAGE, and the concentration was determined by BCA method. Figure 6 shows the SDS-PAGE gel chart of the soluble TCR obtained by the present invention.

Example 4 Production of soluble single-chain TCR specific for NY-ESO-1 antigenic short peptide

According to the patent document WO2014/206304, the variable domains of TCRα and β chains in Example 2 were constructed into a stable soluble single-chain TCR molecule linked by a flexible short peptide (linker) by site-directed mutagenesis. The amino acid sequence and nucleotide sequence of the single-chain TCR molecule are shown in Figure 7a and Figure 7b, respectively. The amino acid sequence and nucleotide sequence of its α chain variable domain are shown in Figure 8a and Figure 8b, respectively; the amino acid sequence and nucleotide sequence of its β chain variable domain are shown in Figure 9a and Figure 9b, respectively; its linker The amino acid sequence and nucleotide sequence of the sequence are shown in Figure 10a and Figure 10b, respectively.

The target gene was double digested with NcoI and NotI, and then ligated with the pET28a vector that was double digested with NcoI and NotI. The ligation product was transformed into E.coli DH5α, coated with LB plate containing kanamycin, and cultured overnight at 37°C by inversion. The positive clones were picked for PCR screening, and the positive recombinants were sequenced. After confirming that the sequences were correct, the recombinant plasmids were extracted and transformed. to E.coliBL21(DE3) for expression.

Example 5 Expression, renaturation and purification of soluble single-chain TCR specific for NY-ESO-1 antigenic short peptide

All the BL21 (DE 3) colonies containing the recombinant plasmid pET28a-template chain prepared in Example 4 were inoculated into LB medium containing kanamycin, cultured at 37°C until OD600 was 0.6-0.8, and IPTG was added to the final concentration 0.5mM, and continue to culture at 37°C for 4h. The cell pellet was harvested by centrifugation at 5000 rpm for 15 min, the cell pellet was lysed with Bugbuster Master Mix (Merck), the inclusion body was recovered by centrifugation at 6000 rpm for 15 min, and then washed with Bugbuster (Merck) to remove cell debris and membrane components, and the inclusion body was collected by centrifugation at 6000 rpm for 15 min. body. The inclusion bodies were dissolved in buffer (20mM Tris-HCl pH 8.0, 8M urea), and insoluble matter was removed by high-speed centrifugation. The supernatant was quantified by BCA method, and then divided into packaging and stored at -80°C for later use.

To 5mg of dissolved single-chain TCR inclusion body protein, add 2.5mL buffer (6M Gua-HCl, 50mM Tris-HCl pH 8.1, 100mM NaCl, 10mM EDTA), then add DTT to a final concentration of 10mM, and treat at 37°C for 30min . The single-chain TCR after the above treatment was added dropwise to 125 mL of renaturation buffer (100 mM Tris-HCl pH 8.1, 0.4 M L-arginine, 5 M urea, 2 mM EDTA, 6.5 mM β-mercapthoethylamine, 1.87 mM Cystamine) with a syringe, Stir at 4 °C for 10 min, then put the renaturation solution into a cellulose membrane dialysis bag with a cut-off of 4 kDa, put the dialysis bag in 1 L of pre-cooled water, and slowly stir at 4 °C overnight. After 17 hours, the dialysate was replaced with 1 L of pre-cooled buffer (20 mM Tris-HCl pH 8.0), and dialysis was continued at 4°C for 8 h, and then the dialysate was replaced with the same fresh buffer and continued dialysis overnight. After 17 hours, the samples were filtered through a 0.45 μm filter membrane, degassed in vacuo and passed through an anion exchange column (HiTrap Q HP, GE Healthcare), and the protein was purified with a linear gradient of 0-1 M NaCl in 20 mM Tris-HCl pH 8.0, and collected. The eluted fractions were analyzed by SDS-PAGE, the fractions containing single-chain TCR were concentrated and further purified by gel filtration column (Superdex 7510/300, GE Healthcare), and the target fractions were also analyzed by SDS-PAGE.

The eluted fractions for BIAcore analysis were further tested for purity by gel filtration. The conditions are: chromatographic column Agilent Bio SEC-3 (300A, φ7.8×300mm), mobile phase is 150mM phosphate buffer, flow rate is 0.5mL/min, column temperature is 25°C, and ultraviolet detection wavelength is 214nm.

Figure 11 shows the SDS-PAGE gel image of the soluble single-chain TCR obtained by the present invention.

Example 6 Binding Characterization

BIAcore analysis

This example demonstrates that soluble TCR molecules of the invention are capable of specifically binding to the SLLMWITQC-HLA A0201 complex.

The binding activity of the TCR molecules obtained in Example 3 and Example 5 to the SLLMWITQC-HLA A0201 complex was detected using the BIAcore T200 real-time analysis system. Anti-streptavidin antibody (GenScript) was added to coupling buffer (10 mM sodium acetate buffer, pH 4.77), and the antibody was then immobilized on the chip surface by flowing through a CM5 chip preactivated with EDC and NHS , and finally blocked the unreacted activated surface with ethanolamine hydrochloric acid solution to complete the coupling process with a coupling level of about 15,000RU.

A low concentration of streptavidin was flowed over the surface of the chip that had been coated with the antibody, and then the SLLMWITQC-HLAA0201 complex was flowed through the detection channel, the other channel was used as a reference channel, and 0.05mM biotin was added at 10 μL/min. The flow rate was flowed through the chip for 2 min to block the remaining binding sites of streptavidin.

The preparation process of the above-mentioned SLLMWITQC-HLA A0201 complex is as follows:

a. Purification

Collect 100ml of E.coli bacteria that induces the expression of heavy or light chains, centrifuge at 8000g at 4°C for 10min, wash the cells once with 10ml PBS, and then use 5ml of BugBuster Master Mix Extraction Reagents (Merck) to vigorously shake the cells to resuspend the cells. Incubate with rotation at room temperature for 20 min, then centrifuge at 6000g for 15 min at 4°C, discard the supernatant, and collect the inclusion bodies.

Resuspend the above inclusions in 5ml of BugBuster Master Mix, and incubate at room temperature for 5min; add 30ml of BugBuster diluted 10 times, mix well, and centrifuge at 6000g at 4°C for 15min; discard the supernatant and add 30ml of BugBuster diluted 10 times to resuspend the inclusion bodies , Mix well, centrifuge at 6000g at 4°C for 15min, repeat twice, add 30ml of 20mM Tris-HCl pH 8.0 to resuspend the inclusion bodies, mix well, centrifuge at 6000g at 4°C for 15min, and finally dissolve the inclusion bodies with 20mM Tris-HCl 8M urea, SDS- The purity of inclusion bodies was detected by PAGE, and the concentration was determined by BCA kit.

b. Refolding

The synthetic short peptide SLLMWITQC (Beijing Saibaisheng Gene Technology Co., Ltd.) was dissolved in DMSO to a concentration of 20 mg/ml. The inclusion bodies of light and heavy chains were solubilized with 8M urea, 20mM Tris pH 8.0, 10mM DTT, and further denatured by adding 3M guanidine hydrochloride, 10mM sodium acetate, 10mM EDTA before renaturation. SLLMWITQC peptide was added to renaturation buffer (0.4M L-arginine, 100mM Tris pH 8.3, 2mM EDTA, 0.5mM oxidized glutathione, 5mM reduced glutathione, 0.2mM PMSF, cooled to 4°C), then add 20mg/L light chain and 90mg/L heavy chain in sequence (final concentration, heavy chain is added in three times, 8h/time), renaturation at 4°C for at least 3 days To complete, SDS-PAGE test whether the renaturation is successful.

c. Purification after renaturation

The renaturation buffer was exchanged by dialysis against 10 volumes of 20 mM Tris pH 8.0 at least twice to sufficiently reduce the ionic strength of the solution. After dialysis, the protein solution was filtered through a 0.45 μm cellulose acetate filter and loaded onto a HiTrap Q HP (GE) anion exchange column (5 ml bed volume). The protein was eluted using Akta purifier (GE), 0-400 mM NaCl linear gradient prepared in 20 mM Tris pH 8.0, pMHC was eluted at about 250 mM NaCl, the peak fractions were collected, and the purity was checked by SDS-PAGE.

d. Biotinylation

Purified pMHC molecules were concentrated with Millipore ultrafiltration tubes while buffer exchanged to 20 mM Tris pH 8.0, followed by addition of biotinylation reagents 0.05 M Bicine pH 8.3, 10 mM ATP, 10 mM MgOAc, 50 μM D-Biotin, 100 μg/ml BirA enzyme (GST-BirA), the mixture was incubated overnight at room temperature, and the complete biotinylation was detected by SDS-PAGE.

e. Purification of biotinylated complexes

The biotinylated pMHC molecules were concentrated to 1 ml with a Millipore ultrafiltration tube, and the biotinylated pMHC was purified by gel filtration chromatography. HiPrep was pre-equilibrated with filtered PBS using an Akta purifier (GE). A ^TM 16/60 S200HR column (GE) was loaded with 1 ml of concentrated biotinylated pMHC molecules and eluted with PBS at a flow rate of 1 ml/min. Biotinylated pMHC molecules eluted as a single peak at about 55 ml. The fractions containing protein were combined, concentrated with Millipore ultrafiltration tube, the protein concentration was determined by BCA method (Thermo), and the protease inhibitor cocktail (Roche) was added to store the biotinylated pMHC molecules in aliquots at -80°C.

Using the BIAcore Evaluation software to calculate the kinetic parameters, the kinetic spectra of the soluble TCR molecules of the present invention and the binding of the soluble single-chain TCR molecules constructed by the present invention to the SLLMWITQC-HLA A0201 complex are shown in Figure 12 and Figure 13, respectively. The map shows that both the soluble TCR molecules and the soluble single-chain TCR molecules obtained by the present invention can bind to the SLLMWITQC-HLA A0201 complex. At the same time, the above method was used to detect the binding activity of the soluble TCR molecule of the present invention to several other irrelevant antigen short peptides and HLA complexes, and the results showed that the TCR molecule of the present invention did not bind to other irrelevant antigens.

All documents mentioned herein are incorporated by reference in this application as if each document were individually incorporated by reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims (34)

1. A T Cell Receptor (TCR) capable of binding to the SLLMWITQC-HLA a0201 complex and wherein the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:

α CDR1- SIFNT (SEQ ID NO: 10)

α CDR2- LYKAGEL (SEQ ID NO: 11)

alpha CDR3-AGFMDSNYQLI (SEQ ID NO: 12); and

the 3 complementarity determining regions of the TCR β chain variable domain are:

β CDR1- SGHVS (SEQ ID NO: 13)

β CDR2- FQNEAQ (SEQ ID NO: 14)

β CDR3- ASSLGGSVLH (SEQ ID NO: 15)。

2. a TCR as claimed in claim 1 which comprises a TCR α chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1 and a TCR β chain variable domain; and/or the TCR β chain variable domain is identical to SEQ ID NO:5 an amino acid sequence having at least 90% sequence identity.

3. A TCR as claimed in claim 1 which comprises the amino acid sequence of the α chain variable domain SEQ id no: 1.

4. A TCR as claimed in claim 1 which comprises the β chain variable domain amino acid sequence SEQ id No. 5.

5. A TCR as claimed in claim 1 which is an α β heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.

6. A TCR as claimed in claim 1 in which the α chain amino acid sequence of the TCR is SEQ ID NO:3 and/or the beta chain amino acid sequence of the TCR is SEQ ID NO 7.

7. A TCR as claimed in any one of claims 1 to 5 which is soluble.

8. A TCR as claimed in claim 7 which is single chain.

9. A TCR as claimed in claim 8 which is formed by the α chain variable domain linked to the β chain variable domain by a peptide linker sequence.

10. A TCR as claimed in claim 8 wherein the amino acid sequence for the α chain variable domain of the TCR is as shown in SEQ ID NO. 32 and/or the amino acid sequence for the β chain variable domain of the TCR is as shown in SEQ ID NO. 34.

11. A TCR as claimed in claim 10 which has the amino acid sequence SEQ ID No. 30.

12. A TCR as claimed in claim 7 which comprises (a) all or part of the TCR α chain, excluding the transmembrane domain; and (b) all or part of a TCR β chain, excluding the transmembrane domain;

and (a) and (b) each comprise a functional variable domain.

13. A TCR as claimed in claim 12 wherein (a) and (b) each further comprise at least a portion of the constant domain of the TCR chain.

14. A TCR as claimed in claim 13 wherein the cysteine residues form an artificial disulphide bond between the α and β chain constant domains of the TCR.

15. A TCR as claimed in claim 14 wherein the cysteine residues which form the artificial disulphide bond in the TCR are substituted at one or more groups selected from:

thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;

tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;

ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;

arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;

pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and

tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.

16. A TCR as claimed in claim 15 wherein the α chain amino acid sequence of the TCR is SEQ ID No. 26 and/or the β chain amino acid sequence of the TCR is SEQ ID No. 28.

17. A TCR as claimed in claim 13 which comprises an artificial interchain disulphide bond between the α chain variable region and the β chain constant region of the TCR.

18. A TCR as claimed in claim 17 in which the cysteine residues which form the artificial interchain disulphide bond in the TCR are substituted at one or more groups selected from:

amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC2 x 01 exon 1; or

Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01.

19. A TCR as claimed in claim 17 which comprises the α chain variable domain and the β chain variable domain and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the α chain constant domain, the α chain variable domain of the TCR forming a heterodimer with the β chain.

20. A TCR as claimed in claim 1 wherein a conjugate is attached to the C-or N-terminus of the α and/or β chains of the TCR.

21. A TCR as claimed in claim 20 wherein the conjugate to which the TCR is bound is a detectable label, a therapeutic agent, a PK modifying moiety or a combination thereof.

22. A TCR as claimed in claim 21 wherein the therapeutic agent is an anti-CD 3 antibody.

23. A multivalent TCR complex comprising at least two TCR molecules, and wherein at least one TCR molecule is a TCR as claimed in any one of claims 1 to 22.

24. A nucleic acid molecule comprising a nucleic acid sequence encoding a TCR according to any one of claims 1 to 22, or the complement thereof.

25. The nucleic acid molecule of claim 24, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO: 33.

26. The nucleic acid molecule of claim 24 or 25, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:6 or SEQ ID NO 35.

27. The nucleic acid molecule of claim 24, comprising the nucleotide sequence encoding a TCR α chain of seq id NO:4 and/or comprises the nucleotide sequence encoding the TCR β chain SEQ ID NO: 8.

28. a vector comprising the nucleic acid molecule of any one of claims 24 to 27.

29. The vector of claim 28, wherein said vector is a viral vector.

30. The vector of claim 29, wherein said vector is a lentiviral vector.

31. An isolated host cell comprising the vector or chromosome of any one of claims 28-30 and wherein the exogenous nucleic acid molecule of any one of claims 24-27 is integrated into the host cell.

32. A T cell transduced with the nucleic acid molecule of any one of claims 24 to 27 or the vector of any one of claims 28 to 30.

33. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to any one of claims 1 to 22, a TCR complex according to claim 23 or a cell according to claim 32.

34. Use of a TCR as claimed in any one of claims 1 to 22 or a TCR complex as claimed in claim 23 or a cell as claimed in claim 32 in the manufacture of a medicament for the treatment of a tumour.

Images