CN106749620B - T cell receptor for recognizing MAGE-A1 antigen short peptide - Google Patents

Abstract

The present invention provides a T Cell Receptor (TCR) capable of specifically binding short peptide KVLEYVIKV derived from MAGE-a1 antigen, which antigen short peptide KVLEYVIKV can form a complex with HLA a0201 and be presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Description

T cell receptor for recognizing MAGE-A1 antigen short peptide

Technical Field

The present invention relates to TCRs capable of recognizing short peptides derived from the MAGE-a1 antigen, to MAGE-a1 specific T cells obtained by transducing such TCRs, and to their use in the prevention and treatment of MAGE-a1 related diseases.

Background

MAGE-a1, an endogenous tumor antigen, is degraded into small polypeptides after intracellular production and is presented on the cell surface as a complex with MHC (major histocompatibility complex) molecules. Studies have shown that KVLEYVIKV is a short peptide derived from MAGE-A1. MAGE-a1 protein is expressed in a variety of tumor types, including melanoma, as well as other solid tumors such as gastric, lung, esophageal, bladder, head and neck squamous cell carcinoma, and the like. For the treatment of the above diseases, chemotherapy, radiotherapy and the like can be used, but both of them cause damages to normal cells themselves.

T cell adoptive immunotherapy is the transfer of reactive T cells specific for a target cell antigen into a patient to act on the target cell. The T Cell Receptor (TCR) is a membrane protein on the surface of T cells that recognizes a corresponding short peptide antigen on the surface of a target cell. In the immune system, the direct physical contact between T cells and Antigen Presenting Cells (APC) is initiated by the binding of antigen short peptide specific TCR and short peptide-major histocompatibility complex (pMHC complex), and then other cell membrane surface molecules of the T cells and APC interact to cause a series of subsequent cell signaling and other physiological reactions, so that T cells with different antigen specificities exert immune effects on their target cells. Therefore, those skilled in the art have focused on isolating a TCR specific for the short peptide of the MAGE-a1 antigen and transducing the TCR into T cells to obtain T cells specific for the short peptide of the MAGE-a1 antigen, thereby enabling them to function in cellular immunotherapy.

Disclosure of Invention

The invention aims to provide a T cell receptor for recognizing MAGE-A1 antigen short peptide.

In a first aspect of the invention, there is provided a T Cell Receptor (TCR) capable of binding to the KVLEYVIKV-HLAA0201 complex.

In another preferred embodiment, the TCR comprises a TCR alpha chain variable domain and a TCR beta chain variable domain, the amino acid sequence of CDR3 of the TCR alpha chain variable domain is AFPSGGGADGLT (SEQ ID NO: 12); and/or the amino acid sequence of CDR3 of the variable domain of the TCR beta chain is ASSVEGYPSYEQY (SEQ ID NO: 15).

In another preferred embodiment, the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:

αCDR1-SSNFYA (SEQ ID NO:10)

αCDR2-MTLNGDE (SEQ ID NO:11)

alpha CDR3-AFPSGGGADGLT (SEQ ID NO: 12); and/or

The 3 complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGDLS (SEQ ID NO:13)

βCDR2-YYNGEE (SEQ ID NO:14)

βCDR3-ASSVEGYPSYEQY (SEQ ID NO:15)。

in another preferred embodiment, the TCR comprises a TCR alpha chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1, and a TCR beta chain variable domain; and/or the TCR β chain variable domain is identical to SEQ ID NO:5 an amino acid sequence having at least 90% sequence identity.

In another preferred embodiment, the TCR comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1.

In another preferred embodiment, the TCR comprises the beta chain variable domain amino acid sequence SEQ ID NO 5.

In another preferred embodiment, the TCR is an α β heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.

In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO:3 and/or the beta chain amino acid sequence of the TCR is SEQ ID NO 7.

In another preferred embodiment, the TCR is soluble.

In another preferred embodiment, the TCR is single chain.

In another preferred embodiment, the TCR is formed by linking an α chain variable domain to a β chain variable domain via a peptide linker.

In another preferred embodiment, the TCR has one or more mutations in amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 of the α chain variable region, and/or in the penultimate 3-, 5-, or 7-position of the short peptide amino acid of the α chain J gene; and/or the TCR has one or more mutations in beta chain variable region amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 th, and/or beta chain J gene short peptide amino acid penultimate 2,4 or 6 th, wherein the amino acid position numbering is according to the position numbering listed in IMGT (international immunogenetic information system).

In another preferred embodiment, the α chain variable domain amino acid sequence of the TCR comprises SEQ ID NO 32 and/or the β chain variable domain amino acid sequence of the TCR comprises SEQ ID NO 34.

In another preferred embodiment, the amino acid sequence of the TCR is SEQ ID NO 30.

In another preferred embodiment, the TCR comprises (a) all or part of a TCR α chain, excluding the transmembrane domain; and (b) all or part of a TCR β chain, excluding the transmembrane domain;

and (a) and (b) each comprise a functional variable domain, or comprise a functional variable domain and at least a portion of the TCR chain constant domain.

In another preferred embodiment, the cysteine residues form an artificial disulfide bond between the alpha and beta chain constant domains of the TCR.

In another preferred embodiment, the cysteine residues forming the artificial disulfide bond in the TCR are substituted at one or more groups of sites selected from the group consisting of:

thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;

tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC 2x 01;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;

ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;

arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;

pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and

tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.

In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO 26 and/or the β chain amino acid sequence of the TCR is SEQ ID NO 28.

In another preferred embodiment, the TCR comprises an artificial interchain disulfide bond between the α chain variable region and the β chain constant region.

In another preferred embodiment, the cysteine residues that form the artificial interchain disulfide bond in the TCR replace one or more groups of sites selected from the group consisting of:

amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01;

amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC 2x 01;

amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC 2x 01 exon 1; or

Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01.

In another preferred embodiment, the TCR comprises an alpha chain variable domain and a beta chain variable domain and all or part of the beta chain constant domain, excluding the transmembrane domain, but which does not comprise an alpha chain constant domain, the alpha chain variable domain of the TCR forming a heterodimer with the beta chain.

In another preferred embodiment, the TCR has a conjugate attached to the C-or N-terminus of the alpha and/or beta chain.

In another preferred embodiment, the conjugate that binds to the T cell receptor is a detectable label, a therapeutic agent, a PK modifying moiety or a combination of any of these. Preferably, the therapeutic agent is an anti-CD 3 antibody.

In a second aspect of the invention, there is provided a multivalent TCR complex comprising at least two TCR molecules, and wherein at least one of the TCR molecules is a TCR according to the first aspect of the invention.

In a third aspect of the invention, there is provided a nucleic acid molecule comprising a nucleic acid sequence encoding a TCR molecule according to the first aspect of the invention, or the complement thereof.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence encoding the variable domain of the TCR α chain SEQ ID NO:2 or SEQ ID NO: 33.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence of SEQ id no:6 or SEQ ID NO 35.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence encoding the TCR α chain SEQ ID NO:4 and/or comprises the nucleotide sequence encoding the TCR β chain SEQ ID NO: 8.

in a fourth aspect of the invention, there is provided a vector comprising a nucleic acid molecule according to the third aspect of the invention; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector.

In a fifth aspect of the invention, there is provided an isolated host cell comprising a vector according to the fourth aspect of the invention or a genome into which has been integrated an exogenous nucleic acid molecule according to the third aspect of the invention.

In a sixth aspect of the invention, there is provided a cell which transduces a nucleic acid molecule according to the third aspect of the invention or a vector according to the fourth aspect of the invention; preferably, the cell is a T cell or a stem cell.

In a seventh aspect of the invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to the first aspect of the invention, a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention.

In an eighth aspect, the invention provides the use of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, for the manufacture of a medicament for the treatment of a tumour or an autoimmune disease.

In a ninth aspect of the invention, there is provided a method of treating a disease comprising administering to a subject in need thereof an amount of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, or a pharmaceutical composition according to the seventh aspect of the invention;

preferably, the disease is a tumor, preferably the tumor comprises melanoma, as well as other solid tumors such as gastric cancer, lung cancer, esophageal cancer, bladder cancer, head and neck squamous cell carcinoma, prostate cancer, breast cancer, colon cancer, ovarian cancer, and the like.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1a, FIG. 1b, FIG. 1c, FIG. 1d, FIG. 1e and FIG. 1f are the amino acid sequence of the TCR α chain variable domain, the nucleotide sequence of the TCR α chain variable domain, the amino acid sequence of the TCR α chain, the nucleotide sequence of the TCR α chain, the amino acid sequence of the TCR α chain with leader sequence and the nucleotide sequence of the TCR α chain with leader sequence, respectively.

Fig. 2a, fig. 2b, fig. 2c, fig. 2d, fig. 2e and fig. 2f are a TCR β chain variable domain amino acid sequence, a TCR β chain variable domain nucleotide sequence, a TCR β chain amino acid sequence, a TCR β chain nucleotide sequence, a TCR β chain amino acid sequence with a leader sequence and a TCR β chain nucleotide sequence with a leader sequence, respectively.

FIG. 3 is CD8 of monoclonal cells⁺And tetramer-PE double positive staining results.

Fig. 4a and 4b are the amino acid and nucleotide sequences, respectively, of a soluble TCR α chain.

Fig. 5a and 5b are the amino acid and nucleotide sequences, respectively, of a soluble TCR β chain.

Figure 6 is a gel diagram of the soluble TCR obtained after purification. The leftmost lane is reducing gel, the middle lane is molecular weight marker (marker), and the rightmost lane is non-reducing gel.

FIGS. 7a and 7b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR.

FIGS. 8a and 8b are the amino acid and nucleotide sequences, respectively, of a single chain TCR α chain.

Fig. 9a and 9b are the amino acid and nucleotide sequences, respectively, of a single chain TCR β chain.

FIGS. 10a and 10b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR linker sequence (linker).

FIG. 11 is a gel diagram of the soluble single chain TCR obtained after purification. The left lane is the molecular weight marker (marker) and the right lane is the non-reducing gel.

FIG. 12 is a ForteBio kinetic profile of soluble TCR of the invention binding to KVLEYVIKV-HLA A0201 complex.

FIG. 13 is a BIAcore kinetic profile of binding of soluble single chain TCRs of the invention to KVLEYVIKV- -HLA A0201 complex.

FIG. 14 shows the results of an experiment for the activation of effector cells transduced with a TCR of the invention.

FIG. 15 shows the results of a killing experiment of effector cells transduced with a TCR of the invention.

Detailed Description

The present inventors have made extensive and intensive studies to find a TCR capable of specifically binding to MAGE-A1 antigen short peptide KVLEYVIKV (SEQ ID NO:9), which antigen short peptide KVLEYVIKV can form a complex with HLA A0201 and be presented on the cell surface together. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Term(s) for

MHC molecules are proteins of the immunoglobulin superfamily, which may be MHC class I or class II molecules. Therefore, it is specific for antigen presentation, different individuals have different MHC, and different short peptides in one protein antigen can be presented on the cell surface of respective APC. Human MHC is commonly referred to as an HLA gene or HLA complex.

The T Cell Receptor (TCR), is the only receptor for a specific antigenic peptide presented on the Major Histocompatibility Complex (MHC). In the immune system, direct physical contact between T cells and Antigen Presenting Cells (APCs) is initiated by the binding of antigen-specific TCRs to pMHC complexes, and then other cell membrane surface molecules of both T cells and APCs interact, which causes a series of subsequent cell signaling and other physiological reactions, thereby allowing T cells of different antigen specificities to exert immune effects on their target cells.

TCRs are cell membrane surface glycoproteins that exist as heterodimers from either the α/β or γ chains. In 95% of T cells the TCR heterodimer consists of α and β chains, while 5% of T cells have a TCR consisting of γ and chains. Native α β heterodimeric TCRs have an α chain and a β chain, which constitute subunits of an α β heterodimeric TCR. Broadly, each of the α and β chains comprises a variable region, a linker region and a constant region, and the β chain also typically contains a short diversity region between the variable region and the linker region, but the diversity region is often considered to be part of the linker region. Each variable region comprises 3 CDRs (complementarity determining regions) CDR1, CDR2 and CDR3, which are chimeric in framework structures (framework regions). The CDR regions determine the binding of the TCR to the pMHC complex, where CDR3 is recombined from variable and connecting regions, referred to as hypervariable regions. The α and β chains of a TCR are generally regarded as having two "domains" each, namely a variable domain and a constant domain, the variable domain being made up of linked variable regions and linking regions. The sequences of TCR constant domains can be found in public databases of the international immunogenetic information system (IMGT), such as the constant domain sequence of the α chain of the TCR molecule is "TRAC 01", the constant domain sequence of the β chain of the TCR molecule is "TRBC 1 01" or "TRBC 2 01". In addition, the α and β chains of the TCR also comprise a transmembrane region and a cytoplasmic region, the cytoplasmic region being very short.

In the present invention, the terms "polypeptide of the invention", "TCR of the invention", "T cell receptor of the invention" are used interchangeably.

Natural interchain disulfide bond and artificial interchain disulfide bond

A set of disulfide bonds, referred to herein as "native interchain disulfide bonds," exist between the C α and C β chains of the membrane proximal region of native TCRs. In the present invention, the artificially introduced interchain covalent disulfide bond whose position is different from that of the natural interchain disulfide bond is referred to as an "artificial interchain disulfide bond".

For convenience of description of the positions of disulfide bonds, the positions of the amino acid sequences of TRAC 01 and TRBC1 × 01 or TRBC2 × 01 are numbered in the order from the N-terminus to the C-terminus, such as in TRBC1 × 01 or TRBC2 × 01, and the 60 th amino acid in the order from the N-terminus to the C-terminus is P (proline), and thus in the present invention it can be described as Pro60 of TRBC1 × 01 or TRBC2 × 01 exon 1, and also as the 60 th amino acid of TRBC1 × 01 or TRBC2 × 01 exon 1, and as in 737bc 3 × 01 or TRBC2 × 01, and the 61 th amino acid in the order from the N-terminus to the C-terminus is Q (glutamine), and thus in the present invention it can be described as TRBC1 × 01 or TRBC 6301 × 01, or TRBC 8501, and similarly as TRBC 8261 or glbc 891. In the present invention, the position numbering of the amino acid sequences of the variable regions TRAV and TRBV follows the position numbering listed in IMGT. If an amino acid in TRAV, the position listed in IMGT is numbered 46, it is described herein as the 46 th amino acid of TRAV, and so on. In the present invention, the sequence position numbers of other amino acids are specifically described.

Detailed Description

TCR molecules

During antigen processing, antigens are degraded within cells and then carried to the cell surface by MHC molecules. T cell receptors are capable of recognizing peptide-MHC complexes on the surface of antigen presenting cells. Accordingly, a first aspect of the invention provides a TCR molecule capable of binding KVLEYVIKV-HLA a0201 complex. Preferably, the TCR molecule is isolated or purified. The α and β chains of the TCR each have 3 Complementarity Determining Regions (CDRs).

In a preferred embodiment of the invention, the α chain of the TCR comprises CDRs having the amino acid sequence:

αCDR1-SSNFYA (SEQ ID NO:10)

αCDR2-MTLNGDE (SEQ ID NO:11)

alpha CDR3-AFPSGGGADGLT (SEQ ID NO: 12); and/or

The 3 complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGDLS (SEQ ID NO:13)

βCDR2-YYNGEE (SEQ ID NO:14)

βCDR3-ASSVEGYPSYEQY (SEQ ID NO:15)。

chimeric TCRs can be prepared by embedding the above-described amino acid sequences of the CDR regions of the invention into any suitable framework. One skilled in the art can design or synthesize a TCR molecule with the corresponding function based on the CDR regions disclosed herein, so long as the framework structure is compatible with the CDR regions of the TCR of the invention. Thus, the TCR molecules of the invention are those which comprise the above-described α and/or β chain CDR region sequences and any suitable framework structure. The TCR α chain variable domain of the invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID No. 1; and/or the TCR β chain variable domain of the invention is a variant of SEQ ID NO:5, having at least 90%, preferably 95%, more preferably 98% sequence identity.

In a preferred embodiment of the invention, the TCR molecules of the invention are heterodimers consisting of α and β chains. In particular, in one aspect the α chain of the heterodimeric TCR molecules comprises a variable domain and a constant domain, the α chain variable domain amino acid sequence comprising CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) of the above-described α chain. Preferably, the TCR molecule comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1. More preferably, the amino acid sequence of the α chain variable domain of the TCR molecule is SEQ ID NO 1. In another aspect, the β chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, and the β chain variable domain amino acid sequence comprises CDR1(SEQ ID NO:13), CDR2(SEQ ID NO: 14), and CDR3(SEQ ID NO:15) of the above-described β chain. Preferably, the TCR molecule comprises the beta chain variable domain amino acid sequence SEQ ID NO 5. More preferably, the amino acid sequence of the β chain variable domain of the TCR molecule is SEQ ID NO 5.

In a preferred embodiment of the invention, the TCR molecules of the invention are single chain TCR molecules consisting of part or all of the α chain and/or part or all of the β chain. Single chain TCR molecules are described in Chung et al (1994) Proc. Natl. Acad. Sci. USA 91, 12654-. From the literature, those skilled in the art are readily able to construct single chain TCR molecules comprising the CDRs regions of the invention. In particular, the single chain TCR molecule comprises V α, V β and C β, preferably linked in order from N-terminus to C-terminus.

The alpha chain variable domain amino acid sequence of the single chain TCR molecule comprises the CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) of the alpha chain described above. Preferably, the single chain TCR molecule comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1. More preferably, the α chain variable domain amino acid sequence of the single chain TCR molecule is SEQ ID NO 1. The amino acid sequence of the beta chain variable domain of the single chain TCR molecule comprises the CDR1(SEQ ID NO:13), CDR2(SEQ ID NO: 14) and CDR3(SEQ ID NO:15) of the above-described beta chain. Preferably, the single chain TCR molecule comprises the beta chain variable domain amino acid sequence SEQ ID NO 5. More preferably, the amino acid sequence of the β chain variable domain of the single chain TCR molecule is SEQ ID NO 5.

In a preferred embodiment of the invention, the constant domain of the TCR molecules of the invention is a human constant domain. The human constant domain amino acid sequences are known to those skilled in the art or can be obtained by consulting published databases of relevant books or IMGT (international immunogenetic information system). For example, the constant domain sequence of the α chain of the TCR molecules of the invention can be "TRAC 01", and the constant domain sequence of the β chain of the TCR molecules can be "TRBC 1 01" or "TRBC 2 01". Arg at position 53 of the amino acid sequence given in TRAC 01 of IMGT, here denoted: TRAC × 01 Arg53 of exon 1, and so on. Preferably, the amino acid sequence of the α chain of the TCR molecule of the invention is SEQ ID NO 3 and/or the amino acid sequence of the β chain is SEQ ID NO 7.

Naturally occurring TCRs are membrane proteins that are stabilized by their transmembrane regions. Like immunoglobulins (antibodies) as antigen recognition molecules, TCRs can also be developed for diagnostic and therapeutic applications, where soluble TCR molecules are required. Soluble TCR molecules do not include their transmembrane regions. Soluble TCRs have a wide range of uses, not only for studying the interaction of TCRs with pmhcs, but also as diagnostic tools for detecting infections or as markers for autoimmune diseases. Similarly, soluble TCRs can be used to deliver therapeutic agents (e.g., cytotoxic or immunostimulatory compounds) to cells presenting a specific antigen, and in addition, soluble TCRs can be conjugated to other molecules (e.g., anti-CD 3 antibodies) to redirect T cells to target them to cells presenting a particular antigen. Soluble TCRs specific for the MAGE-a1 antigen short peptide were also obtained by the present invention.

To obtain a soluble TCR, in one aspect, the inventive TCR may be one in which an artificial disulfide bond is introduced between residues of the constant domains of its alpha and beta chains. Cysteine residues form an artificial interchain disulfide bond between the alpha and beta chain constant domains of the TCR. Cysteine residues may be substituted for other amino acid residues at appropriate positions in native TCRs to form artificial interchain disulfide bonds. For example, a disulfide bond is formed by substituting Thr48 of exon 1 of TRAC × 01 and a cysteine residue of Ser57 of exon 1 of TRBC1 × 01 or TRBC2 × 01. Other sites for introducing cysteine residues to form disulfide bonds may also be: thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1; tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC 2x 01; thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1; ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1; arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1; pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; or Tyr10 and TRBC1 and 01 of TRAC 01 exon 1 or Glu20 of TRBC2 and 01 exon 1. I.e., a cysteine residue, in place of any of the above-described alpha and beta chain constant domains. The TCR constant domains of the invention may be truncated at one or more of their C-termini by up to 50, or up to 30, or up to 15, or up to 10, or up to 8 or fewer amino acids, so as not to include a cysteine residue for the purpose of deleting the native disulphide bond, or by mutating the cysteine residue forming the native disulphide bond to another amino acid.

As described above, the TCRs of the invention may comprise artificial disulfide bonds introduced between residues of the constant domains of their alpha and beta chains. It should be noted that the TCRs of the invention may each contain both TRAC constant domain sequences and TRBC1 or TRBC2 constant domain sequences, with or without the artificial disulfide bonds introduced as described above between the constant domains. The TRAC constant domain sequence and TRBC1 or TRBC2 constant domain sequences of the TCR may be linked by the native disulfide bond present in the TCR.

To obtain a soluble TCR, on the other hand, the inventive TCR also comprises a TCR having a mutation in its hydrophobic core region, preferably a mutation that enables an improved stability of the inventive soluble TCR, as described in the patent publication WO 2014/206304. Such TCRs may be mutated at the following variable domain hydrophobic core positions: (alpha and/or beta chain) variable region amino acid positions 11, 13, 19, 21, 53, 76, 89, 91, 94, and/or positions 3,5,7 of the reciprocal amino acid position of the short peptide of the alpha chain J gene (TRAJ), and/or positions 2,4,6 of the reciprocal amino acid position of the short peptide of the beta chain J gene (TRBJ), wherein the position numbering of the amino acid sequence is according to the position numbering listed in the International immunogenetic information System (IMGT). The above-mentioned international system of immunogenetics information is known to the skilled person and the position numbering of the amino acid residues of the different TCRs in IMGT can be derived from this database.

The TCR with the mutated hydrophobic core region of the invention can be a stable soluble single chain TCR formed by connecting the variable domains of the alpha and beta chains of the TCR by a flexible peptide chain. It should be noted that the flexible peptide chain of the present invention can be any peptide chain suitable for linking the TCR α and β chain variable domains. The single-chain soluble TCR constructed as in example 4 of the invention has an alpha chain variable domain amino acid sequence of SEQ ID NO. 32 and an encoded nucleotide sequence of SEQ ID NO. 33; the amino acid sequence of the beta chain variable domain is SEQ ID NO. 34, and the coded nucleotide sequence is SEQ ID NO. 35.

In addition, for stability, patent document 201510260322.4 also discloses that the introduction of an artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR can significantly improve the stability of the TCR. Thus, the high affinity TCRs of the invention may also contain an artificial interchain disulfide bond between the α chain variable region and the β chain constant region. Specifically, the cysteine residues that form the artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR are substituted for: amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01; amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC 2x 01; amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC 2x 01 exon 1; or amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01. Preferably, such a TCR may comprise (i) all or part of a TCR α chain, excluding its transmembrane domain, and (ii) all or part of a TCR β chain, excluding its transmembrane domain, wherein (i) and (ii) both comprise the variable domain and at least part of the constant domain of the TCR chain, the α chain forming a heterodimer with the β chain. More preferably, such a TCR may comprise the a chain variable domain and the β chain variable domain and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the a chain constant domain, the a chain variable domain of the TCR forming a heterodimer with the β chain.

The TCRs of the invention may also be provided in the form of multivalent complexes. Multivalent TCR complexes of the invention comprise polymers formed by association of two, three, four or more TCRs of the invention, such as might be produced as a tetramer using the tetrameric domain of p53, or a complex formed by association of a plurality of TCRs of the invention with another molecule. The TCR complexes of the invention can be used to track or target cells presenting a particular antigen in vitro or in vivo, and can also be used to generate intermediates for other multivalent TCR complexes having such applications.

The TCRs of the invention may be used alone or in covalent or other association, preferably covalently, with a conjugate. The conjugates include a detectable label (for diagnostic purposes, wherein the TCR is used to detect the presence of cells presenting the KVLEYVIKV-HLA a0201 complex), a therapeutic agent, a PK (protein kinase) modifying moiety, or a combination of any of the above.

Detectable labels for diagnostic purposes include, but are not limited to: a fluorescent or luminescent label, a radioactive label, an MRI (magnetic resonance imaging) or CT (computed tomography) contrast agent, or an enzyme capable of producing a detectable product.

Therapeutic agents that may be associated or conjugated with the TCRs of the invention include, but are not limited to: 1. radionuclides (Koppe et al, 2005, Cancer metastasis reviews (Cancer metastasis) 24, 539); 2. biological toxins (Chaudhary et al, 1989, Nature 339, 394; Epel et al, 2002, Cancer Immunology and immunotherapy 51, 565); 3. cytokines such as IL-2 and the like (Gillies et al, 1992, Proc. Natl. Acad. Sci. USA (PNAS)89, 1428; Card et al, 2004, Cancer Immunology and immunotherapy (Cancer Immunology and Immunotherapy)53, 345; Halin et al, 2003, Cancer Research (Cancer Research)63, 3202); 4. antibody Fc fragment (Mosquera et al, 2005, Journal Of Immunology 174, 4381); 5. antibody scFv fragments (Zhu et al, 1995, International Journal of Cancer 62,319); 6. gold nanoparticles/nanorods (Lapotko et al, 2005, Cancer letters 239, 36; Huang et al, 2006, Journal of the American Chemical Society 128, 2115); 7. viral particles (Peng et al, 2004, Gene therapy 11, 1234); 8. liposomes (Mamot et al, 2005, Cancer research 65, 11631); 9. nano magnetic particles; 10. prodrug activating enzymes (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 11. chemotherapeutic agents (e.g., cisplatin) or nanoparticles in any form, and the like.

In addition, the TCRs of the invention may also be hybrid TCRs comprising sequences derived from more than one species. For example, studies have shown that murine TCRs are more efficiently expressed in human T cells than human TCRs. Thus, the inventive TCR may comprise a human variable domain and a murine constant domain. The drawback of this approach is the possibility of eliciting an immune response. Thus, there should be a regulatory regimen to immunosuppresse when it is used for adoptive T cell therapy to allow for the engraftment of murine expressing T cells.

It should be understood that the amino acid names herein are expressed in terms of international single-letter or three-letter english letters, and the single-letter english letter and three-letter english letters of the amino acid names correspond to the following relationships: ala (A), Arg (R), Asn (N), Asp (D), Cys (C), Gln (Q), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y) and Val (V).

Nucleic acid molecules

A second aspect of the invention provides a nucleic acid molecule encoding a TCR molecule of the first aspect of the invention or a portion thereof, which may be one or more CDRs, variable domains of the alpha and/or beta chains, and the alpha and/or beta chains.

The nucleotide sequence encoding the α chain CDR regions of the TCR molecules of the first aspect of the invention is as follows:

αCDR1-tccagcaatttttatgcc(SEQ ID NO:16)

αCDR2-atgactttaaatggggatgaa(SEQ ID NO:17)

αCDR3-gccttcccttcaggaggaggtgctgacggactcacc(SEQ ID NO:18)

the nucleotide sequence encoding the β chain CDR regions of the TCR molecules of the first aspect of the invention is as follows:

βCDR1-tctggagacctctct(SEQ ID NO:19)

βCDR2-tattataatggagaagag(SEQ ID NO:20)

βCDR3-gccagcagcgtagaaggctacccctcctacgagcagtac(SEQ ID NO:21)

thus, the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR alpha chain of the invention comprises SEQ ID NO 16, SEQ ID NO 17 and SEQ ID NO 18 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR beta chain of the invention comprises SEQ ID NO 19, SEQ ID NO 20 and SEQ ID NO 21.

The nucleotide sequence of the nucleic acid molecule of the invention may be single-stranded or double-stranded, the nucleic acid molecule may be RNA or DNA, and may or may not comprise an intron. Preferably, the nucleotide sequence of the nucleic acid molecule of the invention does not comprise introns but is capable of encoding a polypeptide of the invention, e.g. the nucleotide sequence of the nucleic acid molecule of the invention encoding a TCR alpha chain variable domain of the invention comprises SEQ ID NO 2 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding a TCR beta chain variable domain of the invention comprises SEQ ID NO 6. Alternatively, the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR α chain variable domain of the invention comprises SEQ ID NO 33 and/or the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR β chain variable domain of the invention comprises SEQ ID NO 35. More preferably, the nucleotide sequence of the nucleic acid molecule of the invention comprises SEQ ID NO. 4 and/or SEQ ID NO. 8. Alternatively, the nucleotide sequence of the nucleic acid molecule of the invention is SEQ ID NO. 31.

It will be appreciated that, due to the degeneracy of the genetic code, different nucleotide sequences may encode the same polypeptide. Thus, the nucleic acid sequence encoding the TCR of the present invention may be identical to or a degenerate variant of the nucleic acid sequences shown in the figures of the present invention. As illustrated by one of the examples herein, a "degenerate variant" refers to a nucleic acid sequence that encodes a protein sequence having SEQ ID NO. 1, but differs from the sequence of SEQ ID NO. 2.

The nucleotide sequence may be codon optimized. Different cells differ in the utilization of specific codons, and the expression level can be increased by changing the codons in the sequence according to the type of the cell. Codon usage tables for mammalian cells as well as for various other organisms are well known to those skilled in the art.

The full-length sequence of the nucleic acid molecule of the present invention or a fragment thereof can be obtained by, but not limited to, PCR amplification, recombination, or artificial synthesis. At present, DNA sequences encoding the TCRs of the invention (or fragments or derivatives thereof) have been obtained entirely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. The DNA may be the coding strand or the non-coding strand.

Carrier

The invention also relates to vectors comprising the nucleic acid molecules of the invention, including expression vectors, i.e. constructs capable of expression in vivo or in vitro. Commonly used vectors include bacterial plasmids, bacteriophages and animal and plant viruses.

Viral delivery systems include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, baculoviral vectors.

Preferably, the vector can transfer the nucleotide of the invention into a cell, for example a T cell, such that the cell expresses a TCR specific for the MAGE-a1 antigen. Ideally, the vector should be capable of sustained high level expression in T cells.

Cells

The invention also relates to genetically engineered host cells that have been engineered with the vectors or coding sequences of the invention. The host cell comprises a vector of the invention or has integrated into its chromosome a nucleic acid molecule of the invention. The host cell is selected from: prokaryotic and eukaryotic cells, such as E.coli, yeast cells, CHO cells, and the like.

In addition, the invention also includes isolated cells, particularly T cells, that express the TCRs of the invention. The T cell may be derived from a T cell isolated from a subject, or may be part of a mixed population of cells isolated from a subject, such as a population of Peripheral Blood Lymphocytes (PBLs). For example, the cells may be isolated from Peripheral Blood Mononuclear Cells (PBMC), which may be CD4⁺Helper T cell or CD8⁺Cytotoxic T cells. The cell may be in CD4⁺Helper T cell/CD 8⁺A mixed population of cytotoxic T cells. Generally, the cells can be activated with an antibody (e.g., an anti-CD 3 or anti-CD 28 antibody) to render them more amenable to transfection, e.g., transfection with a vector comprising a nucleotide sequence encoding a TCR molecule of the invention.

Alternatively, the cell of the invention may also be or be derived from a stem cell, such as a Hematopoietic Stem Cell (HSC). Gene transfer to HSCs does not result in TCR expression on the cell surface, since the CD3 molecule is not expressed on the stem cell surface. However, when stem cells differentiate into lymphoid precursors (lymphoid precursors) that migrate to the thymus, expression of the CD3 molecule will initiate expression of the introduced TCR molecule on the surface of the thymocytes.

There are many methods suitable for T cell transfection using DNA or RNA encoding the TCR of the invention (e.g., Robbins et al, (2008) J.Immunol.180: 6116-. T cells expressing the TCRs of the invention may be used for adoptive immunotherapy. Those skilled in the art will be able to recognize many suitable methods for adoptive therapy (e.g., Rosenberg et al, (2008) Nat Revcancer8 (4): 299-308).

MAGE-A1 antigen-related diseases

The invention also relates to a method of treating and/or preventing a disease associated with MAGE-a1 in a subject, comprising the step of adoptively transferring MAGE-a1 specific T cells to the subject. The MAGE-A1-specific T cells recognize the KVLEYVIKV-HLA A0201 complex.

The T cells specific for MAGE-A1 of the invention can be used to treat any MAGE-A1 related disease that presents the MAGE-A1 antigen short peptide KVLEYVIKV-HLA A0201 complex. Including but not limited to tumors such as melanoma, and other solid tumors such as gastric cancer, lung cancer, esophageal cancer, bladder cancer, head and neck squamous cell carcinoma, prostate cancer, breast cancer, colon cancer, ovarian cancer, and the like.

Method of treatment

Treatment may be effected by isolating T cells from patients or volunteers suffering from a disease associated with the MAGE-A1 antigen and introducing the TCR of the invention into such T cells, followed by reinfusion of these genetically engineered cells into the patient. Accordingly, the present invention provides a method of treating a disease associated with MAGE-a1 comprising infusing into a patient isolated T cells expressing a TCR of the invention, preferably the T cells are derived from the patient themselves. Generally, this involves (1) isolating T cells from the patient, (2) transducing T cells in vitro with a nucleic acid molecule of the invention or a nucleic acid molecule capable of encoding a TCR molecule of the invention, and (3) infusing the genetically modified T cells into the patient. The number of cells isolated, transfected and transfused can be determined by a physician.

The main advantages of the invention are:

(1) the inventive TCR can be combined with MAGE-A1 antigen short peptide complex KVLEYVIKV-HLA A0201, and the cells transduced with the inventive TCR can be specifically activated and has strong killing effect on target cells.

The following specific examples further illustrate the invention. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not indicated in the following examples, are generally carried out according to conventional conditions, for example as described in Sambrook and Russell et al, Molecular Cloning: A laboratory Manual (third edition) (2001) CSHL Press, or according to the conditions as recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

EXAMPLE 1 cloning of MAGE-A1 antigen short peptide-specific T cells

Peripheral Blood Lymphocytes (PBLs) from healthy volunteers of genotype HLA-A0201 were stimulated with synthetic short peptide KVLEYVIKV (SEQ ID NO.: 9; Baisheng Gene technologies, Inc., Beijing Sai). KVLEYVIKV short peptide and HLA-A0201 with biotin label are renatured to prepare pHLA haploid. These haploids were combined with streptavidin labeled with PE (BD Co.) to form PE-labeled tetramers, which were sorted for double positive anti-CD 8-APC cells. The sorted cells were expanded and subjected to secondary sorting as described above, followed by single cloning by limiting dilution. Monoclonal cells were stained with tetramer and double positive clones were selected as shown in FIG. 3.

Example 2 construction of TCR Gene and vector for obtaining MAGE-A1 antigen short peptide specific T cell clone

Using Quick-RNA^TMMiniPrep (ZYMO research) extraction of total RNA of T cell clones specific to antigen short peptide KVLEYVIKV and restricted by HLA-A0201 selected in example 1 cDNA amplification kit of clontech is used, primers designed to be conserved at C-terminal of human TCR gene are used, the sequences are cloned into T vector (TAKARA) for sequencing, it is noted that the sequences are complementary sequences and do not contain introns, and sequencing is performed, and the sequences of TCR α chain and TCR 24 chain expressed by the double positive clones are shown in FIG. 1 and FIG. 2, respectively, and the sequences of TCR α chain variable domain amino acid sequence, TCR α chain variable domain nucleotide sequence, TCR α chain amino acid sequence, TCR 2 chain nucleotide sequence, TCR α chain amino acid sequence having leader sequence and TCR α chain nucleotide sequence having leader sequence, TCR 3 chain nucleotide sequence, TCR 632 b, TCR 632 chain nucleotide sequence, TCR β chain variable domain nucleotide sequence, and TCR 6342 chain nucleotide sequence are shown in FIG. 1a, 1b, 2C 2b, and FIG. 2f are shown in FIG. 2.

The alpha chain was identified to comprise CDRs with the following amino acid sequences:

αCDR1-SSNFYA (SEQ ID NO:10)

αCDR2-MTLNGDE (SEQ ID NO:11)

αCDR3-AFPSGGGADGLT (SEQ ID NO:12)

the beta chain comprises CDRs having the following amino acid sequences:

βCDR1-SGDLS (SEQ ID NO:13)

βCDR2-YYNGEE (SEQ ID NO:14)

βCDR3-ASSVEGYPSYEQY (SEQ ID NO:15)

the full length genes for the TCR α and β chains were cloned into the lentiviral expression vector pllenti (addendum) by overlap (overlap) PCR, respectively. The method specifically comprises the following steps: the TCR alpha chain and the TCR beta chain are connected by overlap PCR to obtain the TCR alpha-2A-TCR beta segment. And (3) carrying out enzyme digestion and connection on the lentivirus expression vector and the TCR alpha-2A-TCR beta to obtain pLenti-TRA-2A-TRB-IRES-NGFR plasmid. As a control, a lentiviral vector pLenti-eGFP expressing eGFP was also constructed. The pseudovirus was then packaged again at 293T/17.

Example 3 expression, refolding and purification of MAGE-A1 antigen short peptide specific soluble TCR

To obtain soluble TCR molecules, the α and β chains of the TCR molecules of the invention may comprise only the variable and part of the constant domains thereof, respectively, and a cysteine residue has been introduced into the constant domains of the α and β chains, respectively, to form artificial interchain disulfide bonds, at the positions Thr48 of exon 1 TRAC × 01 and Ser57 of exon 1 TRBC2 × 01, respectively; the amino acid sequence and nucleotide sequence of the alpha chain are shown in FIGS. 4a and 4b, respectively, and the amino acid sequence and nucleotide sequence of the beta chain are shown in FIGS. 5a and 5b, respectively, and the introduced cysteine residues are shown in bold and underlined letters. The desired gene sequences of the above TCR alpha and beta chains were synthesized and inserted into the expression vector pET28a + (Novagene) by standard methods described in "Molecular Cloning A Laboratory Manual" (third edition, Sambrook and Russell), upstream and downstream Cloning sites being NcoI and NotI, respectively. The insert was confirmed by sequencing without error.

The expression vectors of TCR α and β chains are respectively transformed into expression cells by a chemical transformation methodBacterium BL21(DE3) grown in LB broth at OD₆₀₀Inclusion bodies formed after expression of α and β chains of TCR were extracted by BugBuster Mix (Novagene) and washed repeatedly with BugBuster solution several times at 0.6 final induction with final concentration of 0.5mM IPTG, and finally dissolved in 6M guanidine hydrochloride, 10mM Dithiothreitol (DTT),10mM ethylenediaminetetraacetic acid (EDTA),20mM Tris (ph 8.1).

The TCR α and β chains after lysis were separated by 1: 1 was rapidly mixed in 5M urea, 0.4M arginine, 20mM Tris (pH8.1), 3.7mM cystamine,6.6mM β -mercaptamine (4 ℃) to a final concentration of 60 mg/mL. After mixing, the solution was dialyzed against 10 times the volume of deionized water (4 ℃ C.), and after 12 hours, the deionized water was changed to a buffer (20mM Tris, pH 8.0) and dialysis was continued at 4 ℃ for 12 hours. The solution after completion of dialysis was filtered through a 0.45. mu.M filter and then purified by an anion exchange column (HiTrap Q HP,5ml, GE Healthcare). The TCR eluted with peaks containing successfully renatured α and β dimers was confirmed by SDS-PAGE gel. The TCR was subsequently further purified by gel filtration chromatography (HiPrep 16/60, Sephacryl S-100HR, GE Healthcare). The purity of the purified TCR was greater than 90% as determined by SDS-PAGE and the concentration was determined by BCA. The SDS-PAGE gel of the soluble TCR of the invention is shown in FIG. 6.

Example 4 Generation of soluble Single chain TCR specific for MAGE-A1 antigen short peptide

According to the disclosure of WO2014/206304, the variable domains of TCR α and β chains in example 2 were constructed as a stable soluble single-chain TCR molecule linked by a short flexible peptide (linker) using site-directed mutagenesis. The amino acid sequence and the nucleotide sequence of the single-chain TCR molecule are shown in FIG. 7a and FIG. 7b, respectively. The amino acid sequence and nucleotide sequence of the alpha chain variable domain are shown in FIG. 8a and FIG. 8b, respectively; the amino acid sequence and nucleotide sequence of its beta-chain variable domain are shown in FIG. 9a and FIG. 9b, respectively; the amino acid sequence and the nucleotide sequence of the linker sequence are shown in FIG. 10a and FIG. 10b, respectively.

The target gene was digested simultaneously with Nco I and Not I, and ligated with pET28a vector digested simultaneously with Nco I and Not I. The ligation product was transformed into e.coli DH5 α, spread on LB plates containing kanamycin, cultured at 37 ℃ for overnight inversion, positive clones were selected for PCR screening, positive recombinants were sequenced, and after the correct sequence was determined, recombinant plasmids were extracted and transformed into e.coli bl21(DE3) for expression.

Example 5 expression, renaturation and purification of soluble Single-chain TCR specific for MAGE-A1 antigen short peptide

The BL21(DE3) colony containing the recombinant plasmid pET28 a-template strand prepared in example 4 was inoculated in its entirety into LB medium containing kanamycin, cultured at 37 ℃ to OD600 of 0.6 to 0.8, IPTG was added to a final concentration of 0.5mM, and the culture was continued at 37 ℃ for 4 hours. The cell pellet was harvested by centrifugation at 5000rpm for 15min, the cell pellet was lysed by Bugbuster Master Mix (Merck), inclusion bodies were recovered by centrifugation at 6000rpm for 15min, washed with Bugbuster (Merck) to remove cell debris and membrane components, and centrifuged at 6000rpm for 15min to collect the inclusion bodies. The inclusion bodies were dissolved in a buffer (20mM Tris-HClpH 8.0,8M urea), and the insoluble material was removed by high-speed centrifugation, and the supernatant was quantified by BCA method, and then dispensed, and stored at-80 ℃ for further use.

To 5mg of solubilized single-chain TCR inclusion body protein, 2.5mL of buffer (6M Gua-HCl, 50mM Tris-HCl pH8.1, 100mM NaCl, 10mM EDTA) was added, DTT was added to a final concentration of 10mM, and treatment was carried out at 37 ℃ for 30 min. The treated single-chain TCR was added dropwise to 125mL of renaturation buffer (100mM Tris-HCl pH8.1, 0.4M L-arginine, 5M urea, 2mM EDTA,6.5mM beta-mercaptoethylamine, 1.87mM Cystamine) with a syringe, stirred at 4 ℃ for 10min, and then the renaturation solution was filled into a cellulose membrane dialysis bag with a cut-off of 4kDa, and the bag was placed in 1L of precooled water and stirred slowly at 4 ℃ overnight. After 17 hours, the dialysate was changed to 1L of pre-chilled buffer (20mM Tris-HCl pH 8.0), dialysis was continued at 4 ℃ for 8h, and then dialysis was continued overnight with the same fresh buffer. After 17 hours, the sample was filtered through a 0.45 μ M filter, vacuum degassed, passed through an anion exchange column (HiTrap Q HP, GE Healthcare), protein purified by a linear gradient elution of 0-1M NaCl in 20mM Tris-HClpH 8.0, the collected eluted fractions were subjected to SDS-PAGE analysis, fractions containing single-chain TCR concentrated and further purified by a gel filtration column (Superdex 7510/300, GE Healthcare), and the target fraction was also subjected to SDS-PAGE analysis.

The eluted fractions for BIAcore analysis were further tested for purity using gel filtration. The conditions are as follows: the chromatographic column Agilent Bio SEC-3(300A, phi 7.8X 300mM) and the mobile phase are 150mM phosphate buffer solution, the flow rate is 0.5mL/min, the column temperature is 25 ℃, and the ultraviolet detection wavelength is 214 nm.

The SDS-PAGE gel of the soluble single-chain TCR obtained by the invention is shown in FIG. 11.

Example 6 binding characterization

This example demonstrates that soluble TCR molecules of the invention are capable of specifically binding to the KVLEYVIKV-HLA a0201 complex.

The binding activity of the TCR molecules obtained in example 3 and example 5 to the KVLEYVIKV-HLA A0201 complex was measured using ForteBio (octet QKe System) and BIAcore (T200) real-time assay systems, respectively. Anti-streptavidin antibody (GenScript) was added to coupling buffer (10mM sodium acetate buffer, pH 4.77), and then the antibody was passed through CM5 chip previously activated with EDC and NHS to immobilize the antibody on the chip surface, and finally the unreacted activated surface was blocked with ethanolamine hydrochloric acid solution to complete the coupling process at a coupling level of about 15,000 RU.

The low concentration of streptavidin was flowed over the antibody coated chip surface, then KVLEYVIKV-HLAA0201 complex was flowed over the detection channel, the other channel served as the reference channel, and 0.05mM biotin was flowed over the chip at a flow rate of 10. mu.L/min for 2min, blocking the remaining binding sites of streptavidin.

The KVLEYVIKV-HLA A0201 complex is prepared as follows:

a. purification of

Collecting 100ml E.coli liquid for inducing expression of heavy chain or light chain, centrifuging at 4 ℃ for 10min at 8000g, washing the thalli once with 10ml PBS, then resuspending the thalli with 5ml BugBuster Master Mix Extraction Reagents (Merck) by vigorous shaking, rotatably incubating at room temperature for 20min, centrifuging at 4 ℃ for 15min at 6000g, discarding supernatant, and collecting inclusion body.

Resuspending the inclusion bodies in 5ml of BugBuster Master Mix, and rotary incubating at room temperature for 5 min; adding 30ml of 10-fold diluted BugBuster, uniformly mixing, and centrifuging at 4 ℃ at 6000g for 15 min; discarding the supernatant, adding 30ml of 10-fold diluted BugBuster to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, repeating twice, adding 30ml of 20mM Tris-HCl pH8.0 to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, finally dissolving the inclusion bodies by using 20mM Tris-HCl 8M urea, detecting the purity of the inclusion bodies by SDS-PAGE, and detecting the concentration by using a BCA kit.

b. Renaturation

The synthesized short peptide KVLEYVIKV (Beijing Baisheng Gene technology Co., Ltd.) was dissolved in DMSO to a concentration of 20 mg/ml. Inclusion of light and heavy chains was solubilized with 8M Urea, 20mM Tris pH8.0, 10mM DTT and further denatured by addition of 3M guanidine hydrochloride, 10mM sodium acetate, 10mM EDTA prior to renaturation. KVLEYVIKV peptide was added to a renaturation buffer (0.4M L-arginine, 100mM Tris pH 8.3, 2mM EDTA, 0.5mM oxidative glutathione, 5mM reduced glutathione, 0.2mM PMSF, cooled to 4 ℃) at 25mg/L (final concentration), followed by the addition of 20mg/L of light chain and 90mg/L of heavy chain in sequence (final concentration, heavy chain was added in three portions, 8 h/time), and renaturation was carried out at 4 ℃ for at least 3 days until completion, and SDS-PAGE checked for success or failure of the renaturation.

c. Purification after renaturation

The renaturation buffer was replaced by dialysis against 10 volumes of 20mM Tris pH8.0, at least twice to reduce the ionic strength of the solution sufficiently. After dialysis, the protein solution was filtered through a 0.45 μm cellulose acetate filter and then loaded onto a HiTrap Q HP (GE general electric) anion exchange column (5ml bed volume). Using Akta purifiers (GE general electric company), 20mM Tris pH8.0 prepared 0-400mM NaCl linear gradient elution protein, pMHC approximately 250mM NaCl elution, collecting the peak components, SDS-PAGE detection purity.

d. Biotinylation of the compound

The purified pMHC molecules were concentrated using Millipore ultrafiltration tubes while displacing the buffer to 20mM Tris pH8.0, followed by addition of biotinylation reagent 0.05M Bicine pH 8.3, 10mM ATP, 10mM MgOAc, 50. mu. M D-Biotin, 100. mu.g/ml BirA enzyme (GST-BirA), incubation of the mixture overnight at room temperature, and SDS-PAGE to determine the completion of biotinylation.

e. Purification of biotinylated complexes

Using Millipore ultrafiltration tubeThe biotinylated pMHC molecules were concentrated to 1ml, and the biotinylated pMHC was purified by gel filtration chromatography using an Akta purifier (GE general electric company) to pre-equilibrate HiPrep with filtered PBS^TM16/60S200HR column (GE general electric) was loaded with 1ml of concentrated biotinylated pMHC molecules and then eluted with PBS at a flow rate of 1 ml/min. Biotinylated pMHC molecules appeared as a unimodal elution at approximately 55 ml. The fractions containing the protein were pooled, concentrated using Millipore ultrafiltration tubes, protein concentration was determined by BCA (Thermo), and biotinylated pMHC molecules were stored in aliquots at-80 ℃ by addition of the protease inhibitor cocktail (Roche).

Kinetic parameters were calculated using Data Analysis 7.1 and BIAcore Evaluation software, and kinetic profiles of soluble TCR molecules of the invention and soluble single-chain TCR molecules constructed according to the invention bound to KVLEYVIKV-HLA a0201 complex were obtained as shown in fig. 12 and 13, respectively. The maps show that both soluble TCR molecules and soluble single-chain TCR molecules obtained by the invention can be combined with KVLEYVIKV-HLA A0201 complex. Meanwhile, the method is used for detecting the binding activity of the soluble TCR molecule and the short peptides of other unrelated antigens and the HLA complex, and the result shows that the TCR molecule is not bound with other unrelated antigens.

Example 7 MAGE A1 antigen short peptide specific TCR Lentiviral packaging and Primary T cell transfection

(a) Production of lentiviruses by Rapid-mediated transient transfection (Express-In-mediated transfection) of 293T cells

A third generation lentiviral packaging system was used to package lentiviruses containing the gene encoding the desired TCR. 293T cells were transfected with 4 plasmids (a lentiviral vector containing pLenti-RHAMMTRA-2A-TRB-IRES-NGFR as described In example 2, and 3 plasmids containing other components necessary for the construction of infectious but non-replicating lentiviral particles) using rapid-mediated transient transfection (Express-In-mediated transfection (open biosystems)).

For transfection, cells were seeded on day 0 on a 15 cm petri dish at 1.7 × 10⁷293T cells, and the cells were evenly dividedSpread on petri dish with a degree of confluence slightly higher than 50%. On day 1, plasmids were transfected, pLenti-TRA-2A-TRB-IRES-NGFR and pLenti-eGFP pseudoviruses were packaged, and the above expression plasmids were mixed with packaging plasmids pMDLg/pRRE, pRSV-REV and pMD.2G, in the following amounts on a 15 cm diameter plate: 22.5 microgram: 15 microgram: 7.5 micrograms. The ratio of the transfection reagent PEI-MAX to the plasmid was 2:1 and the amount of PEI-MAX used was 120. mu.g per plate. The specific operation is as follows: the expression plasmid and the packaging plasmid were added to 1800. mu.l of OPTI-MEM (Gibbo, catalog No. 31985-; mixing a corresponding amount of PEI with 1800 microliters of OPTI-MEM culture medium uniformly, standing for 5 minutes at room temperature to obtain a PEI mixed solution, mixing the DNA mixed solution with the PEI mixed solution, standing for 30 minutes at room temperature, adding 3150 microliters of OPTI-MEM culture medium, uniformly mixing, adding into 293T cells converted into 11.25 milliliters of OPTI-MEM, gently shaking the culture dish to mix the culture medium uniformly, culturing at 37 deg.C/5% CO2, transfecting for 5-7 hr, the transfection medium was removed and replaced with DMEM (Gibbo, Cat. No. C11995500bt) complete medium containing 10% fetal bovine serum at 37 deg.C/5% CO.₂And (5) culturing. Culture supernatants containing packaged lentiviruses were collected on days 3 and 4. To harvest the packaged lentivirus, the collected culture supernatant was centrifuged at 3000g for 15min to remove cell debris, filtered through a 0.22 micron filter (Merck Millipore, catalog # SLGP033RB), and finally concentrated using a 50KD cut-off concentration tube (Merck Millipore, catalog # UFC905096), to remove most of the supernatant, and finally concentrated to 1ml, and aliquots were frozen at-80 ℃. Pseudovirus samples were taken for virus titer determination, procedures were referenced to p24ELISA (Clontech, cat # 632200) kit instructions. As a control, a pseudovirus transformed with pLenti-eGFP was also included.

(b) Transduction of primary T cells with lentiviruses containing T cell receptor genes specific for MAGE A1 antigen short peptides

CD8+ T cells were isolated from the blood of healthy volunteers and transduced with packaged lentiviruses. These cells were counted in 48-well plates containing 50IU/ml IL-2 and 10ng/mlIL-7 in 1640 (Gibbo, Cat. No. C11875500bt) medium with 10% FBS (Gibbo, Cat. No. C10010500BT) at 1 × 10⁶Cells/ml (0.5 ml/well) were incubated with pre-washed anti-CD 3/CD28 antibody-coated beads (T cell amplicons, life technologies, cat No. 11452D) overnight for stimulation, cells: bead 3: 1.

after overnight stimulation, the concentrated lentivirus of the MAGE A1 antigen short peptide specific T cell receptor gene was added at an MOI of 10 according to the virus titer measured by the p24ELISA kit and centrifuged at 32 ℃ and 900g for 1 hour. After infection, the lentivirus infection solution was removed and the cells were resuspended in 1640 medium containing 10% FBS with 50IU/ml IL-2 and 10ng/ml IL-7 at 37 ℃/5% CO₂Culturing for 3 days, performing second round infection in the same manner on the next day, counting cells after 3 days of second transduction, and diluting the cells to 0.5 × 10⁶One cell/ml, one cell count every two days, replace or add fresh medium containing 50IU/ml IL-2 and 10ng/ml IL-7, maintain cells at 0.5 × 10⁶-1×10⁶Individual cells/ml cells were analyzed by flow cytometry starting at day 3 and starting at day 5 for functional assays (e.g., ELISPOT and non-radioactive cytotoxicity assays for IFN- γ release). starting at day 10 or as cells slow down division and diminish in size, aliquots of cells were frozen, at least 4 × 10⁶One cell/tube (1 × 10)⁷Individual cells/ml, 90% FBS/10% DMSO).

Example 8 activation of T cells transducing TCRs of the invention

ELISPOT scheme

The following assay was performed to demonstrate the specific activation response of TCR-transduced T cells to target cells. IFN-. gamma.production as measured by the ELISPOT assay was used as a readout for T cell activation.

Reagent

Test medium: 10% FBS (Gibbo, catalog number 16000-

Wash buffer (PBST): 0.01M PBS/0.05% Tween 20

PBS (Gibbo Co., catalog number C10010500BT)

PVDF ELISPOT 96-well plate (Merck Millipore, Cat. No. MSIPS4510)

Human IFN-. gamma.ELISPOT PVDF-enzyme kit (BD) contains all other reagents required (capture and detection antibody, streptavidin-alkaline phosphatase and BCIP/NBT solution)

Method of producing a composite material

Target cell preparation

The target cells used in this experiment were T2 cells, and the target cells were prepared in the experimental medium by adjusting the concentration of the target cells to 2.0 × 10⁵One/ml, 100. mu.l/well to obtain 2.0 × 10⁴Individual cells/well.

Effector cell preparation

The effector cells (T cells) of this experiment were CD8+ T cells expressing the TCR specific for the MAGE a1 antigen short peptide of the present invention analyzed by flow cytometry in example 7, and CD8+ T cells of the same volunteer, which were not transfected with the TCR of the present invention, were used as a control group. T cells were stimulated with anti-CD 3/CD28 coated beads (T cell amplicons, life technologies), transduced with lentiviruses carrying the MAGE A1 antigen short peptide specific TCR gene (according to example 7), expanded in 1640 medium containing 10% FBS with 50IU/ml IL-2 and 10ng/ml IL-7 until 9-12 days post transduction, then placed in assay medium and washed by centrifugation at 300g for 10min at RT. The cells were then resuspended in the test medium at 2 × the desired final concentration. Negative control effector cells were treated as well.

Preparation of short peptide solution

The corresponding short peptide was added to the corresponding target cell (T2) experiment group to give a final concentration of 1. mu.g/ml of short peptide in ELISPOT well plates.

ELISPOT

The well plate was prepared as follows according to the manufacturer's instructions: 10ml of sterile PBS per plate 1: anti-human IFN-. gamma.capture antibody was diluted at 200, and 100. mu.l of the diluted capture antibody was aliquoted into each well. The plates were incubated overnight at 4 ℃. After incubation, the well plates were washed to remove excess capture antibody. 100 μ l/well of RPMI1640 medium containing 10% FBS was added and the well plates were incubated at room temperature for 2 hours to close the well plates. The media was then washed from the well plate, and any residual wash buffer was removed by flicking and tapping the ELISPOT well plate on paper.

The components of the assay were then added to ELISPOT well plates in the following order:

100 microliter of target cells 2x10⁵Cells/ml (total of about 2x10 was obtained)⁴Individual target cells/well).

100 microliter of effector cells (1 x 10)⁴Individual control effector cells/well and MAGE a1 TCR positive T cells/well).

All wells were prepared in duplicate for addition.

The well plates were then incubated overnight (37 ℃/5% CO)₂) The next day, the medium was discarded, the well plate was washed 2 times with double distilled water and 3 times with wash buffer, and tapped on a paper towel to remove residual wash buffer. Then, the mixture was mixed with PBS containing 10% FBS at a ratio of 1: the detection antibody was diluted at 200 and added to each well at 100. mu.l/well. The well plate was incubated at room temperature for 2 hours, washed 3 times with wash buffer and the well plate was tapped on a paper towel to remove excess wash buffer.

PBS containing 10% FBS was used at 1: streptavidin-alkaline phosphatase was diluted 100, 100 microliters of diluted streptavidin-alkaline phosphatase was added to each well and the wells were incubated for 1 hour at room temperature. The plates were then washed 2 times with 4 washes of PBS and tapped on a paper towel to remove excess wash buffer and PBS. After washing, 100 microliter of BCIP/NBT solution provided by the kit is added for development. And covering the well plate with tinfoil paper in the developing period, keeping the well plate in the dark, and standing for 5-15 minutes. Spots on the developing plate were routinely detected during this period to determine the optimum time for terminating the reaction. The BCIP/NBT solution was removed and the well plate was rinsed with double-distilled water to stop the development reaction, spun-dried, then the bottom of the well plate was removed, the well plate was dried at room temperature until each well was completely dried, and then the spots formed in the bottom film of the well plate were counted using an immune spot plate counter (CTL, cell technology limited).

Results

The TCR transduced T cells of the invention were tested by ELISPOT assay (as described above) for IFN- γ release in response to target cells loaded with MAGE a1 antigen short peptide GLSNLTHVL. The number of ELSPOT spots observed in each well was plotted using a graphipad prism 6.

As shown in FIG. 14, T cells transduced with the TCR of the invention were shown to be very active against target cells loaded with their specific short peptides, whereas T cells not transduced with the TCR of the invention were shown to be essentially non-active.

Example 9 killing of cells transduced with a TCR of the invention

This example demonstrates the killing function of cells transduced with the TCR of the invention by measuring LDH release by non-radioactive cytotoxicity assays. This test is a colorimetric substitution test for the 51Cr release cytotoxicity test, and quantitatively determines Lactate Dehydrogenase (LDH) released after cell lysis. LDH released in the medium was detected using a 30min coupled enzymatic reaction in which LDH converted a tetrazolium salt (INT) to red formazan (formazan). The amount of red product produced is proportional to the number of cells lysed. 490nm visible absorbance data can be collected using a standard 96-well plate reader.

Methods for detecting cell function using LDH release assays are well known to those skilled in the art. The effector cells (T cells) of this example were CD8+ T cells expressing the TCR specific for the MAGE a1 antigen short peptide of the invention, analyzed by flow cytometry in example 7, the target cell lines being 293T and U266B 1. According to nanostring results, U266B1 expressed MAGE A1 antigen, 293T did not substantially express MAGE A1 antigen, and this served as a control.

LDH plates were first prepared. On day 1 of the experiment, the components of the experiment were added to the plate in the following order: medium regulates Effector cells to 2X10⁶Individual cells/ml, media adjusted each target cell line to 5X10⁵Individual cells/ml. Mixing well, and collecting 100 μ L of target cell line 5X10⁵One cell/ml (i.e., 50,000 cells/well), 100. mu.L Effector cell 2X10⁶One cell/ml (i.e., 200,000 cells/well) was added to the corresponding well and three replicate wells were set. Meanwhile, an effector cell spontaneous hole, a target cell maximum hole, a volume correction control hole and a culture medium background control hole are arranged. Incubation overnight (37 ℃, 5% CO)₂). On day 2 of the experiment, color development was detected, and after termination of the reaction, the absorbance was recorded at 490nm using a microplate reader (Bioteck). The results are shown in FIG. 15, where curve NC-293T is the response of effector cells that have not been transfected with a TCR of the invention to the 293T cell line; curve NC-U266B1 is the response of effector cells that are not transfected with the TCR of the invention to the U266B1 cell line; curve TCR-293T is the response of effector cells transfected with the TCR of the invention to the 293T cell line; the TCR-U266B1 curve is the response of effector cells transfected with the TCR of the invention to the U266B1 cell line. As can be seen from the results, effector cells transduced with the TCRs of the invention have a killing effect on target cells expressing the relevant antigen, while there is essentially no killing effect on target cells not expressing the relevant antigen.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Guangzhou Xiangxue pharmaceutical products Co., Ltd

<120> T cell receptor recognizing MAGE-A1 antigen short peptide

<130>P2017-0068

<150>CN201610190650.6

<151>2016-03-29

<160>37

<170>PatentIn version 3.5

<210>1

<211>114

<212>PRT

<213> Artificial sequence

<220>

<223> TCR alpha chain variable Domain

<400>1

Ile Leu Asn Val Glu Gln Ser Pro Gln Ser Leu His Val Gln Glu Gly

1 5 10 15

Asp Ser Thr Asn Phe Thr Cys Ser Phe Pro Ser Ser Asn Phe Tyr Ala

20 25 30

Leu His Trp Tyr Arg Trp Glu Thr Ala Lys Ser Pro Glu Ala Leu Phe

35 40 45

Val Met Thr Leu Asn Gly Asp Glu Lys Lys Lys Gly Arg Ile Ser Ala

50 55 60

Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr Leu Tyr Ile Lys Gly Ser

65 7075 80

Gln Pro Glu Asp Ser Ala Thr Tyr Leu Cys Ala Phe Pro Ser Gly Gly

85 90 95

Gly Ala Asp Gly Leu Thr Phe Gly Lys Gly Thr His Leu Ile Ile Gln

100 105 110

Pro Tyr

<210>2

<211>342

<212>DNA

<213> Artificial sequence

<220>

<223> TCR alpha chain variable Domain

<400>2

atactgaacg tggaacaaag tcctcagtca ctgcatgttc aggagggaga cagcaccaat 60

ttcacctgca gcttcccttc cagcaatttt tatgccttac actggtacag atgggaaact 120

gcaaaaagcc ccgaggcctt gtttgtaatg actttaaatg gggatgaaaa gaagaaagga 180

cgaataagtg ccactcttaa taccaaggag ggttacagct atttgtacat caaaggatcc 240

cagcctgaag actcagccac atacctctgt gccttccctt caggaggagg tgctgacgga 300

ctcacctttg gcaaagggac tcatctaatc atccagccct at 342

<210>3

<211>254

<212>PRT

<213> Artificial sequence

<220>

<223> TCR alpha chain

<400>3

Ile Leu Asn Val Glu Gln SerPro Gln Ser Leu His Val Gln Glu Gly

1 5 10 15

Asp Ser Thr Asn Phe Thr Cys Ser Phe Pro Ser Ser Asn Phe Tyr Ala

20 25 30

Leu His Trp Tyr Arg Trp Glu Thr Ala Lys Ser Pro Glu Ala Leu Phe

35 40 45

Val Met Thr Leu Asn Gly Asp Glu Lys Lys Lys Gly Arg Ile Ser Ala

50 55 60

Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr Leu Tyr Ile Lys Gly Ser

65 70 75 80

Gln Pro Glu Asp Ser Ala Thr Tyr Leu Cys Ala Phe Pro Ser Gly Gly

85 90 95

Gly Ala Asp Gly Leu Thr Phe Gly Lys Gly Thr His Leu Ile Ile Gln

100 105 110

Pro Tyr Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser

115 120 125

Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln

130 135 140

Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys

145 150 155 160

Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val

165 170 175

Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn

180 185 190

Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys

195 200 205

Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn

210 215 220

Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val

225 230 235 240

Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser

245 250

<210>4

<211>762

<212>DNA

<213> Artificial sequence

<220>

<223> TCR alpha chain

<400>4

atactgaacg tggaacaaag tcctcagtca ctgcatgttc aggagggaga cagcaccaat 60

ttcacctgca gcttcccttc cagcaatttt tatgccttac actggtacag atgggaaact 120

gcaaaaagcc ccgaggcctt gtttgtaatg actttaaatg gggatgaaaa gaagaaagga 180

cgaataagtg ccactcttaa taccaaggag ggttacagct atttgtacat caaaggatcc 240

cagcctgaag actcagccac atacctctgt gccttccctt caggaggagg tgctgacgga 300

ctcacctttg gcaaagggac tcatctaatc atccagccct atatccagaa ccctgaccct 360

gccgtgtacc agctgagaga ctctaaatcc agtgacaagt ctgtctgcct attcaccgat 420

tttgattctc aaacaaatgt gtcacaaagt aaggattctg atgtgtatat cacagacaaa 480

actgtgctag acatgaggtc tatggacttc aagagcaaca gtgctgtggc ctggagcaac 540

aaatctgact ttgcatgtgc aaacgccttc aacaacagca ttattccaga agacaccttc 600

ttccccagcc cagaaagttc ctgtgatgtc aagctggtcg agaaaagctt tgaaacagat 660

acgaacctaa actttcaaaa cctgtcagtg attgggttcc gaatcctcct cctgaaagtg 720

gccgggttta atctgctcat gacgctgcgg ctgtggtcca gc 762

<210>5

<211>114

<212>PRT

<213> Artificial sequence

<220>

<223> TCR beta chain variable domain

<400>5

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr Ala Thr Gly

1 5 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu ArgPhe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Leu Ser Ser

65 70 75 80

Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Val Glu

85 90 95

Gly Tyr Pro Ser Tyr Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr

100 105 110

Val Thr

<210>6

<211>342

<212>DNA

<213> Artificial sequence

<220>

<223> TCR beta chain variable domain

<400>6

gattctggag tcacacaaac cccaaagcac ctgatcacag caactggaca gcgagtgacg 60

ctgagatgct cccctaggtc tggagacctc tctgtgtact ggtaccaaca gagcctggac 120

cagggcctcc agttcctcat tcagtattat aatggagaag agagagcaaa aggaaacatt 180

cttgaacgat tctccgcaca acagttccct gacttgcact ctgaactaaa cctgagctct 240

ctggagctgg gggactcagc tttgtatttc tgtgccagca gcgtagaagg ctacccctcc 300

tacgagcagt acttcgggcc gggcaccagg ctcacggtca ca 342

<210>7

<211>293

<212>PRT

<213> Artificial sequence

<220>

<223> TCR beta chain

<400>7

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr Ala Thr Gly

1 5 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Leu Ser Ser

65 70 75 80

Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Val Glu

85 90 95

Gly Tyr Pro Ser Tyr Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr

100 105 110

Val Thr Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe

115 120 125

Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val

130 135 140

Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp

145 150 155 160

Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro

165 170 175

Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser

180 185 190

Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe

195 200 205

Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr

210 215 220

Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp

225 230 235 240

Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val

245 250 255

Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu

260 265 270

Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg

275 280 285

Lys Asp Ser Arg Gly

290

<210>8

<211>879

<212>DNA

<213> Artificial sequence

<220>

<223> TCR beta chain

<400>8

gattctggag tcacacaaac cccaaagcac ctgatcacag caactggaca gcgagtgacg 60

ctgagatgct cccctaggtc tggagacctc tctgtgtact ggtaccaaca gagcctggac 120

cagggcctcc agttcctcat tcagtattat aatggagaag agagagcaaa aggaaacatt 180

cttgaacgat tctccgcaca acagttccct gacttgcact ctgaactaaa cctgagctct 240

ctggagctgg gggactcagc tttgtatttc tgtgccagca gcgtagaagg ctacccctcc 300

tacgagcagt acttcgggcc gggcaccagg ctcacggtca cagaggacct gaaaaacgtg 360

ttcccacccg aggtcgctgt gtttgagcca tcagaagcag agatctccca cacccaaaag 420

gccacactgg tgtgcctggc cacaggcttc taccccgacc acgtggagct gagctggtgg 480

gtgaatggga aggaggtgca cagtggggtc agcacagacc cgcagcccct caaggagcag 540

cccgccctca atgactccag atactgcctg agcagccgcc tgagggtctc ggccaccttc 600

tggcagaacc cccgcaacca cttccgctgt caagtccagt tctacgggct ctcggagaat 660

gacgagtgga cccaggatag ggccaaacct gtcacccaga tcgtcagcgc cgaggcctgg 720

ggtagagcag actgtggctt cacctccgag tcttaccagc aaggggtcct gtctgccacc 780

atcctctatg agatcttgct agggaaggcc accttgtatg ccgtgctggt cagtgccctc 840

gtgctgatgg ccatggtcaa gagaaaggat tccagaggc 879

<210>9

<211>9

<212>PRT

<213> Artificial sequence

<220>

<223> antigen short peptide

<400>9

Lys Val Leu Glu Tyr Val Ile Lys Val

1 5

<210>10

<211>6

<212>PRT

<213> Artificial sequence

<220>

<223>α CDR1

<400>10

Ser Ser Asn Phe Tyr Ala

1 5

<210>11

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>α CDR2

<400>11

Met Thr Leu Asn Gly Asp Glu

1 5

<210>12

<211>12

<212>PRT

<213> Artificial sequence

<220>

<223>α CDR3

<400>12

Ala Phe Pro Ser Gly Gly Gly Ala Asp Gly Leu Thr

1 5 10

<210>13

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>β CDR1

<400>13

Ser Gly Asp Leu Ser

1 5

<210>14

<211>6

<212>PRT

<213> Artificial sequence

<220>

<223>β CDR2

<400>14

Tyr Tyr Asn Gly Glu Glu

1 5

<210>15

<211>13

<212>PRT

<213> Artificial sequence

<220>

<223>β CDR3

<400>15

Ala Ser Ser Val Glu Gly Tyr Pro Ser Tyr Glu Gln Tyr

1 5 10

<210>16

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223>α CDR1

<400>16

tccagcaatt tttatgcc 18

<210>17

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223>α CDR2

<400>17

atgactttaa atggggatga a 21

<210>18

<211>36

<212>DNA

<213> Artificial sequence

<220>

<223>α CDR3

<400>18

gccttccctt caggaggagg tgctgacgga ctcacc 36

<210>19

<211>15

<212>DNA

<213> Artificial sequence

<220>

<223>β CDR1

<400>19

tctggagacc tctct 15

<210>20

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223>β CDR2

<400>20

tattataatg gagaagag 18

<210>21

<211>39

<212>DNA

<213> Artificial sequence

<220>

<223>β CDR3

<400>21

gccagcagcg tagaaggcta cccctcctac gagcagtac 39

<210>22

<211>276

<212>PRT

<213> Artificial sequence

<220>

<223> TCR alpha chain having leader sequence

<400>22

Met Glu Lys Asn Pro Leu Ala Ala Pro Leu Leu Ile Leu Trp Phe His

1 5 10 15

Leu Asp Cys Val Ser Ser Ile Leu Asn Val Glu Gln Ser Pro Gln Ser

20 25 30

Leu His Val Gln Glu Gly Asp Ser Thr Asn Phe Thr Cys Ser Phe Pro

35 40 45

Ser Ser Asn Phe Tyr Ala Leu His Trp Tyr Arg Trp Glu Thr Ala Lys

50 55 60

Ser Pro Glu Ala Leu Phe Val Met Thr Leu Asn Gly Asp Glu Lys Lys

65 70 75 80

Lys Gly Arg Ile Ser Ala Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr

85 90 95

Leu Tyr Ile Lys Gly Ser Gln Pro Glu Asp Ser Ala Thr Tyr Leu Cys

100 105 110

Ala Phe Pro Ser Gly Gly Gly Ala Asp Gly Leu Thr Phe Gly Lys Gly

115 120 125

Thr His Leu Ile Ile Gln Pro Tyr Ile Gln Asn Pro Asp Pro Ala Val

130 135 140

Tyr Gln Leu Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe

145 150 155 160

Thr Asp Phe Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp

165 170 175

Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe

180 185 190

Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys

195 200 205

Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro

210 215 220

Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu

225 230 235 240

Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg

245 250 255

Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg

260 265 270

Leu Trp Ser Ser

275

<210>23

<211>828

<212>DNA

<213> Artificial sequence

<220>

<223> TCR alpha chain having leader sequence

<400>23

atggagaaga atcctttggc agccccatta ctaatcctct ggtttcatct tgactgcgtg 60

agcagcatac tgaacgtgga acaaagtcct cagtcactgc atgttcagga gggagacagc 120

accaatttca cctgcagctt cccttccagc aatttttatg ccttacactg gtacagatgg 180

gaaactgcaa aaagccccga ggccttgttt gtaatgactt taaatgggga tgaaaagaag 240

aaaggacgaa taagtgccac tcttaatacc aaggagggtt acagctattt gtacatcaaa 300

ggatcccagc ctgaagactc agccacatac ctctgtgcct tcccttcagg aggaggtgct 360

gacggactca cctttggcaa agggactcat ctaatcatcc agccctatat ccagaaccct 420

gaccctgccg tgtaccagct gagagactct aaatccagtg acaagtctgt ctgcctattc 480

accgattttg attctcaaac aaatgtgtca caaagtaagg attctgatgt gtatatcaca 540

gacaaaactg tgctagacat gaggtctatg gacttcaaga gcaacagtgc tgtggcctgg 600

agcaacaaat ctgactttgc atgtgcaaac gccttcaaca acagcattat tccagaagac 660

accttcttcc ccagcccaga aagttcctgt gatgtcaagc tggtcgagaa aagctttgaa 720

acagatacga acctaaactt tcaaaacctg tcagtgattg ggttccgaat cctcctcctg 780

aaagtggccg ggtttaatct gctcatgacg ctgcggctgt ggtccagc 828

<210>24

<211>312

<212>PRT

<213> Artificial sequence

<220>

<223> TCR beta chain having leader sequence

<400>24

Met Gly Phe Arg Leu Leu Cys Cys Val Ala Phe Cys Leu Leu Gly Ala

1 5 10 15

Gly Pro Val Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr

20 25 30

Ala Thr Gly Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp

35 40 45

Leu Ser Val Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe

50 55 60

Leu Ile Gln Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu

65 70 75 80

Glu Arg Phe Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn

85 9095

Leu Ser Ser Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser

100 105 110

Ser Val Glu Gly Tyr Pro Ser Tyr Glu Gln Tyr Phe Gly Pro Gly Thr

115 120 125

Arg Leu Thr Val Thr Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val

130 135 140

Ala Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala

145 150 155 160

Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu

165 170 175

Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp

180 185 190

Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys

195 200 205

Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg

210 215 220

Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp

225 230 235 240

Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala

245 250 255

Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln

260 265 270

Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys

275 280 285

Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met

290 295 300

Val Lys Arg Lys Asp Ser Arg Gly

305 310

<210>25

<211>936

<212>DNA

<213> Artificial sequence

<220>

<223> TCR beta chain having leader sequence

<400>25

atgggcttca ggctcctctg ctgtgtggcc ttttgtctcc tgggagcagg cccagtggat 60

tctggagtca cacaaacccc aaagcacctg atcacagcaa ctggacagcg agtgacgctg 120

agatgctccc ctaggtctgg agacctctct gtgtactggt accaacagag cctggaccag 180

ggcctccagt tcctcattca gtattataat ggagaagaga gagcaaaagg aaacattctt 240

gaacgattct ccgcacaaca gttccctgac ttgcactctg aactaaacct gagctctctg 300

gagctggggg actcagcttt gtatttctgt gccagcagcg tagaaggcta cccctcctac 360

gagcagtact tcgggccggg caccaggctc acggtcacag aggacctgaa aaacgtgttc 420

ccacccgagg tcgctgtgtt tgagccatca gaagcagaga tctcccacac ccaaaaggcc 480

acactggtgt gcctggccac aggcttctac cccgaccacg tggagctgag ctggtgggtg 540

aatgggaagg aggtgcacag tggggtcagc acagacccgc agcccctcaa ggagcagccc 600

gccctcaatg actccagata ctgcctgagc agccgcctga gggtctcggc caccttctgg 660

cagaaccccc gcaaccactt ccgctgtcaa gtccagttct acgggctctc ggagaatgac 720

gagtggaccc aggatagggc caaacctgtc acccagatcg tcagcgccga ggcctggggt 780

agagcagact gtggcttcac ctccgagtct taccagcaag gggtcctgtc tgccaccatc 840

ctctatgaga tcttgctagg gaaggccacc ttgtatgccg tgctggtcag tgccctcgtg 900

ctgatggcca tggtcaagag aaaggattcc agaggc 936

<210>26

<211>207

<212>PRT

<213> Artificial sequence

<220>

<223> soluble TCR alpha chain

<400>26

Ile Leu Asn Val Glu Gln Ser Pro Gln Ser Leu His Val Gln Glu Gly

1 5 10 15

Asp Ser Thr Asn Phe Thr Cys Ser Phe Pro Ser Ser Asn Phe Tyr Ala

20 25 30

Leu His Trp Tyr Arg Trp Glu Thr Ala Lys Ser Pro Glu Ala Leu Phe

35 40 45

Val Met Thr Leu Asn Gly Asp Glu Lys Lys Lys Gly Arg Ile Ser Ala

50 55 60

Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr Leu Tyr Ile Lys Gly Ser

65 70 75 80

Gln Pro Glu Asp Ser Ala Thr Tyr Leu Cys Ala Phe Pro Ser Gly Gly

85 90 95

Gly Ala Asp Gly Leu Thr Phe Gly Lys Gly Thr His Leu Ile Ile Gln

100 105 110

Pro Tyr Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser

115 120 125

Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln

130 135 140

Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys

145 150 155 160

Cys Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val

165 170 175

Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn

180 185 190

Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser

195 200 205

<210>27

<211>621

<212>DNA

<213> Artificial sequence

<220>

<223> soluble TCR alpha chain

<400>27

attctgaacg tggaacaaag tcctcagtca ctgcatgttc aggagggaga cagcaccaat 60

ttcacctgca gcttcccttc cagcaatttt tatgccttac actggtacag atgggaaact 120

gcaaaaagcc ccgaggcctt gtttgtaatg actttaaatg gggatgaaaa gaagaaagga 180

cgaataagtg ccactcttaa taccaaggag ggttacagct atttgtacat caaaggatcc 240

cagcctgaag actcagccac atacctctgt gccttccctt caggaggagg tgctgacgga 300

ctcacctttg gcaaagggac tcatctaatc atccagccct atatccagaa ccctgaccct 360

gccgtgtacc agctgagaga ctctaagtcg agtgacaagt ctgtctgcct attcaccgat 420

tttgattctc aaacaaatgt gtcacaaagt aaggattctg atgtgtatat cacagacaaa 480

tgtgtgctag acatgaggtc tatggacttc aagagcaaca gtgctgtggc ctggagcaac 540

aaatctgact ttgcatgtgc aaacgccttc aacaacagca ttattccaga agacaccttc 600

ttccccagcc cagaaagttc c 621

<210>28

<211>244

<212>PRT

<213> Artificial sequence

<220>

<223> soluble TCR beta chain

<400>28

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr Ala Thr Gly

15 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Leu Ser Ser

65 70 75 80

Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Val Glu

85 90 95

Gly Tyr Pro Ser Tyr Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr

100 105 110

Val Thr Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe

115 120 125

Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val

130 135 140

Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp

145 150 155 160

Val Asn Gly Lys Glu Val His Ser Gly Val Cys Thr Asp Pro Gln Pro

165 170 175

Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Ala Leu Ser Ser

180 185 190

Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asp Pro Arg Asn His Phe

195 200 205

Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr

210 215 220

Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp

225 230 235 240

Gly Arg Ala Asp

<210>29

<211>732

<212>DNA

<213> Artificial sequence

<220>

<223> soluble TCR beta chain

<400>29

gatagcggcg tgacccaaac cccaaagcac ctgatcacag caactggaca gcgagtgacg 60

ctgagatgct cccctaggtc tggagacctc tctgtgtact ggtaccaaca gagcctggac 120

cagggcctcc agttcctcat tcagtattat aatggagaag agagagcaaa aggaaacatt 180

cttgaacgat tctccgcaca acagttccct gacttgcact ctgaactaaa cctgagctct 240

ctggagctgg gggactcagc tttgtatttc tgtgccagca gcgtagaagg ctacccctcc 300

tacgagcagt acttcgggcc gggcaccagg ctcacggtca cagaggacct gaaaaacgtg 360

ttcccacccg aggtcgctgt gtttgagcca tcagaagcag agatctccca cacccaaaag 420

gccacactgg tgtgcctggc caccggtttc taccccgacc acgtggagct gagctggtgg 480

gtgaatggga aggaggtgca cagtggggtc tgcacagacc cgcagcccct caaggagcag 540

cccgccctca atgactccag atacgctctg agcagccgcc tgagggtctc ggccaccttc 600

tggcaggacc cccgcaacca cttccgctgt caagtccagt tctacgggct ctcggagaat 660

gacgagtgga cccaggatag ggccaaaccc gtcacccaga tcgtcagcgc cgaggcctgg 720

ggtagagcag ac 732

<210>30

<211>252

<212>PRT

<213> Artificial sequence

<220>

<223> Single-chain TCR

<400>30

Ala Ile Leu Asn Val Glu Gln Ser Pro Gln Ser Leu His Val Gln Glu

1 5 10 15

Gly Asp Ser Val Asn Ile Thr Cys Ser Phe Pro Ser Ser Asn Phe Tyr

20 25 30

Ala Leu His Trp Tyr Arg Trp Glu Thr Ala Lys Ser Pro Glu Ala Leu

35 40 45

Phe Val Met Thr Leu Asn Gly Asp Glu Lys Lys Lys Gly Arg Ile Ser

50 55 60

Ala Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr Leu Tyr Ile Lys Arg

65 70 75 80

Val Gln Pro Glu Asp Ser Ala Thr Tyr Leu Cys Ala Phe Pro Ser Gly

85 90 95

Gly Gly Ala Asp Gly Leu Thr Phe Gly Lys Gly Thr His Leu Met Ile

100 105 110

Gln Pro Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser

115 120 125

Glu Gly Gly Gly Ser Glu Gly Gly Thr Gly Asp Ser Gly Val Thr Gln

130 135 140

Thr Pro Lys His Leu Ser Val Ala Thr Gly Gln Arg Val Thr Leu Arg

145 150 155 160

Cys Ser Pro Arg Ser Gly Asp Leu Ser Val Tyr Trp Tyr Gln Gln Ser

165 170 175

Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln Tyr Tyr Asn Gly Glu Glu

180 185 190

Arg Ala Lys Gly Asn Ile Pro Glu Arg Phe Ser Ala Gln Gln Phe Pro

195 200 205

Asp Leu His Ser Glu Leu Asn Ile Ser Ser Val Glu Pro Gly Asp Ser

210 215 220

Ala Leu Tyr Phe Cys Ala Ser Ser Val Glu Gly Tyr Pro Ser Tyr Glu

225 230 235 240

Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Leu

245 250

<210>31

<211>756

<212>DNA

<213> Artificial sequence

<220>

<223> Single-chain TCR

<400>31

gctattctta atgttgaaca gagcccgcaa tctctgcatg tgcaggaagg tgatagtgtt 60

aacatcacct gctcctttcc gagctctaat ttctatgcgc tgcactggta ccgctgggaa 120

accgcgaaaa gcccggaagc cctgtttgtc atgacgctga acggtgacga gaaaaagaaa 180

ggccgcattt cagccaccct gaatacgaaa gaaggttatt cgtacctgta tatcaaacgt 240

gttcagccgg aagatagcgc aacctatctg tgtgcttttc cgtctggcgg tggcgcagac 300

ggtctgacct tcggtaaagg cacgcatctg atgattcaac cgggtggcgg ttcagaaggc 360

ggtggctcgg aaggtggcgg tagcgaaggc ggtggctctg aaggtggcac cggtgattca 420

ggcgtgaccc agacgccgaa acacctgtct gtcgcgaccg gtcaacgtgt gacgctgcgt 480

tgcagtccgc gttccggtga tctgtcagtt tactggtatc agcaatcgct ggaccagggc 540

ctgcaattcc tgattcagta ttacaacggt gaagaacgcg caaaaggcaa tatcccggaa 600

cgttttagtg ctcagcaatt cccggatctg cattccgaac tgaatatcag ttccgttgaa 660

ccgggtgaca gtgcgctgta tttttgtgcc tcatcggtcg aaggctaccc gagctatgaa 720

cagtacttcggtccgggcac ccgtctgacg gttctg 756

<210>32

<211>114

<212>PRT

<213> Artificial sequence

<220>

<223> Single-chain TCR alpha chain

<400>32

Ala Ile Leu Asn Val Glu Gln Ser Pro Gln Ser Leu His Val Gln Glu

1 5 10 15

Gly Asp Ser Val Asn Ile Thr Cys Ser Phe Pro Ser Ser Asn Phe Tyr

20 25 30

Ala Leu His Trp Tyr Arg Trp Glu Thr Ala Lys Ser Pro Glu Ala Leu

35 40 45

Phe Val Met Thr Leu Asn Gly Asp Glu Lys Lys Lys Gly Arg Ile Ser

50 55 60

Ala Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr Leu Tyr Ile Lys Arg

65 70 75 80

Val Gln Pro Glu Asp Ser Ala Thr Tyr Leu Cys Ala Phe Pro Ser Gly

85 90 95

Gly Gly Ala Asp Gly Leu Thr Phe Gly Lys Gly Thr His Leu Met Ile

100 105 110

Gln Pro

<210>33

<211>342

<212>DNA

<213> Artificial sequence

<220>

<223> Single-chain TCR alpha chain

<400>33

gctattctta atgttgaaca gagcccgcaa tctctgcatg tgcaggaagg tgatagtgtt 60

aacatcacct gctcctttcc gagctctaat ttctatgcgc tgcactggta ccgctgggaa 120

accgcgaaaa gcccggaagc cctgtttgtc atgacgctga acggtgacga gaaaaagaaa 180

ggccgcattt cagccaccct gaatacgaaa gaaggttatt cgtacctgta tatcaaacgt 240

gttcagccgg aagatagcgc aacctatctg tgtgcttttc cgtctggcgg tggcgcagac 300

ggtctgacct tcggtaaagg cacgcatctg atgattcaac cg 342

<210>34

<211>114

<212>PRT

<213> Artificial sequence

<220>

<223> Single chain TCR beta chain

<400>34

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ser Val Ala Thr Gly

1 5 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu GluArg Ala Lys Gly Asn Ile Pro Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Ile Ser Ser

65 70 75 80

Val Glu Pro Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Val Glu

85 90 95

Gly Tyr Pro Ser Tyr Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr

100 105 110

Val Leu

<210>35

<211>342

<212>DNA

<213> Artificial sequence

<220>

<223> Single chain TCR beta chain

<400>35

gattcaggcg tgacccagac gccgaaacac ctgtctgtcg cgaccggtca acgtgtgacg 60

ctgcgttgca gtccgcgttc cggtgatctg tcagtttact ggtatcagca atcgctggac 120

cagggcctgc aattcctgat tcagtattac aacggtgaag aacgcgcaaa aggcaatatc 180

ccggaacgtt ttagtgctca gcaattcccg gatctgcatt ccgaactgaa tatcagttcc 240

gttgaaccgg gtgacagtgc gctgtatttt tgtgcctcat cggtcgaagg ctacccgagc 300

tatgaacagt acttcggtcc gggcacccgt ctgacggttc tg 342

<210>36

<211>24

<212>PRT

<213> Artificial sequence

<220>

<223> Single-chain TCR linker sequence

<400>36

Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly

1 5 10 15

Gly Gly Ser Glu Gly Gly Thr Gly

20

<210>37

<211>72

<212>DNA

<213> Artificial sequence

<220>

<223> Single-chain TCR linker sequence

<400>37

ggtggcggtt cagaaggcgg tggctcggaa ggtggcggta gcgaaggcgg tggctctgaa 60

ggtggcaccg gt 72

Claims (36)

1. A T Cell Receptor (TCR), wherein the TCR is capable of binding to the KVLEYVIKV-HLA a0201 complex; and, the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:

αCDR1-SSNFYA (SEQ ID NO:10)

αCDR2-MTLNGDE (SEQ ID NO:11)

alpha CDR3-AFPSGGGADGLT (SEQ ID NO: 12); and

the 3 complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGDLS (SEQ ID NO:13)

βCDR2-YYNGEE (SEQ ID NO:14)

βCDR3-ASSVEGYPSYEQY (SEQ ID NO:15)。

2. a TCR as claimed in claim 1 which comprises a TCR α chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1 and a TCR β chain variable domain; and/or the TCR β chain variable domain is identical to SEQ ID NO:5 an amino acid sequence having at least 90% sequence identity.

3. A TCR as claimed in claim 1 which comprises the amino acid sequence of the α chain variable domain SEQ id no: 1.

4. A TCR as claimed in claim 1 which comprises the β chain variable domain amino acid sequence SEQ id No. 5.

5. A TCR as claimed in claim 1 which is an α β heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.

6. A TCR as claimed in claim 5 wherein the α chain amino acid sequence of the TCR is SEQ ID NO:3 and/or the beta chain amino acid sequence of the TCR is SEQ ID NO 7.

7. A TCR as claimed in any one of claims 1 to 4 which is soluble.

8. A TCR as claimed in claim 7 which is single chain.

9. A TCR as claimed in claim 8 which is formed by the α chain variable domain linked to the β chain variable domain by a peptide linker sequence.

10. A TCR as claimed in claim 9 which has one or more mutations in the alpha chain variable region amino acid 11, 13, 19, 21, 53, 76, 89, 91 or 94 and/or the alpha chain J gene short peptide amino acid penultimate 3, penultimate 5 or penultimate 7 position; and/or the TCR has one or more mutations in beta chain variable region amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 th, and/or beta chain J gene short peptide amino acid penultimate 2,4 or 6 th, wherein the amino acid position numbering is according to the position numbering listed in IMGT (international immunogenetic information system).

11. A TCR as claimed in claim 10 wherein the α chain variable domain amino acid sequence of the TCR comprises SEQ ID No. 32 and/or the β chain variable domain amino acid sequence of the TCR comprises SEQ ID No. 34.

12. A TCR as claimed in claim 11 which has the amino acid sequence SEQ ID No. 30.

13. A TCR as claimed in claim 7 which comprises (a) all or part of the TCR α chain, excluding the transmembrane domain; and (b) all or part of a TCR β chain, excluding the transmembrane domain;

and (a) and (b) each comprise a functional variable domain.

14. A TCR as claimed in claim 13 wherein (a) and (b) each further comprise at least a portion of the constant domain of the TCR chain.

15. A TCR as claimed in claim 13 or claim 14 wherein the cysteine residues form an artificial disulphide bond between the α and β chain constant domains of the TCR.

16. A TCR as claimed in claim 15 wherein the cysteine residues which form the artificial disulphide bond in the TCR are substituted at one or more groups selected from:

thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;

tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC 2x 01;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;

ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;

arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;

pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and

tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.

17. A TCR as claimed in claim 16 wherein the α chain amino acid sequence of the TCR is SEQ ID No. 26 and/or the β chain amino acid sequence of the TCR is SEQ ID No. 28.

18. A TCR as claimed in claim 13 which comprises an artificial interchain disulphide bond between the α chain variable region and the β chain constant region of the TCR.

19. A TCR as claimed in claim 18 wherein the cysteine residues which form the artificial interchain disulphide bond in the TCR are substituted at one or more groups selected from:

amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01;

amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC 2x 01;

amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC 2x 01 exon 1; or

Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01.

20. A TCR as claimed in claim 18 or claim 19 which comprises the α chain variable domain and the β chain variable domain and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the α chain constant domain, the α chain variable domain of the TCR forming a heterodimer with the β chain.

21. A TCR as claimed in claim 1 wherein a conjugate is attached to the C-or N-terminus of the α and/or β chains of the TCR.

22. A TCR as claimed in claim 21 wherein the conjugate to which the TCR is bound is a detectable label, a therapeutic agent, a PK modifying moiety or a combination thereof.

23. A TCR as claimed in claim 22 wherein the therapeutic agent is an anti-CD 3 antibody.

24. A multivalent TCR complex comprising at least two TCR molecules, and wherein at least one TCR molecule is a TCR as claimed in any one of claims 1 to 23.

25. A nucleic acid molecule comprising a nucleic acid sequence encoding a TCR according to any one of claims 1 to 23, or the complement thereof.

26. The nucleic acid molecule of claim 25, comprising the nucleotide sequence encoding the TCR α chain variable domain of SEQ ID NO:2 or SEQ ID NO: 33.

27. The nucleic acid molecule of claim 25 or 26, comprising the nucleotide sequence of SEQ ID NO:6 or SEQ ID NO 35.

28. The nucleic acid molecule of claim 25, comprising the nucleotide sequence encoding a TCR α chain of seq id NO:4 and/or comprises the nucleotide sequence encoding the TCR β chain SEQ ID NO: 8.

29. a vector comprising the nucleic acid molecule of any one of claims 25-28.

30. The vector of claim 29, wherein said vector is a viral vector.

31. The vector of claim 30, wherein said vector is a lentiviral vector.

32. An isolated host cell comprising the vector or chromosome of any one of claims 29-31 and wherein the exogenous nucleic acid molecule of any one of claims 25-28 is integrated into the host cell.

33. A cell transduced with the nucleic acid molecule of any one of claims 25 to 28 or the vector of any one of claims 29 to 31.

34. The cell of claim 33, wherein the cell is a T cell or a stem cell.

35. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to any one of claims 1 to 23, a TCR complex according to claim 24, a nucleic acid molecule according to any one of claims 25 to 28, or a cell according to claim 33 or 34.

36. Use of a TCR as claimed in any one of claims 1 to 23, or a TCR complex as claimed in claim 24 or a cell as claimed in claim 33 or 34, in the manufacture of a medicament for the treatment of a tumour.

Images