CN106831978B - T cell receptor recognizing PRAME antigen - Google Patents

Abstract

The present invention provides a T Cell Receptor (TCR) capable of specifically binding to short peptide PYLGQMINL derived from PRAME antigen, the antigen short peptide PYLGQMINL being complexed with HLA a2402 and presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Description

T cell receptor recognizing PRAME antigen

Technical Field

The present invention relates to a TCR capable of recognising a short peptide derived from the PRAME antigen, and to PRAME specific T cells obtained by transduction of such TCRs, and their use in the prevention and treatment of PRAME related diseases.

Background

PRAME is a melanoma specific antigen (PRAME) that is expressed in 88% of primary and 95% of metastatic melanomas (Ikeda H, equivalent. immunity,1997,6(2): 199-. PRAME is degraded into small polypeptides after intracellular production and is presented on the cell surface as a complex by binding to MHC (major histocompatibility complex) molecules. PYLGQMINL is a short peptide derived from the PRAME antigen, which is a target for the treatment of PRAME related diseases. In addition to melanoma, PRAME is expressed in a variety of tumors including lung squamous cell carcinoma, breast cancer, renal cell carcinoma, head and neck tumors, Hodgkin's lymphoma, sarcoma, medulloblastoma, etc. (van't Veer LJ, et al Nature,2002,415(6871): 530-. For the treatment of the above diseases, chemotherapy, radiotherapy and the like can be used, but both of them cause damages to normal cells themselves.

T cell adoptive immunotherapy is the transfer of reactive T cells specific for a target cell antigen into a patient to act on the target cell. The T Cell Receptor (TCR) is a membrane protein on the surface of T cells that recognizes a corresponding short peptide antigen on the surface of a target cell. In the immune system, the direct physical contact between T cells and Antigen Presenting Cells (APC) is initiated by the binding of antigen short peptide specific TCR and short peptide-major histocompatibility complex (pMHC complex), and then other cell membrane surface molecules of the T cells and APC interact to cause a series of subsequent cell signaling and other physiological reactions, so that T cells with different antigen specificities exert immune effects on their target cells. Therefore, those skilled in the art have made an effort to isolate a TCR specific for the NY-ESO-1 antigen short peptide and to transduce the TCR into T cells to obtain T cells specific for the NY-ESO-1 antigen short peptide, thereby allowing them to play a role in cellular immunotherapy.

Disclosure of Invention

The invention aims to provide a T cell receptor for recognizing PRAME antigen short peptide.

In a first aspect of the invention, there is provided a T Cell Receptor (TCR) capable of binding to the PYLGQMINL-HLAA2402 complex.

In another preferred embodiment, the TCR comprises a TCR α chain variable domain and a TCR β chain variable domain, the amino acid sequence of the CDR3 of the TCR α chain variable domain is AGPTGAGSYQL (SEQ ID NO:12), and/or the amino acid sequence of the CDR3 of the TCR β chain variable domain is ASSGTSGINEQF (SEQ ID NO: 15).

In another preferred embodiment, the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:

αCDR1-SIFNT(SEQ ID NO:10)

αCDR2-LYKAGEL(SEQ ID NO:11)

α CDR3-AGPTGAGSYQL (SEQ ID NO:12), and/or

The 3 complementarity determining regions of the variable domain of TCR β chain are:

βCDR1-SGDLS(SEQ ID NO:13)

βCDR2-YYNGEE(SEQ ID NO:14)

βCDR3-ASSGTSGINEQF(SEQ ID NO:15)。

in another preferred embodiment, the TCR comprises a TCR α chain variable domain and a TCR β chain variable domain, the TCR α chain variable domain being an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1, and/or the TCR β chain variable domain being an amino acid sequence having at least 90% sequence identity to SEQ ID No. 5.

In another preferred embodiment, the TCR comprises the α chain variable domain amino acid sequence SEQ ID NO 1.

In another preferred embodiment, the TCR comprises the β chain variable domain amino acid sequence SEQ ID NO 5.

In another preferred embodiment, the TCR is an αβ heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.

In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO. 3 and/or the β chain amino acid sequence of the TCR is SEQ ID NO. 7.

In another preferred embodiment, the TCR is soluble.

In another preferred embodiment, the TCR is single chain.

In another preferred embodiment, the TCR is comprised of the α chain variable domain linked to the β chain variable domain by a peptide linker sequence.

In another preferred embodiment, the TCR has one or more mutations in α chain variable region amino acid position 11, 13, 19, 21, 53, 76, 89, 91, or 94 and/or α chain J gene short peptide amino acid position 3 last, 5 last or 7 last and/or the TCR has one or more mutations in β chain variable region amino acid position 11, 13, 19, 21, 53, 76, 89, 91 or 94 and/or β chain J gene short peptide amino acid position 2 last, 4 last or 6 last, wherein the amino acid position numbering is according to the position numbering listed in IMGT (International immunogenetics information System).

In another preferred embodiment, the α chain variable domain amino acid sequence of the TCR comprises SEQ ID NO. 32 and/or the β chain variable domain amino acid sequence of the TCR comprises SEQ ID NO. 34.

In another preferred embodiment, the amino acid sequence of the TCR is SEQ ID NO 30.

In another preferred embodiment, the TCR comprises (a) all or part of a TCR α chain except for the transmembrane domain and (b) all or part of a TCR β chain except for the transmembrane domain;

and (a) and (b) each comprise a functional variable domain, or comprise a functional variable domain and at least a portion of the TCR chain constant domain.

In another preferred example, cysteine residues form an artificial disulfide bond between the α and β chain constant domains of the TCR.

In another preferred embodiment, the cysteine residues forming the artificial disulfide bond in the TCR are substituted at one or more groups of sites selected from the group consisting of:

thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;

tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;

ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;

arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;

pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and

tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.

In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO. 26 and/or the β chain amino acid sequence of the TCR is SEQ ID NO. 28.

In another preferred embodiment, the TCR comprises an artificial interchain disulfide bond between the α chain variable region and the β chain constant region.

In another preferred embodiment, the cysteine residues that form the artificial interchain disulfide bond in the TCR replace one or more groups of sites selected from the group consisting of:

amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC2 x 01 exon 1; or

Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01.

In another preferred embodiment, the TCR comprises α and β chain variable domains and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the α chain constant domain, the α chain variable domain of the TCR forming a heterodimer with the β chain.

In another preferred embodiment, the TCR has a conjugate attached to the C-or N-terminus of chain α and/or chain β.

In another preferred embodiment, the conjugate that binds to the T cell receptor is a detectable label, a therapeutic agent, a PK modifying moiety or a combination of any of these. Preferably, the therapeutic agent is an anti-CD 3 antibody.

In a second aspect of the invention, there is provided a multivalent TCR complex comprising at least two TCR molecules, and wherein at least one of the TCR molecules is a TCR according to the first aspect of the invention.

In a third aspect of the invention, there is provided a nucleic acid molecule comprising a nucleic acid sequence encoding a TCR molecule according to the first aspect of the invention, or the complement thereof.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO 2 or SEQ ID NO 33 encoding the variable domain of the TCR α chain.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO 6 or SEQ ID NO 35 encoding the variable domain of the TCR β chain.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO. 4 encoding the TCR α chain and/or comprises the nucleotide sequence SEQ ID NO. 8 encoding the TCR β chain.

In a fourth aspect of the invention, there is provided a vector comprising a nucleic acid molecule according to the third aspect of the invention; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector.

In a fifth aspect of the invention, there is provided an isolated host cell comprising a vector according to the fourth aspect of the invention or a genome into which has been integrated an exogenous nucleic acid molecule according to the third aspect of the invention.

In a sixth aspect of the invention, there is provided a cell which transduces a nucleic acid molecule according to the third aspect of the invention or a vector according to the fourth aspect of the invention; preferably, the cell is a T cell or a stem cell.

In a seventh aspect of the invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to the first aspect of the invention, a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention.

In an eighth aspect, the invention provides the use of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, for the manufacture of a medicament for the treatment of a tumour or an autoimmune disease.

In a ninth aspect of the invention, there is provided a method of treating a disease comprising administering to a subject in need thereof an amount of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, or a pharmaceutical composition according to the seventh aspect of the invention;

preferably, the disease is a tumor, preferably the tumor includes melanoma, lung squamous cell carcinoma, breast cancer, renal cell carcinoma, head and neck tumors, hodgkin's lymphoma, sarcoma, medulloblastoma, leukemia (including but not limited to acute lymphoblastic leukemia, acute myeloblastic leukemia), melanoma, and other solid tumors such as gastric cancer, lung cancer, esophageal cancer, bladder cancer, head and neck squamous cell carcinoma, prostate cancer, breast cancer, colon cancer, ovarian cancer, and the like.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1a, FIG. 1b, FIG. 1c, FIG. 1d, FIG. 1e and FIG. 1f are the TCR α chain variable domain amino acid sequence, TCR α chain variable domain nucleotide sequence, TCR α chain amino acid sequence, TCR α chain nucleotide sequence, TCR α chain amino acid sequence with leader sequence and TCR α chain nucleotide sequence with leader sequence, respectively.

FIG. 2a, FIG. 2b, FIG. 2c, FIG. 2d, FIG. 2e and FIG. 2f are the TCR β chain variable domain amino acid sequence, TCR β chain variable domain nucleotide sequence, TCR β chain amino acid sequence, TCR β chain nucleotide sequence, TCR β chain amino acid sequence with leader sequence and TCR β chain nucleotide sequence with leader sequence, respectively.

FIG. 3 is CD8 of monoclonal cells⁺And tetramer-PE double positive staining results.

Fig. 4a and 4b are the amino acid and nucleotide sequences, respectively, of a soluble TCR α chain.

Fig. 5a and 5b are the amino acid and nucleotide sequences, respectively, of a soluble TCR β chain.

Figure 6 is a gel diagram of the soluble TCR obtained after purification. The leftmost lane is reducing gel, the middle lane is molecular weight marker (marker), and the rightmost lane is non-reducing gel (.

FIGS. 7a and 7b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR.

Fig. 8a and 8b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR α chain.

Fig. 9a and 9b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR β chain.

FIGS. 10a and 10b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR linker sequence (linker).

FIG. 11 is a gel diagram of the soluble single chain TCR obtained after purification. The left lane is the molecular weight marker (marker) and the right lane is the non-reducing gel.

FIG. 12 is a BIAcore kinetic profile of binding of soluble TCRs of the invention to the PYLGQMINL-HLA A2402 complex.

FIG. 13 shows that the T cells of the NC group without TCR lentiviral infection were free of P83-tetramer-PE positive cells after staining with P83-tetramer-PE and anti-CD8 antibody, whereas T cells infected with TCR lentiviral appeared to be TCR expressing P83-tetramer-PE positive cells with only a small number of non-specific positive cells when staining with other tetramer-PE than P83-tetramer-PE.

FIG. 14 shows that effector cells transduced with a TCR of the invention are able to react with target cells loaded with a specific short peptide to release more IFN-. gamma.whereas control groups not transduced with a TCR of the invention release only a minimal amount of IFN-. gamma.and that effector cells transduced with a TCR of the invention are less reactive with target cells loaded with a non-specific short peptide to release minimal amounts of IFN-. gamma..

FIG. 15 shows that effector cells transduced with the TCR of the invention have strong killing of target cells loaded with specific short peptides and no killing of target cells not loaded with short peptides or loaded with nonspecific short peptides.

Detailed Description

The present inventors have made extensive and intensive studies to find a TCR capable of specifically binding to PRAME antigen short peptide PYLGQMINL (SEQ ID NO:9), which antigen short peptide PYLGQMINL can form a complex with HLA A2402 and be presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Term(s) for

MHC molecules are proteins of the immunoglobulin superfamily, which may be MHC class I or class II molecules. Therefore, it is specific for antigen presentation, different individuals have different MHC, and different short peptides in one protein antigen can be presented on the cell surface of respective APC. Human MHC is commonly referred to as an HLA gene or HLA complex.

The T Cell Receptor (TCR), is the only receptor for a specific antigenic peptide presented on the Major Histocompatibility Complex (MHC). In the immune system, direct physical contact between T cells and Antigen Presenting Cells (APCs) is initiated by the binding of antigen-specific TCRs to pMHC complexes, and then other cell membrane surface molecules of both T cells and APCs interact, which causes a series of subsequent cell signaling and other physiological reactions, thereby allowing T cells of different antigen specificities to exert immune effects on their target cells.

TCR is a glycoprotein on the surface of cell membranes which consists of α/β or γ/δ chains in the form of heterodimers, in 95% of T cells TCR heterodimers consist of β and β 1 chains, while 5% of T cells have TCRs consisting of γ and δ chains native β 3 β heterodimer TCR has β and β chains, β and β chains constituting subunits of α β heterodimeric TCR. broadly, each of α and β chains comprises a variable region, a connecting region and a constant region, β chains usually also contain a short variable region between the variable and connecting regions, but the variable region is usually considered part of the connecting region. each variable region comprises 3 CDRs (complementarity determining regions) which are chimeric in a framework structure (work domains), CDR1, CDR2 and CDR 3. CDR regions determine the binding of the TCR complex to pMHC, wherein the variable region and CDR 29 are composed of variable and constant regions, known as imk domains, and the variable region is known as the TCR α -variable region, TCR 80 domain, the variable region is usually found as a TCR domain of a TCR α -variable region linked to a TCR-variable region, and TCR-variable domain of a TCR-variable domain which is known as a TCR-variable domain linked to a TCR-variable domain.

In the present invention, the terms "polypeptide of the invention", "TCR of the invention", "T cell receptor of the invention" are used interchangeably.

Natural interchain disulfide bond and artificial interchain disulfide bond

A set of disulfide bonds exists between the membrane proximal region C α and the C β chain of a native TCR, and are referred to herein as "native interchain disulfide bonds.

For convenience of description of the positions of disulfide bonds, the positions of the amino acid sequences of TRAC 01 and TRBC1 × 01 or TRBC2 × 01 are numbered in the order from the N-terminus to the C-terminus, such as in TRBC1 × 01 or TRBC2 × 01, and the 60 th amino acid in the order from the N-terminus to the C-terminus is P (proline), and thus in the present invention it can be described as Pro60 of TRBC1 × 01 or TRBC2 × 01 exon 1, and also as the 60 th amino acid of TRBC1 × 01 or TRBC2 × 01 exon 1, and as in 737bc 3 × 01 or TRBC2 × 01, and the 61 th amino acid in the order from the N-terminus to the C-terminus is Q (glutamine), and thus in the present invention it can be described as TRBC1 × 01 or TRBC 6301 × 01, or TRBC 8501, and similarly as TRBC 8261 or glbc 891. In the present invention, the position numbering of the amino acid sequences of the variable regions TRAV and TRBV follows the position numbering listed in IMGT. If an amino acid in TRAV, the position listed in IMGT is numbered 46, it is described herein as the 46 th amino acid of TRAV, and so on. In the present invention, the sequence position numbers of other amino acids are specifically described.

Detailed Description

TCR molecules

In the course of antigen processing, antigens are degraded within cells and then carried to the cell surface by MHC molecules.t cell receptors are able to recognise peptide-MHC complexes on the surface of antigen presenting cells.accordingly, in a first aspect of the invention there is provided a TCR molecule which is capable of binding the PYLGQMINL-HLA a2402 complex.

In a preferred embodiment of the invention, the α chain of the TCR comprises CDRs having the amino acid sequence:

αCDR1-SIFNT(SEQ ID NO:10)

αCDR2-LYKAGEL(SEQ ID NO:11)

α CDR3-AGPTGAGSYQL (SEQ ID NO:12), and/or

The 3 complementarity determining regions of the variable domain of TCR β chain are:

βCDR1-SGDLS(SEQ ID NO:13)

βCDR2-YYNGEE(SEQ ID NO:14)

βCDR3-ASSGTSGINEQF(SEQ ID NO:15)。

the TCR molecules of the invention are thus defined as TCR molecules comprising the α and/or β chain CDR region sequences and any suitable framework structure, the TCR α chain variable domain of the invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID NO:1, and/or the TCR β chain variable domain of the invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID NO: 5.

In a preferred embodiment of the invention, the TCR molecule of the invention is a heterodimer of α and β chains, in particular, the α chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain on the one hand and the α chain variable domain amino acid sequence comprises the CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) of the α chain described above, preferably, the TCR molecule comprises the α chain variable domain amino acid sequence SEQ ID NO:1, more preferably, the α chain variable domain amino acid sequence of the TCR molecule is SEQ ID NO:1, and on the other hand, the β chain of the heterodimeric molecule comprises a variable domain and a constant domain, the β chain variable domain amino acid sequence comprises the CDR1(SEQ ID NO:13), CDR 48 (SEQ ID NO: 3914) and CDR3 (TCR ID NO:15) of the β chain, preferably, the TCR molecule comprises the variable domain amino acid sequence 5965 chain variable domain of the variable domain, more preferably, the TCR molecule is SEQ ID NO: 5965 chain variable domain.

In a preferred embodiment of the invention, the TCR molecule of the invention is a single chain TCR molecule consisting of part or all of the α chain and/or part or all of the β chain the description of single chain TCR molecules can be found in Chung et al (1994) Proc. Natl. Acad. Sci. USA 91, 12654. 12658 from the literature, the skilled person can readily construct single chain TCR molecules comprising the CDRs regions of the invention.

The α chain variable domain amino acid sequence of the single chain TCR molecule comprises CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) of the above-mentioned α chain preferably the single chain TCR molecule comprises α chain variable domain amino acid sequence SEQ ID NO:1 more preferably the α chain variable domain amino acid sequence of the single chain TCR molecule is SEQ ID NO:1 the β chain variable domain amino acid sequence of the single chain TCR molecule comprises CDR1(SEQ ID NO:13), CDR2(SEQ ID NO: 14) and CDR3(SEQ ID NO:15) of the above-mentioned β chain preferably the single chain TCR molecule comprises β chain variable domain amino acid sequence SEQ ID NO:5 more preferably the single chain TCR β chain variable domain amino acid sequence of the single chain TCR molecule is SEQ ID NO: 5.

For example, the constant domain sequence of the α chain of the TCR molecules of the invention can be "TRAC 01", the constant domain sequence of the β chain of the TCR molecules can be "TRBC 1" 01 "or" TRBC2 "01", the amino acid sequence given in TRAC 01 of the IMGT at position 53 is Arg, here indicated as Arg53 of TRAC 01 exon 1, and the rest of the way around, preferably, the amino acid sequence of the α chain of the TCR molecules of the invention is SEQ ID NO:3, and/or the amino acid sequence of the β chain is SEQ ID NO: 7.

Naturally occurring TCRs are membrane proteins that are stabilized by their transmembrane regions. Like immunoglobulins (antibodies) as antigen recognition molecules, TCRs can also be developed for diagnostic and therapeutic applications, where soluble TCR molecules are required. Soluble TCR molecules do not include their transmembrane regions. Soluble TCRs have a wide range of uses, not only for studying the interaction of TCRs with pmhcs, but also as diagnostic tools for detecting infections or as markers for autoimmune diseases. Similarly, soluble TCRs can be used to deliver therapeutic agents (e.g., cytotoxic or immunostimulatory compounds) to cells presenting a specific antigen, and in addition, soluble TCRs can be conjugated to other molecules (e.g., anti-CD 3 antibodies) to redirect T cells to target them to cells presenting a particular antigen. The invention also provides soluble TCRs specific for PRAME antigen short peptides.

In order to obtain a soluble TCR, the TCR of the invention may be a TCR in which an artificial disulfide bond is introduced between residues of a constant domain of the TCR, a cysteine residue may be substituted for another amino acid residue at a suitable site in the native TCR to form an artificial interchain disulfide bond, e.g., a cysteine residue substituted for Thr of exon 1 of TRAC 01 and a Ser of exon 1 of TRBC 01 or TRBC 01 to form a disulfide bond, and the other site in which a cysteine residue is introduced to form a disulfide bond may be a truncated Thr of exon 1 of TRAC 01 and a Ser of exon 1 of TRBC 01 or TRBC 01, a Tyr of exon 1 of TRAC 01 and a Ser of exon 1 of TRBC 01 or TRBC 01, a Thr of exon 1 of TRAC 01 and a TRBC 01 or a set of multiple amino acid residues of the TrBC 01, a multiple TrBC1 or Ser of the same, a TrBC 01, a TrBC1, a C01, a C1, a TrBC1, a C01, a TrBC1, a C1, a TrBC1, a C1, a TrBC, a C1, a T1, a C1, a T5, a T1, a C1, a T1, a C1.

As noted above, the TCRs of the invention may comprise an artificial disulfide bond introduced between the residues of the constant domains of its α and β chains it is noted that the constant domains may or may not contain the artificial disulfide bond introduced as described above and that the TCRs of the invention may each contain a TRAC constant domain sequence and a TRBC1 or TRBC2 constant domain sequence.

To obtain a soluble TCR, on the other hand, the TCR of the invention also includes a TCR having mutations in its hydrophobic core region, preferably mutations that increase the stability of the soluble TCR of the invention, as described in the patent publication WO2014/206304, such a TCR may have mutations in its following variable domain hydrophobic core positions (chain α and/or β) variable region amino acid positions 11, 13, 19, 21, 53, 76, 89, 91, 94, and/or α chain J gene (TRAJ) short peptide amino acid positions 3,5,7, and/or β chain J gene (TRBJ) short peptide amino acid positions 2,4,6, reciprocal of the amino acid positions, wherein the numbering of the amino acid sequences is as listed in the International Immunogenetic information System (IMGT).

The TCR with the mutated hydrophobic core region can be a stable soluble single-chain TCR formed by connecting α of the TCR and a variable domain of a β chain through a flexible peptide chain, and the flexible peptide chain can be any peptide chain suitable for connecting TCR α and β chain variable domains, for example, the single-chain soluble TCR constructed in the embodiment 4 of the invention has the α chain variable domain amino acid sequence of SEQ ID NO. 32, the coded nucleotide sequence of SEQ ID NO. 33, the β chain variable domain amino acid sequence of SEQ ID NO. 34 and the coded nucleotide sequence of SEQ ID NO. 35.

In addition, for stability, it is disclosed in 201510260322.4 that the introduction of an artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR can significantly improve the stability of the TCR, and therefore, an artificial interchain disulfide bond can also be included between the β chain variable region and the β chain constant region of the high affinity TCR of the present invention, specifically, the cysteine residue forming the artificial interchain disulfide bond between the β chain variable region and the β chain constant region of the TCR replaces amino acid 46 of TRAV and amino acid 60 of TRBC1 or TRBC2 exon 1, amino acid 47 of TRAV and amino acid 61 of TRBC 1.01 or TRBC2 exon 1, amino acid 46 of TRAV and amino acid 61 of TRBC 1.01 or TRBC2 exon 1, and amino acid 47 of TRAV and amino acid 61 of TRBC2 or TRBC 5801 exon 1, or the TCR 47 of TRAV and TRBC 24 or TRBC1 or the transmembrane domain may include at least part of a transmembrane variable domain (preferably, but may include a variant domain 867 or a portion of the variable domain of the variable region of the chain, and a variable domain of the variable region 865, preferably include a transmembrane chain, and a portion of the variable domain of the variable region of the chain of the β, which may include at least one of the transmembrane region 867 chain, preferably a portion of a transmembrane chain, and a variable region of the variable region 867 chain, and a variable region of the variable chain of the variable region of the chain (preferably, particularly, which may include a chain of the variable region of chain of the variable region of the.

The TCRs of the invention may also be provided in the form of multivalent complexes. Multivalent TCR complexes of the invention comprise polymers formed by association of two, three, four or more TCRs of the invention, such as might be produced as a tetramer using the tetrameric domain of p53, or a complex formed by association of a plurality of TCRs of the invention with another molecule. The TCR complexes of the invention can be used to track or target cells presenting a particular antigen in vitro or in vivo, and can also be used to generate intermediates for other multivalent TCR complexes having such applications.

The TCRs of the invention may be used alone or in covalent or other association, preferably covalently, with a conjugate. The conjugates include a detectable label (for diagnostic purposes, where the TCR is used to detect the presence of cells presenting the PYLGQMINL-HLA a2402 complex), a therapeutic agent, a PK (protein kinase) modifying moiety, or a combination of any of the above.

Detectable labels for diagnostic purposes include, but are not limited to: a fluorescent or luminescent label, a radioactive label, an MRI (magnetic resonance imaging) or CT (computed tomography) contrast agent, or an enzyme capable of producing a detectable product.

Therapeutic agents that may be associated or conjugated with the TCRs of the invention include, but are not limited to: 1. radionuclides (Koppe et al, 2005, Cancer metastasis reviews (Cancer metastasis) 24, 539); 2. biological toxins (Chaudhary et al, 1989, Nature 339, 394; Epel et al, 2002, Cancer Immunology and immunotherapy 51, 565); 3. cytokines such as IL-2 and the like (Gillies et al, 1992, Proc. Natl. Acad. Sci. USA (PNAS)89, 1428; Card et al, 2004, Cancer Immunology and immunotherapy (Cancer Immunology and Immunotherapy)53, 345; Halin et al, 2003, Cancer Research (Cancer Research)63, 3202); 4. antibody Fc fragment (Mosquera et al, 2005, Journal Of Immunology 174, 4381); 5. antibody scFv fragments (Zhu et al, 1995, International Journal of Cancer 62,319); 6. gold nanoparticles/nanorods (Lapotko et al, 2005, Cancer letters 239, 36; Huang et al, 2006, Journal of the American Chemical Society 128, 2115); 7. viral particles (Peng et al, 2004, Gene therapy 11, 1234); 8. liposomes (Mamot et al, 2005, Cancer research 65, 11631); 9. nano magnetic particles; 10. prodrug activating enzymes (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 11. chemotherapeutic agents (e.g., cisplatin) or nanoparticles in any form, and the like.

In addition, the TCRs of the invention may also be hybrid TCRs comprising sequences derived from more than one species. For example, studies have shown that murine TCRs are more efficiently expressed in human T cells than human TCRs. Thus, the inventive TCR may comprise a human variable domain and a murine constant domain. The drawback of this approach is the possibility of eliciting an immune response. Thus, there should be a regulatory regimen to immunosuppresse when it is used for adoptive T cell therapy to allow for the engraftment of murine expressing T cells.

It should be understood that the amino acid names herein are expressed in terms of international single-letter or three-letter english letters, and the single-letter english letter and three-letter english letters of the amino acid names correspond to the following relationships: ala (A), Arg (R), Asn (N), Asp (D), Cys (C), Gln (Q), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y) and Val (V).

Nucleic acid molecules

A second aspect of the invention provides a nucleic acid molecule encoding a TCR molecule of the first aspect of the invention or a portion thereof which may be a variable domain of one or more of the CDRs, &lttt translation = α "&gtt α &/t &gtt and/or β chains, and the α chain and/or β chain.

The nucleotide sequence encoding the α chain CDR regions of the TCR molecule of the first aspect of the invention is as follows:

αCDR1-agcatatttaacacc(SEQ ID NO:16)

αCDR2-ttatataaggctggtgaattg(SEQ ID NO:17)

αCDR3-gctgggcccactggggctgggagttaccaactc(SEQ ID NO:18)

the nucleotide sequence encoding the β chain CDR regions of the TCR molecule of the first aspect of the invention is as follows:

βCDR1-tctggagacctctct(SEQ ID NO:19)

βCDR2-tattataatggagaagag(SEQ ID NO:20)

βCDR3-gccagcagcgggactagcgggatcaatgagcagttc(SEQ ID NO:21)

thus, the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR α chain of the invention comprises SEQ ID NO 16, SEQ ID NO 17 and SEQ ID NO 18 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR β chain of the invention comprises SEQ ID NO 19, SEQ ID NO 20 and SEQ ID NO 21.

Preferably, the nucleotide sequence of the nucleic acid molecule of the invention does not comprise an intron but is capable of encoding a polypeptide of the invention, e.g. the nucleotide sequence of the nucleic acid molecule of the invention encoding a variable domain of the TCR α chain of the invention comprises SEQ ID NO 2 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding a variable domain of the TCR β chain of the invention comprises SEQ ID NO 6 or the nucleotide sequence of the nucleic acid molecule of the invention encoding a variable domain of the TCR α chain of the invention comprises SEQ ID NO 33 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding a variable domain of the TCR β chain of the invention comprises SEQ ID NO 35 more preferably the nucleotide sequence of the nucleic acid molecule of the invention comprises SEQ ID NO 4 and/or SEQ ID NO 8 or the nucleotide sequence of the nucleic acid molecule of the invention is SEQ ID NO 31.

It will be appreciated that, due to the degeneracy of the genetic code, different nucleotide sequences may encode the same polypeptide. Thus, the nucleic acid sequence encoding the TCR of the present invention may be identical to or a degenerate variant of the nucleic acid sequences shown in the figures of the present invention. As illustrated by one of the examples herein, a "degenerate variant" refers to a nucleic acid sequence that encodes a protein sequence having SEQ ID NO. 1, but differs from the sequence of SEQ ID NO. 2.

The nucleotide sequence may be codon optimized. Different cells differ in the utilization of specific codons, and the expression level can be increased by changing the codons in the sequence according to the type of the cell. Codon usage tables for mammalian cells as well as for various other organisms are well known to those skilled in the art.

The full-length sequence of the nucleic acid molecule of the present invention or a fragment thereof can be obtained by, but not limited to, PCR amplification, recombination, or artificial synthesis. At present, DNA sequences encoding the TCRs of the invention (or fragments or derivatives thereof) have been obtained entirely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. The DNA may be the coding strand or the non-coding strand.

Carrier

The invention also relates to vectors comprising the nucleic acid molecules of the invention, including expression vectors, i.e. constructs capable of expression in vivo or in vitro. Commonly used vectors include bacterial plasmids, bacteriophages and animal and plant viruses.

Viral delivery systems include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, baculoviral vectors.

Preferably, the vector can transfer the nucleotide of the invention into a cell, e.g., a T cell, such that the cell expresses a TCR specific for the PRAME antigen. Ideally, the vector should be capable of sustained high level expression in T cells.

Cells

The invention also relates to genetically engineered host cells that have been engineered with the vectors or coding sequences of the invention. The host cell comprises a vector of the invention or has integrated into its chromosome a nucleic acid molecule of the invention. The host cell is selected from: prokaryotic and eukaryotic cells, such as E.coli, yeast cells, CHO cells, and the like.

In addition, the invention also includes isolated cells, particularly T cells, that express the TCRs of the invention. The T cell may be derived from a T cell isolated from a subject, or may be part of a mixed population of cells isolated from a subject, such as a population of Peripheral Blood Lymphocytes (PBLs). For example, the cells may be isolated from Peripheral Blood Mononuclear Cells (PBMC), which may be CD4⁺Helper T cell or CD8⁺Cytotoxic T cells. The cell may be in CD4⁺Helper T cell/CD 8⁺A mixed population of cytotoxic T cells. Generally, the cells can be activated with an antibody (e.g., an anti-CD 3 or anti-CD 28 antibody) to render them more amenable to transfection, e.g., transfection with a vector comprising a nucleotide sequence encoding a TCR molecule of the invention.

Alternatively, the cell of the invention may also be or be derived from a stem cell, such as a Hematopoietic Stem Cell (HSC). Gene transfer to HSCs does not result in TCR expression on the cell surface, since the CD3 molecule is not expressed on the stem cell surface. However, when stem cells differentiate into lymphoid precursors (lymphoid precursors) that migrate to the thymus, expression of the CD3 molecule will initiate expression of the introduced TCR molecule on the surface of the thymocytes.

There are many methods suitable for T cell transfection using DNA or RNA encoding the TCR of the invention (e.g., Robbins et al, (2008) J.Immunol.180: 6116-. T cells expressing the TCRs of the invention may be used for adoptive immunotherapy. Those skilled in the art will be able to recognize many suitable methods for adoptive therapy (e.g., Rosenberg et al, (2008) Nat Revcancer8 (4): 299-308).

PRAME antigen associated diseases

The invention also relates to a method of treating and/or preventing a PRAME-associated disease in a subject comprising the step of adoptively transferring PRAME-specific T cells to the subject. The PRAME-specific T cells recognize PYLGQMINL-HLAA2402 complex.

The PRAME specific T cells of the invention may be used to treat any PRAME associated disease, such as a tumor, that presents the PRAME antigen short peptide PYLGQMINL-HLA a2402 complex. Such tumors include, but are not limited to, melanoma, squamous cell carcinoma of the lung, breast cancer, renal cell carcinoma, tumors of the head and neck, hodgkin's lymphoma, sarcoma, medulloblastoma, leukemia (including, but not limited to, acute lymphocytic leukemia, acute myelocytic leukemia), gastric cancer, lung cancer, esophageal cancer, bladder cancer, squamous cell carcinoma of the head and neck, prostate cancer, colon cancer, ovarian cancer, and the like.

Method of treatment

Treatment may be effected by isolating T cells from patients or volunteers suffering from a disease associated with the PRAME antigen and introducing the TCR of the invention into such T cells, followed by reinfusion of these genetically engineered cells into the patient. Accordingly, the present invention provides a method of treating a PRAME-related disease comprising infusing into a patient an isolated T cell expressing a TCR of the invention, preferably the T cell is derived from the patient per se. Generally, this involves (1) isolating T cells from the patient, (2) transducing T cells in vitro with a nucleic acid molecule of the invention or a nucleic acid molecule capable of encoding a TCR molecule of the invention, and (3) infusing the genetically modified T cells into the patient. The number of cells isolated, transfected and transfused can be determined by a physician.

The main advantages of the invention are:

(1) the inventive TCR can be combined with PRAME antigen short peptide complex PYLGQMINL-HLA A2402, and the cells transduced with the inventive TCR can be specifically activated and have strong killing effect on target cells.

The following specific examples further illustrate the invention. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not indicated in the following examples, are generally carried out according to conventional conditions, for example as described in Sambrook and Russell et al, Molecular Cloning: A laboratory Manual (third edition) (2001) CSHL Press, or according to the conditions as recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Example 1 cloning of PRAME antigen short peptide specific T cells

Peripheral Blood Lymphocytes (PBLs) from healthy volunteers of genotype HLA-A2402 were stimulated with synthetic short peptide PYLGQMINL (SEQ ID NO.: 9; Baisheng Gene technologies, Beijing). And renaturing PYLGQMINL short peptide and HLA-A2402 with biotin label to prepare pHLA haploid. These haploids were combined with streptavidin labeled with PE (BD Co.) to form PE-labeled tetramers, which were sorted for double positive anti-CD8-APC cells. The sorted cells were expanded and subjected to secondary sorting as described above, followed by single cloning by limiting dilution. Monoclonal cells were stained with tetramer and double positive clones were selected as shown in FIG. 3.

Example 2 construction of TCR Gene and vector for obtaining PRAME antigen short peptide specific T cell clone

Using Quick-RNA^TMMiniPrep (ZYMO research) extractorSynthesis of cDNA from the antigen short peptide PYLGQMINL-specific HLA-A2402-restricted T cell clone selected in example 1 the cDNA amplification kit of clontech SMART RACE was used, primers designed to the C-terminal conserved region of the human TCR gene were used, the sequence was cloned into the T vector (TAKARA) and sequenced, it should be noted that the sequence was complementary and contains no introns, and the sequence structures of the α and β chains of TCR expressed by the double positive clone were shown in FIGS. 1 and 2, respectively, the nucleotide sequences of TCR PYLGQMINL, TCR α, TCR α, α, TCR α, and TCR 633 with leader, respectively, the nucleotide sequences of TCR PYLGQMINL, TCR α, TCR α, TCR α, TCR α, and TCR β, TCR 8536, TCR 7375, and TCR 7378, respectively, the nucleotide sequences of TCR 6342, TCR 7375, and TCR 7378 chains of TCR α, respectively.

The α chain was identified as comprising CDRs having the amino acid sequences:

αCDR1-SIFNT(SEQ ID NO:10)

αCDR2-LYKAGEL(SEQ ID NO:11)

αCDR3-AGPTGAGSYQL(SEQ ID NO:12)

β chain contains CDRs having the amino acid sequences:

βCDR1-SGDLS(SEQ ID NO:13)

βCDR2-YYNGEE(SEQ ID NO:14)

βCDR3-ASSGTSGINEQF(SEQ ID NO:15)

respectively cloning the full-length genes of a TCR α chain and a TCR β chain to a lentivirus expression vector pLenti (addendum) by overlapping (overlap) PCR, specifically, connecting the full-length genes of a TCR α chain and a TCR β chain by overlapping PCR to obtain a TCR α -2A-TCR β fragment, carrying out enzyme digestion and connection on the lentivirus expression vector and the TCR α -2A-TCR β to obtain pLenti-TRA-2A-TRB-IRES-NGFR plasmid, serving as a control, and simultaneously constructing a lentivirus vector pLenti-eGFP for expressing eGFP, and then packaging pseudoviruses by 293T/17.

Example 3 expression, refolding and purification of PRAME antigen short peptide specific soluble TCR

To obtain soluble TCR molecules, chains α and β of the TCR molecules of the invention may comprise only their variable domains and part of the constant domains, respectively, and a cysteine residue is introduced in the constant domains of chains α and β, respectively, to form artificial interchain disulfide bonds, at the positions Thr48 of exon 1 TRAC 01 and Ser57 of exon 1 TRBC2, respectively, the amino acid sequence and nucleotide sequence of the α chain are shown in fig. 4a and 4b, respectively, the amino acid sequence and nucleotide sequence of β chain are shown in fig. 5a and 5b, respectively, the introduced cysteine residues are shown in bold and underlined, the gene sequences of the TCR α and β chains are inserted after synthesis into expression vectors (third edition, Sambrook and Russell), respectively, and the non-targeted fragments are inserted into novat sites 28a + without false Cloning, respectively, by standard methods described in Molecular Cloning laboratories handbook (Molecular Cloning).

The expression vectors of TCR α and β chains are transformed into expression bacteria BL21(DE3) by chemical transformation, respectively, and the bacteria are grown in LB culture solution and then in OD₆₀₀Inclusion bodies formed after expression of α and β chains of TCR were extracted by BugBuster Mix (Novagene) and washed repeatedly with BugBuster solution several times at 0.6 final induction with final concentration of 0.5mM IPTG, and finally dissolved in 6M guanidine hydrochloride, 10mM Dithiothreitol (DTT),10mM ethylenediaminetetraacetic acid (EDTA),20mM Tris (ph 8.1).

The dissolved TCR α and β chains were rapidly mixed in 5M urea, 0.4M arginine, 20mM Tris (pH8.1), 3.7mM cystamine,6.6mM β -mer capoethylamine (4 ℃) at a mass ratio of 1: 1, and the final concentration was 60mg/mL, after mixing, the solution was dialyzed (4 ℃) against 10 volumes of deionized water, after 12 hours the deionized water was changed to a buffer (20mM Tris, pH 8.0) and dialysis was continued at 4 ℃ for 12 hours, after the dialysis of the solution was completed, the solution was filtered through a 0.45. mu.M filter, purified by an anion exchange column (HiTrap Q HP,5ml, HeGE Healthcare), the TCR with the eluted peak containing the dimer α and β dimers which succeeded in the reproducibility was further purified by SDS-PAGE, the purity of the TCR was confirmed by gel filtration chromatography (HiCREP 16/60, Sephacryl S-100HR, HeGE TCR) and the purity of the purified TCR was more than 90%, as determined by PAGE-PAGE method, presented in the present invention.

Example 4 Generation of soluble Single chain TCR specific for PRAME antigen short peptides

According to the disclosure of WO2014/206304, the variable domains of TCR α and β chains in example 2 are constructed into a stable soluble single-chain TCR molecule connected by a flexible short peptide (linker) by site-directed mutagenesis, the amino acid sequence and the nucleotide sequence of the single-chain TCR molecule are respectively shown in FIGS. 7a and 7b, the amino acid sequence and the nucleotide sequence of α chain variable domain are respectively shown in FIGS. 8a and 8b, the amino acid sequence and the nucleotide sequence of β chain variable domain are respectively shown in FIGS. 9a and 9b, and the amino acid sequence and the nucleotide sequence of the linker sequence are respectively shown in FIGS. 10a and 10 b.

The target gene is subjected to double enzyme digestion by Nco I and Not I and is connected with a pET28a vector subjected to double enzyme digestion by Nco I and Not I, a ligation product is transformed into E.coli DH5 α, an LB plate containing kanamycin is coated, inverted culture is carried out overnight at 37 ℃, positive clones are selected for PCR screening, positive recombinants are sequenced, and after the sequence is determined to be correct, recombinant plasmids are extracted and transformed into E.coli BL21(DE3) for expression.

Example 5 expression, renaturation and purification of soluble Single chain TCR specific for the PRAME antigen short peptide

The BL21(DE3) colony containing the recombinant plasmid pET28 a-template strand prepared in example 4 was inoculated in its entirety into LB medium containing kanamycin, cultured at 37 ℃ to OD600 of 0.6 to 0.8, IPTG was added to a final concentration of 0.5mM, and the culture was continued at 37 ℃ for 4 hours. The cell pellet was harvested by centrifugation at 5000rpm for 15min, the cell pellet was lysed by Bugbuster Master Mix (Merck), inclusion bodies were recovered by centrifugation at 6000rpm for 15min, washed with Bugbuster (Merck) to remove cell debris and membrane components, and centrifuged at 6000rpm for 15min to collect the inclusion bodies. The inclusion bodies were dissolved in a buffer (20mM Tris-HClpH 8.0,8M urea), and the insoluble material was removed by high-speed centrifugation, and the supernatant was quantified by BCA method, and then dispensed, and stored at-80 ℃ for further use.

To 5mg of solubilized single-chain TCR inclusion body protein, 2.5mL of buffer (6M Gua-HCl, 50mM Tris-HCl pH8.1, 100mM NaCl, 10mM EDTA) was added, DTT was added to a final concentration of 10mM, treated at 37 ℃ for 30min, 125mL of renaturation buffer (100mM Tris-HCl pH8.1, 0.4M L-arginine, 5M urea, 2mM EDTA,6.5mM β -mercaptoethylamine, 1.87mM Cystamine) was added dropwise with the treated single-chain TCR using a syringe, stirred at 4 ℃ for 10min, the renaturation was then placed in a cellulose membrane dialysis bag with a cut-off of 4kDa, the dialysis bag was placed in 1L Trapa precooled water, slowly stirred overnight at 4 ℃ after 17 hours, the dialysate was changed to 1L of precooled buffer (20mM Tris-HCl pH 8.0), dialyzed for 8h at 4 ℃ after which the dialysate was changed to the same fresh buffer, the same, further purified by filtration on a Sephadex column, and eluted fraction containing fractions purified by a Sephadex-PAGE (0.52) and purified by a Sephadex gel column, and purified by SDS-PAGE, and purified by a Sephadex column, and purified fraction containing fraction of fraction containing SDS-Sephadex (SDS-Sephadex) was further purified by SDS-PAGE, purified by a fraction, purified by a gel column, purified by SDS-PAGE, purified by a gel column, and purified by a gel column chromatography, and a column.

The eluted fractions for BIAcore analysis were further tested for purity using gel filtration. The conditions are as follows: the chromatographic column Agilent Bio SEC-3(300A, phi 7.8X 300mM) and the mobile phase are 150mM phosphate buffer solution, the flow rate is 0.5mL/min, the column temperature is 25 ℃, and the ultraviolet detection wavelength is 214 nm.

The SDS-PAGE gel of the soluble single-chain TCR obtained by the invention is shown in FIG. 11.

Example 6 binding characterization

BIAcore analysis

This example demonstrates that soluble TCR molecules of the invention are capable of specifically binding to the PYLGQMINL-HLA a2402 complex.

The binding activity of the TCR molecules obtained in example 3 to the PYLGQMINL-HLAA2402 complex was tested using a BIAcore T200 real-time assay system. Anti-streptavidin antibody (GenScript) was added to coupling buffer (10mM sodium acetate buffer, pH 4.77), and then the antibody was passed through CM5 chip previously activated with EDC and NHS to immobilize the antibody on the chip surface, and finally the unreacted activated surface was blocked with ethanolamine hydrochloric acid solution to complete the coupling process at a coupling level of about 15,000 RU.

The low concentration of streptavidin was flowed over the antibody coated chip surface, then the PYLGQMINL-HLAA2402 complex was flowed over the detection channel, the other channel served as a reference channel, and 0.05mM biotin was flowed over the chip at a flow rate of 10. mu.L/min for 2min to block the remaining binding sites of streptavidin.

The PYLGQMINL-HLA A2402 complex is prepared as follows:

a. purification of

Collecting 100ml E.coli liquid for inducing expression of heavy chain or light chain, centrifuging at 4 ℃ for 10min at 8000g, washing the thalli once with 10ml PBS, then resuspending the thalli with 5ml BugBuster Master Mix Extraction Reagents (Merck) by vigorous shaking, rotatably incubating at room temperature for 20min, centrifuging at 4 ℃ for 15min at 6000g, discarding supernatant, and collecting inclusion body.

Resuspending the inclusion bodies in 5ml of BugBuster Master Mix, and rotary incubating at room temperature for 5 min; adding 30ml of 10-fold diluted BugBuster, uniformly mixing, and centrifuging at 4 ℃ at 6000g for 15 min; discarding the supernatant, adding 30ml of 10-fold diluted BugBuster to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, repeating twice, adding 30ml of 20mM Tris-HCl pH8.0 to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, finally dissolving the inclusion bodies by using 20mM Tris-HCl 8M urea, detecting the purity of the inclusion bodies by SDS-PAGE, and detecting the concentration by using a BCA kit.

b. Renaturation

The synthesized short peptide PYLGQMINL (Beijing Baisheng Gene technology Co., Ltd.) was dissolved in DMSO to a concentration of 20 mg/ml. Inclusion of light and heavy chains was solubilized with 8M Urea, 20mM Tris pH8.0, 10mM DTT and further denatured by addition of 3M guanidine hydrochloride, 10mM sodium acetate, 10mM EDTA prior to renaturation. PYLGQMINL peptide was added to a renaturation buffer (0.4M L-arginine, 100mM Tris pH 8.3, 2mM EDTA, 0.5mM oxidative glutathione, 5mM reduced glutathione, 0.2mM PMSF, cooled to 4 ℃) at 25mg/L (final concentration), followed by the addition of 20mg/L of light chain and 90mg/L of heavy chain in sequence (final concentration, heavy chain was added in three portions, 8 h/time), and renaturation was carried out at 4 ℃ for at least 3 days until completion, and SDS-PAGE checked for success or failure of the renaturation.

c. Purification after renaturation

The renaturation buffer was replaced by dialysis against 10 volumes of 20mM Tris pH8.0, at least twice to reduce the ionic strength of the solution sufficiently. After dialysis, the protein solution was filtered through a 0.45 μm cellulose acetate filter and then loaded onto a HiTrap Q HP (GE general electric) anion exchange column (5ml bed volume). Using Akta purifiers (GE general electric company), 20mM Tris pH8.0 prepared 0-400mM NaCl linear gradient elution protein, pMHC approximately 250mM NaCl elution, collecting the peak components, SDS-PAGE detection purity.

d. Biotinylation of the compound

The purified pMHC molecules were concentrated using Millipore ultrafiltration tubes while displacing the buffer to 20mM Tris pH8.0, followed by addition of biotinylation reagent 0.05M Bicine pH 8.3, 10mM ATP, 10mM MgOAc, 50. mu. M D-Biotin, 100. mu.g/ml BirA enzyme (GST-BirA), incubation of the mixture overnight at room temperature, and SDS-PAGE to determine the completion of biotinylation.

e. Purification of biotinylated complexes

The biotinylated pMHC molecules were concentrated to 1ml using Millipore ultrafiltration tubes, the biotinylated pMHC was purified by gel filtration chromatography, and HiPrep was pre-equilibrated with filtered PBS using Akta purifier (GE general electric Co., Ltd.)^TM16/60S200HR column (GE general electric) was loaded with 1ml of concentrated biotinylated pMHC molecules and then eluted with PBS at a flow rate of 1 ml/min. Biotinylated pMHC molecules appeared as a unimodal elution at approximately 55 ml. The fractions containing the protein were pooled, concentrated using Millipore ultrafiltration tubes, protein concentration was determined by BCA (Thermo), and biotinylated pMHC molecules were stored in aliquots at-80 ℃ by addition of the protease inhibitor cocktail (Roche).

Kinetic parameters were calculated using BIAcore Evaluation software, and the kinetic profiles of the binding of soluble TCR molecules of the invention to PYLGQMINL-HLA A2402 complex are shown in FIG. 12. The profile shows that the soluble TCR molecules obtained by the invention can be combined with PYLGQMINL-HLA A2402 complex. Meanwhile, the method is used for detecting the binding activity of the soluble TCR molecule and the short peptides of other unrelated antigens and the HLA complex, and the result shows that the TCR molecule is not bound with other unrelated antigens.

Example 7 transfection of PRAME TCR with PRAME specific T cell receptor Lentiviral packaging and Primary T cells

(a) Production of lentiviruses by Rapid-mediated transient transfection of 293T/17 cells

A third generation lentiviral packaging system was used to package lentiviruses containing the gene encoding the desired TCR. 293T/17 cells were transfected with 4 plasmids (a lentiviral vector containing pLenti-PRAME TRA-2A-TRB-IRES-NGFR as described In example 2, and 3 plasmids containing other components necessary for the construction of infectious but non-replicating lentiviral particles) using rapid-mediated transient transfection (Express-In-mediated transfection (open biosystems)).

(b) Transduction of primary T cells with lentiviruses containing PRAME-specific T cell receptor genes

CD8+ T cells were isolated from the blood of healthy volunteers and transduced with packaged lentiviruses. These cells were counted and incubated overnight in 48-well plates with 1 × 106 cells/ml (0.5 ml/well) in 1640 (gibbeco, cat # C11875500bt) medium containing 10% FBS (gibbeco, cat # C10010500BT) containing 50IU/ml IL-2 and 10ng/ml IL-7 with pre-washed anti-CD 3/CD28 antibody-coated beads (T cell amplicons, lifetechnologies, cat # 11452D), cells: bead 3: 1.

(c) tetramer staining of TCR transduced primary T cells

The PRAME P83254-262PYLGQMINL short peptide is renatured with HLA-A2402 with biotin label to prepare pHLA haploid. These haplotypes were combined with PE-labeled streptavidin (BD) into a PE-labeled tetramer, designated P83-tetramer-PE. This tetramer can label T cells expressing the PRAME specific T cell receptor gene as positive cells. Incubating the transfected T cell sample of (b) with P83-tetramer-PE on ice for 30min, adding anti-CD8-APC (biolegend) antibody, and further incubating on ice for 15 min. Samples were washed 2 times with PBS containing 2% FBS and P83-tetramer-PE and CD8 double positive T cells expressing the PRAME specific T cell receptor gene were detected OR sorted using bdcalbur OR BD Arial and data analysis was analyzed using CellQuest software (BD) OR FlowJo software (Tree Star Inc, Ashland, OR).

As a result of assay analysis, as shown in FIG. 13, after staining with P83-tetramer-PE and anti-CD8 antibody, the T cells of the NC group without TCR lentiviral infection were free from P83-tetramer-PE positive cells, while the T cells infected with TCR lentiviral exhibited P83-tetramer-PE positive cells expressing TCR, and when staining with other tetramer-PE than P83-tetramer-PE, there were only a few non-specific positive cells.

Example 8 activation of Effector cells transducing TCRs of the invention

ELISPOT scheme

The following assay was performed to demonstrate activation of TCR-transduced T cells in response specifically to target cells. IFN-. gamma.production as measured by the ELISPOT assay was used as a readout for T cell activation.

Reagent

Test medium: 10% FBS (Gibbo, catalog number 16000-

Washing buffer solution: 0.01M PBS/0.05% Tween 20

PBS (Gibbo Co., catalog number C10010500BT)

PVDF ELISPOT 96-well plate (Merck Millipore, Cat. No. MSIPS4510)

Human IFN-. gamma.ELISPOT PVDF-enzyme kit (BD) contains all other reagents required (capture and detection antibody, streptavidin-alkaline phosphatase and BCIP/NBT solution)

Method of producing a composite material

Target cell preparation

The target cells of this example were Epstein-Barr virus (EBV) transformed immortalized Lymphoblastoid Cell Lines (LCLs). B95-8 cells were induced to produce EBV-containing culture supernatants by phorbol myristate acetate (TPA), centrifuged at 4 deg.C/600 g for 10min to remove impurities, filtered through 0.22 μm filter, and aliquoted for-70 deg.C storage. From Peripheral Blood Lymphocytes (PBLs) of healthy volunteers of HLA-A11/A02/A24 (including homozygote and heterozygote), 10ml of PBL suspension with a concentration of 2X 107/ml is taken in a 25 cm square culture flask, cyclosporine is added, the mixture is incubated for 1 hour in a 37 ℃/CO2 incubator, an EBV is quickly thawed, an EBV is added into the cells by 1/10 dilution, the mixture is gently shaken and the culture flask is vertically placed in the 37 ℃/CO2 incubator for culture. After 12 days of culture, 10ml of medium was added to continue the culture, and after about 30 days, the culture was further expanded and flow-tested, wherein CD19+ CD23hicD58+ is immortalized Lymphoblastoid Cell Line (LCL). The ELISPOT assay uses HLA-A24 as the target cell.

Effector cell preparation

The effector cells (T cells) of this experiment were CD8+ T cells expressing PRAME-specific TCR analyzed in example 7, and CD8+ T cells from the same volunteer were used as negative control effector cells. T cells were stimulated with anti-CD 3/CD28 coated beads (T cell amplicons, life technologies), transduced with lentiviruses carrying the PRAME specific TCR gene (according to example 3), expanded in 1640 medium containing 10% FBS with 50IU/ml IL-2 and 10ng/ml IL-7 until 9-12 days post transduction, then placed in assay medium and washed by centrifugation at 300g for 10min at RT. The cells were then resuspended in the test medium at 2 × the desired final concentration. Negative control effector cells were treated as well.

ELISPOT

The well plate was prepared as follows according to the manufacturer's instructions: 10ml of sterile PBS per plate 1: anti-human IFN-. gamma.capture antibody was diluted at 200, and 100. mu.l of the diluted capture antibody was aliquoted into each well. The plates were incubated overnight at 4 ℃. After incubation, the well plates were washed to remove excess capture antibody. 100 μ l/well of RPMI1640 medium containing 10% FBS was added and the well plates were incubated at room temperature for 2 hours to close the well plates. The media was then washed from the well plate, and any residual wash buffer was removed by flicking and tapping the ELISPOT well plate on paper.

PRAME CD8+ T cells (PRAME TCR transduced T cells, effector cells), CD8+ T cells (negative control effector cells) and LCL-A02/24 (target cells), and corresponding short peptides were added to the corresponding experimental groups, wherein P83 is PRAME P83254-262PYLGQMINL short peptidePeptides, P84 and P_XIs a non-PRAME TCR specific binding short peptide.

The components of the assay were then added to ELISPOT well plates in the following order:

77000 cells/ml of 130 microliters of target cells (resulting in a total of about 10000 target cells/well).

50 microliter of effector cells (1000 PRAME TCR positive T cells).

20 microliter 10^-4Mole/liter PRAME P83254-262 PYLGQMINL/P84/P_XShort peptide solution (final concentration of 10)^-5Moles/liter).

All wells were made in triplicate for addition.

The plates were then incubated overnight (37 ℃/5% CO2) for the next day, the medium was discarded, the plates were washed 2 times with double distilled water and 3 times with wash buffer, and tapped on a paper towel to remove residual wash buffer. Primary antibody was then detected by dilution with PBS containing 10% FBS and added to each well at 100. mu.l/well. The well plate was incubated at room temperature for 2 hours, washed 3 times with wash buffer and the well plate was tapped on a paper towel to remove excess wash buffer.

PBS containing 10% FBS was used at 1: streptavidin-alkaline phosphatase was diluted 10000, 100 microliters of diluted streptavidin-alkaline phosphatase was added to each well and the wells were incubated for 1 hour at room temperature. The plate was then washed 3 times with wash buffer and 2 times with PBS, and the excess wash buffer and PBS was removed by tapping the plate on a paper towel. After washing, 100 microliter of BCIP/NBT solution provided by the kit is added for development. And covering the well plate with tinfoil paper in the developing period, keeping the well plate in the dark, and standing for 5-15 minutes. Spots on the developing plate were routinely detected during this period to determine the optimum time for terminating the reaction. The BCIP/NBT solution was removed and the well plate was rinsed with double-distilled water to stop the development reaction, spun-dried, then the bottom of the well plate was removed, the well plate was dried at room temperature until each well was completely dried, and then the spots formed in the bottom film of the well plate were counted using an immune spot plate counter (CTL, cell technology limited).

Results

PRAME TCR transduced T cells were tested for IFN- γ release in response to both PRAME P83254-262PYLGQMINL short peptide-loaded target cells and non-specific short peptide-loaded target cells by the ELISPOT assay (described above). The number of ELSPOT spots observed in each well was plotted using graphpadprist 6.

The results are shown in FIG. 14, and show that the effector cells transduced the TCR of the invention can react with the target cells loaded with the specific short peptide to release more IFN-gamma, while the control group not transduced the TCR of the invention can release only a very small amount of IFN-gamma, and the effector cells transduced the TCR of the invention have very low reactivity with the target cells loaded with the non-specific short peptide to release a very small amount of IFN-gamma.

Example 9 killing of effector cells transduced with a TCR of the invention

This test is a colorimetric substitution test for the 51Cr release cytotoxicity test, and quantitatively determines Lactate Dehydrogenase (LDH) released after cell lysis. LDH released in the medium was detected using a 30min coupled enzymatic reaction in which LDH converted a tetrazolium salt (INT) to red formazan (formazan). The amount of red product produced is proportional to the number of cells lysed. 490nm visible absorbance data can be collected using a standard 96-well plate reader.

Material

CytoTox

Non-radioactive cytotoxicity assays (Promega, G1780) contained a substrate mixture, assay buffer, lysis solution and stop buffer.

Test medium: 10% FBS (heat-inactivated, Gibbo, Cat. No. 16000-.

Microwell round bottom 96 well tissue culture plates (Nunc, Cat. No. 163320)

96-well immunoplate Maxisorb (Nunc, Cat. No. 442404)

Method of producing a composite material

Target cell preparation

Target cells for use in the assayThe LCL is prepared as described above for the target cells in the ELISPOT protocol. Target cells were prepared in assay medium: the concentration of the target cells is adjusted to 3X 10⁵One/ml, 50. mu.l/well to obtain 1.5X 10⁴Individual cells/well.

Effector cell preparation

The effector cells (T cells) of this assay were CD8+ T cells that were analyzed for expression of PRAME-specific TCR in example 7. Ratio of effector cells to target cells 1: 1 (3X 10)⁵One/ml, 50. mu.l/well to obtain 1.5X 10⁴Individual cells/well).

Preparation of short peptide solution

The PRAME P83254-262PYLGQMINL (or P63 and P47 two non-specific short peptides) short peptide is diluted to 10 times by 10 times dilution method with 10% FBS-containing RPMI1640 culture medium^-5M-10^-11M range, the final concentration gradient after addition to the experimental group was 10^-6M-10^-12M is greater than or equal to the total weight of the composition.

(a) Detection of killing capability of effector cells by loading target cells with short peptides at different concentrations

Preparation of the test

The components of the assay were added to a microwell round bottom 96 well tissue culture plate in the following order:

50ul of target cells (prepared as described above) were added to each well

50ul of effector cells (prepared as described above) were added to each well

-12ul of the short peptide solution was added to each well

8ul culture supplement wells (20 ul medium was directly supplemented to the experimental group without short peptide load).

A control group was prepared as follows:

experimental group without short peptide loading: contains 50ul effector cells and 50ul target cells.

Effector cells release spontaneously: there were only 50ul of effector cells.

Target cells release: there are only 50ul of target cells.

Maximum release of target cells: there are only 50ul of target cells.

Reagent medium control: only 120ul of medium was present.

All wells were made in triplicate with a final volume of 120ul (insufficient media make-up).

Incubate at 37 ℃ for 24 hours. Before collecting the supernatants from all wells, the target cells maximum release control wells were placed on the cells at-70 ℃ for approximately 30 minutes and thawed at 37 ℃ for 15 minutes to allow total lysis of the target cells.

The plate was centrifuged at 250g for 4 min. 50ul of supernatant from each well of the assay plate was transferred to the corresponding well of a 96-well immunoplate Maxisorb plate. The substrate mixture was reconstituted with assay buffer (12ml) and 50ul was added to each well of the plate. The plate was covered and incubated in the dark at room temperature for 30 minutes. 50ul of stop solution was added to each well of the plate to stop the reaction. The absorbance at 490nm was recorded counted over 1 hour after addition of the stop solution.

Calculation results

The absorbance values of the medium background were subtracted from all the absorbance values of the experimental, target cell spontaneous release and effector cell spontaneous release groups.

The corrected values obtained above were substituted into the following formula to calculate the percent cytotoxicity resulting from each effect-to-target ratio.

% cytotoxicity 100 × (experiment-effector cell spontaneous-target cell spontaneous)/(target cell maximal-target cell spontaneous)

Results

The TCR-transduced T cells of the invention were tested for LDH release in response to target cells loaded with PRAMEP 83254-262PYLGQMINL short peptide and non-specific short peptide by a non-radioactive cytotoxicity assay (as described above). The absorbance of 490nm visible light in each well was plotted using graphpad prism 6.

The statistical results of the experimental data are shown in fig. 15, and the effector cells transduced the TCR of the present invention have a strong killing effect on the target cells loaded with the specific short peptide, and have no killing effect on the target cells not loaded with the short peptide or loaded with the non-specific short peptide.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Guangzhou biomedical and health research institute of Chinese academy of sciences

<120> T cell receptor recognizing PRAME antigen

<130>P2016-2020

<150>CN201510890467.2

<151>2015-12-04

<160>37

<170>PatentIn version 3.5

<210>1

<211>118

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> TCR α chain variable Domain

<400>1

Gly Gln Gln Leu Asn Gln Ser Pro Gln Ser Met Phe Ile Gln Glu Gly

1 5 10 15

Glu Asp Val Ser Met Asn Cys Thr Ser Ser Ser Ile Phe Asn Thr Trp

20 25 30

Leu Trp Tyr Lys Gln Asp Pro Gly Glu Gly Pro Val Leu Leu Ile Ala

35 40 45

Leu Tyr Lys Ala Gly Glu Leu Thr Ser Asn Gly Arg Leu Thr Ala Gln

50 55 60

Phe Gly Ile Thr Arg Lys Asp Ser Phe Leu Asn Ile Ser Ala Ser Ile

65 70 75 80

Pro Ser Asp Val Gly Ile Tyr Phe Cys Ala Gly Pro Thr Gly Ala Gly

85 90 95

Ser Tyr Gln Leu Thr Phe Gly Lys Gly Thr Lys Leu Ser Val Ile Pro

100 105 110

Asn Ile Gln Asn Pro Asp

115

<210>2

<211>354

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> TCR α chain variable Domain

<400>2

ggtcaacagc tgaatcagag tcctcaatct atgtttatcc aggaaggaga agatgtctcc 60

atgaactgca cttcttcaag catatttaac acctggctat ggtacaagca ggaccctggg 120

gaaggtcctg tcctcttgat agccttatat aaggctggtg aattgacctc aaatggaaga 180

ctgactgctc agtttggtat aaccagaaag gacagcttcc tgaatatctc agcatccata 240

cctagtgatg taggcatcta cttctgtgct gggcccactg gggctgggag ttaccaactc 300

actttcggga aggggaccaa actctcggtc ataccaaata tccagaaccc tgac 354

<210>3

<211>253

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> TCR α chain

<400>3

Gly Gln Gln Leu Asn Gln Ser Pro Gln Ser Met Phe Ile Gln Glu Gly

1 5 10 15

Glu Asp Val Ser Met Asn Cys Thr Ser Ser Ser Ile Phe Asn Thr Trp

20 25 30

Leu Trp Tyr Lys Gln Asp Pro Gly Glu Gly Pro Val Leu Leu Ile Ala

35 40 45

Leu Tyr Lys Ala Gly Glu Leu Thr Ser Asn Gly Arg Leu Thr Ala Gln

50 55 60

Phe Gly Ile Thr Arg Lys Asp Ser Phe Leu Asn Ile Ser Ala Ser Ile

65 70 75 80

Pro Ser Asp Val Gly Ile Tyr Phe Cys Ala Gly Pro Thr Gly Ala Gly

85 90 95

Ser Tyr Gln Leu Thr Phe Gly Lys Gly Thr Lys Leu Ser Val Ile Pro

100 105 110

Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys

115 120 125

Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr

130 135 140

Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr

145 150 155 160

Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala

165 170 175

Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser

180 185 190

Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp

195 200 205

Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe

210 215 220

Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala

225 230 235 240

Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser

245 250

<210>4

<211>759

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> TCR α chain

<400>4

ggtcaacagc tgaatcagag tcctcaatct atgtttatcc aggaaggaga agatgtctcc 60

atgaactgca cttcttcaag catatttaac acctggctat ggtacaagca ggaccctggg 120

gaaggtcctg tcctcttgat agccttatat aaggctggtg aattgacctc aaatggaaga 180

ctgactgctc agtttggtat aaccagaaag gacagcttcc tgaatatctc agcatccata 240

cctagtgatg taggcatcta cttctgtgct gggcccactg gggctgggag ttaccaactc 300

actttcggga aggggaccaa actctcggtc ataccaaata tccagaaccc tgaccctgcc 360

gtgtaccagc tgagagactc taaatccagt gacaagtctg tctgcctatt caccgatttt 420

gattctcaaa caaatgtgtc acaaagtaag gattctgatg tgtatatcac agacaaaact 480

gtgctagaca tgaggtctat ggacttcaag agcaacagtg ctgtggcctg gagcaacaaa 540

tctgactttg catgtgcaaa cgccttcaac aacagcatta ttccagaaga caccttcttc 600

cccagcccag aaagttcctg tgatgtcaag ctggtcgaga aaagctttga aacagatacg 660

aacctaaact ttcaaaacct gtcagtgatt gggttccgaa tcctcctcct gaaagtggcc 720

gggtttaatc tgctcatgac gctgcggctg tggtccagc 759

<210>5

<211>112

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> TCR β chain variable Domain

<400>5

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr Ala Thr Gly

1 5 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Leu Ser Ser

65 70 75 80

Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Gly Thr

85 90 95

Ser Gly Ile Asn Glu Gln Phe Phe Gly Pro Gly Thr Arg Leu Thr Val

100 105 110

<210>6

<211>336

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> TCR β chain variable Domain

<400>6

gattctggag tcacacaaac cccaaagcac ctgatcacag caactggaca gcgagtgacg 60

ctgagatgct cccctaggtc tggagacctc tctgtgtact ggtaccaaca gagcctggac 120

cagggcctcc agttcctcat tcagtattat aatggagaag agagagcaaa aggaaacatt 180

cttgaacgat tctccgcaca acagttccct gacttgcact ctgaactaaa cctgagctct 240

ctggagctgg gggactcagc tttgtatttc tgtgccagca gcgggactag cgggatcaat 300

gagcagttct tcgggccagg gacacggctc accgtg 336

<210>7

<211>292

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> TCR β chain

<400>7

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr Ala Thr Gly

1 5 10 15

Gln Arg Val ThrLeu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Leu Ser Ser

65 70 75 80

Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Gly Thr

85 90 95

Ser Gly Ile Asn Glu Gln Phe Phe Gly Pro Gly Thr Arg Leu Thr Val

100 105 110

Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu

115 120 125

Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys

130 135 140

Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val

145 150 155 160

Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu

165 170 175

Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg

180 185 190

Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg

195 200 205

Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln

210 215 220

Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly

225 230 235 240

Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu

245 250 255

Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr

260 265 270

Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys

275 280 285

Asp Ser Arg Gly

290

<210>8

<211>876

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> TCR β chain

<400>8

gattctggag tcacacaaac cccaaagcac ctgatcacag caactggaca gcgagtgacg 60

ctgagatgctcccctaggtc tggagacctc tctgtgtact ggtaccaaca gagcctggac 120

cagggcctcc agttcctcat tcagtattat aatggagaag agagagcaaa aggaaacatt 180

cttgaacgat tctccgcaca acagttccct gacttgcact ctgaactaaa cctgagctct 240

ctggagctgg gggactcagc tttgtatttc tgtgccagca gcgggactag cgggatcaat 300

gagcagttct tcgggccagg gacacggctc accgtgctag aggacctgaa aaacgtgttc 360

ccacccgagg tcgctgtgtt tgagccatca gaagcagaga tctcccacac ccaaaaggcc 420

acactggtgt gcctggccac aggcttctac cccgaccacg tggagctgag ctggtgggtg 480

aatgggaagg aggtgcacag tggggtcagc acagacccgc agcccctcaa ggagcagccc 540

gccctcaatg actccagata ctgcctgagc agccgcctga gggtctcggc caccttctgg 600

cagaaccccc gcaaccactt ccgctgtcaa gtccagttct acgggctctc ggagaatgac 660

gagtggaccc aggatagggc caaacctgtc acccagatcg tcagcgccga ggcctggggt 720

agagcagact gtggcttcac ctccgagtct taccagcaag gggtcctgtc tgccaccatc 780

ctctatgaga tcttgctagg gaaggccacc ttgtatgccg tgctggtcag tgccctcgtg 840

ctgatggcca tggtcaagag aaaggattcc agaggc 876

<210>9

<211>9

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> antigen short peptide

<400>9

Pro Tyr Leu Gly Gln Met Ile Asn Leu

15

<210>10

<211>5

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223>α CDR1

<400>10

Ser Ile Phe Asn Thr

1 5

<210>11

<211>7

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223>α CDR2

<400>11

Leu Tyr Lys Ala Gly Glu Leu

1 5

<210>12

<211>11

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223>α CDR3

<400>12

Ala Gly Pro Thr Gly Ala Gly Ser Tyr Gln Leu

1 5 10

<210>13

<211>5

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223>β CDR1

<400>13

Ser Gly Asp Leu Ser

1 5

<210>14

<211>6

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223>β CDR2

<400>14

Tyr Tyr Asn Gly Glu Glu

1 5

<210>15

<211>12

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223>β CDR3

<400>15

Ala Ser Ser Gly Thr Ser Gly Ile Asn Glu Gln Phe

1 5 10

<210>16

<211>15

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223>α CDR1

<400>16

agcatattta acacc 15

<210>17

<211>21

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223>α CDR2

<400>17

ttatataagg ctggtgaatt g 21

<210>18

<211>33

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223>α CDR3

<400>18

gctgggccca ctggggctgg gagttaccaa ctc 33

<210>19

<211>15

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223>β CDR1

<400>19

tctggagacc tctct 15

<210>20

<211>18

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223>β CDR2

<400>20

tattataatg gagaagag 18

<210>21

<211>36

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223>β CDR3

<400>21

gccagcagcg ggactagcgg gatcaatgag cagttc 36

<210>22

<211>271

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> TCR α chain with leader sequence

<400>22

Met Leu Leu Glu His Leu Leu Ile Ile Leu Trp Met Gln Leu Thr Trp

1 5 10 15

Val Ser Gly Gln Gln Leu Asn Gln Ser Pro Gln Ser Met Phe Ile Gln

20 25 30

Glu Gly Glu Asp Val Ser Met Asn Cys Thr Ser Ser Ser Ile Phe Asn

35 40 45

Thr Trp Leu Trp Tyr Lys Gln Asp Pro Gly Glu Gly Pro Val Leu Leu

50 55 60

Ile Ala Leu Tyr Lys Ala Gly Glu Leu Thr Ser Asn Gly Arg Leu Thr

65 70 75 80

Ala Gln Phe Gly Ile Thr Arg Lys Asp Ser Phe Leu Asn Ile Ser Ala

85 90 95

Ser Ile Pro Ser Asp Val Gly Ile Tyr Phe Cys Ala Gly Pro Thr Gly

100105 110

Ala Gly Ser Tyr Gln Leu Thr Phe Gly Lys Gly Thr Lys Leu Ser Val

115 120 125

Ile Pro Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp

130 135 140

Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser

145 150 155 160

Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp

165 170 175

Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala

180 185 190

Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn

195 200 205

Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser

210 215 220

Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu

225 230 235 240

Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys

245 250 255

Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser

260 265 270

<210>23

<211>813

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> TCR α chain with leader sequence

<400>23

atgctccttg aacatttatt aataatcttg tggatgcagc tgacatgggt cagtggtcaa 60

cagctgaatc agagtcctca atctatgttt atccaggaag gagaagatgt ctccatgaac 120

tgcacttctt caagcatatt taacacctgg ctatggtaca agcaggaccc tggggaaggt 180

cctgtcctct tgatagcctt atataaggct ggtgaattga cctcaaatgg aagactgact 240

gctcagtttg gtataaccag aaaggacagc ttcctgaata tctcagcatc catacctagt 300

gatgtaggca tctacttctg tgctgggccc actggggctg ggagttacca actcactttc 360

gggaagggga ccaaactctc ggtcatacca aatatccaga accctgaccc tgccgtgtac 420

cagctgagag actctaaatc cagtgacaag tctgtctgcc tattcaccga ttttgattct 480

caaacaaatg tgtcacaaag taaggattct gatgtgtata tcacagacaa aactgtgcta 540

gacatgaggt ctatggactt caagagcaac agtgctgtgg cctggagcaa caaatctgac 600

tttgcatgtg caaacgcctt caacaacagc attattccag aagacacctt cttccccagc 660

ccagaaagtt cctgtgatgt caagctggtc gagaaaagct ttgaaacaga tacgaaccta 720

aactttcaaa acctgtcagt gattgggttc cgaatcctcc tcctgaaagt ggccgggttt 780

aatctgctca tgacgctgcg gctgtggtcc agc 813

<210>24

<211>311

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> TCR β chain with leader sequence

<400>24

Met Gly Phe Arg Leu Leu Cys Cys Val Ala Phe Cys Leu Leu Gly Ala

1 5 10 15

Gly Pro Val Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr

20 25 30

Ala Thr Gly Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp

35 40 45

Leu Ser Val Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe

50 55 60

Leu Ile Gln Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu

65 70 75 80

Glu Arg Phe Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn

85 90 95

Leu Ser Ser Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser

100 105 110

Ser Gly Thr Ser Gly Ile Asn Glu Gln Phe Phe Gly Pro Gly Thr Arg

115 120 125

Leu Thr Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala

130 135 140

Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr

145 150 155 160

Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser

165 170 175

Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro

180 185 190

Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu

195 200 205

Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn

210 215 220

His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu

225 230 235 240

Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu

245 250 255

Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln

260 265 270

Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala

275 280 285

Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val

290 295 300

Lys Arg Lys Asp Ser Arg Gly

305 310

<210>25

<211>933

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> TCR β chain with leader sequence

<400>25

atgggcttca ggctcctctg ctgtgtggcc ttttgtctcc tgggagcagg cccagtggat 60

tctggagtca cacaaacccc aaagcacctg atcacagcaa ctggacagcg agtgacgctg 120

agatgctccc ctaggtctgg agacctctct gtgtactggt accaacagag cctggaccag 180

ggcctccagt tcctcattca gtattataat ggagaagaga gagcaaaagg aaacattctt 240

gaacgattct ccgcacaaca gttccctgac ttgcactctg aactaaacct gagctctctg 300

gagctggggg actcagcttt gtatttctgt gccagcagcg ggactagcgg gatcaatgag 360

cagttcttcg ggccagggac acggctcacc gtgctagagg acctgaaaaa cgtgttccca 420

cccgaggtcg ctgtgtttga gccatcagaa gcagagatct cccacaccca aaaggccaca 480

ctggtgtgcc tggccacagg cttctacccc gaccacgtgg agctgagctg gtgggtgaat 540

gggaaggagg tgcacagtgg ggtcagcaca gacccgcagc ccctcaagga gcagcccgcc 600

ctcaatgact ccagatactg cctgagcagc cgcctgaggg tctcggccac cttctggcag 660

aacccccgca accacttccg ctgtcaagtc cagttctacg ggctctcgga gaatgacgag 720

tggacccagg atagggccaa acctgtcacc cagatcgtca gcgccgaggc ctggggtaga 780

gcagactgtg gcttcacctc cgagtcttac cagcaagggg tcctgtctgc caccatcctc 840

tatgagatct tgctagggaa ggccaccttg tatgccgtgc tggtcagtgc cctcgtgctg 900

atggccatgg tcaagagaaa ggattccaga ggc 933

<210>26

<211>206

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> soluble TCR α chain

<400>26

Gly Gln Gln Leu Asn Gln Ser Pro Gln Ser Met Phe Ile Gln Glu Gly

1 5 10 15

Glu Asp Val Ser Met Asn Cys Thr Ser Ser Ser Ile Phe Asn Thr Trp

20 25 30

Leu Trp Tyr Lys Gln Asp Pro Gly Glu Gly Pro Val Leu Leu Ile Ala

35 40 45

Leu Tyr Lys Ala Gly Glu Leu Thr Ser Asn Gly Arg Leu Thr Ala Gln

50 55 60

Phe Gly Ile Thr Arg Lys Asp Ser Phe Leu Asn Ile Ser Ala Ser Ile

65 70 75 80

Pro Ser Asp Val Gly Ile Tyr Phe Cys Ala Gly Pro Thr Gly Ala Gly

85 90 95

Ser Tyr Gln Leu Thr Phe Gly Lys Gly Thr Lys Leu Ser Val Ile Pro

100 105 110

Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys

115 120 125

Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr

130 135 140

Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Cys

145 150 155 160

Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala

165 170 175

Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser

180 185 190

Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser

195 200 205

<210>27

<211>618

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> soluble TCR α chain

<400>27

ggccagcagc tgaaccagag tcctcaatct atgtttatcc aggaaggaga agatgtctcc 60

atgaactgca cttcttcaag catatttaac acctggctat ggtacaagca ggaccctggg 120

gaaggtcctg tcctcttgat agccttatat aaggctggtg aattgacctc aaatggaaga 180

ctgactgctc agtttggtat aaccagaaag gacagcttcc tgaatatctc agcatccata 240

cctagtgatg taggcatcta cttctgtgct gggcccactg gggctgggag ttaccaactc 300

actttcggga aggggaccaa actctcggtc ataccaaata tccagaaccc tgaccctgcc 360

gtgtaccagc tgagagactc taagtcgagt gacaagtctg tctgcctatt caccgatttt 420

gattctcaaa caaatgtgtc acaaagtaag gattctgatg tgtatatcac agacaaatgt 480

gtgctagaca tgaggtctat ggacttcaag agcaacagtg ctgtggcctg gagcaacaaa 540

tctgactttg catgtgcaaa cgccttcaac aacagcatta ttccagaaga caccttcttc 600

cccagcccag aaagttcc 618

<210>28

<211>243

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> soluble TCR β chain

<400>28

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr Ala Thr Gly

1 5 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Leu Ser Ser

65 70 75 80

Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Gly Thr

85 90 95

Ser Gly Ile Asn Glu Gln Phe Phe Gly Pro Gly Thr Arg Leu Thr Val

100 105 110

Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu

115 120 125

Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys

130 135 140

Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val

145 150 155 160

Asn Gly Lys Glu Val His Ser Gly Val Cys Thr Asp Pro Gln Pro Leu

165 170 175

Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Ala Leu Ser Ser Arg

180 185 190

Leu Arg Val Ser Ala Thr Phe Trp Gln Asp Pro Arg Asn His Phe Arg

195 200 205

Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln

210 215 220

Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly

225 230 235 240

Arg Ala Asp

<210>29

<211>729

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> soluble TCR β chain

<400>29

gatagcggcg tgacccaaac cccaaagcac ctgatcacag caactggaca gcgagtgacg 60

ctgagatgct cccctaggtc tggagacctc tctgtgtact ggtaccaaca gagcctggac 120

cagggcctcc agttcctcat tcagtattat aatggagaag agagagcaaa aggaaacatt 180

cttgaacgat tctccgcaca acagttccct gacttgcact ctgaactaaa cctgagctct 240

ctggagctgg gggactcagc tttgtatttc tgtgccagca gcgggactag cgggatcaat 300

gagcagttct tcgggccagg gacacggctc accgtgctag aggacctgaa aaacgtgttc 360

ccacccgagg tcgctgtgtt tgagccatca gaagcagaga tctcccacac ccaaaaggcc 420

acactggtgt gcctggccac cggtttctac cccgaccacg tggagctgag ctggtgggtg 480

aatgggaagg aggtgcacag tggggtctgc acagacccgc agcccctcaa ggagcagccc 540

gccctcaatg actccagata cgctctgagc agccgcctga gggtctcggc caccttctgg 600

caggaccccc gcaaccactt ccgctgtcaa gtccagttct acgggctctc ggagaatgac 660

gagtggaccc aggatagggc caaacccgtc acccagatcg tcagcgccga ggcctggggt 720

agagcagac 729

<210>30

<211>249

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> Single-chain TCR

<400>30

Gly Gln Gln Leu Asn Gln Ser Pro Gln Ser Leu Asn Ile Gln Glu Gly

1 5 10 15

Glu Asp Val Ser Ile Asn Cys Thr Ser Ser Ser Ile Phe Asn Thr Trp

20 25 30

Leu Trp Tyr Lys Gln Asp Pro Gly Glu Gly Pro Val Leu Leu Ile Ala

35 40 45

Leu Tyr Lys Ala Gly Glu Leu Thr Ser Asn Gly Arg Leu Thr Ala Gln

50 55 60

Phe Gly Ile Thr Arg Lys Asp Ser Ser Leu Asn Ile Ser Asp Val Gln

65 70 75 80

Pro Ser Asp Val Gly Ile Tyr Phe Cys Ala Gly Pro Thr Gly Ala Gly

85 90 95

Ser Tyr Gln Leu Thr Phe Gly Lys Gly Thr Lys Leu Ser ValThr Pro

100 105 110

Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly

115 120 125

Gly Gly Ser Glu Gly Gly Thr Gly Asp Ser Gly Val Thr Gln Thr Pro

130 135 140

Lys His Leu Ser Val Ala Thr Gly Gln Arg Val Thr Leu Arg Cys Ser

145 150 155 160

Pro Arg Ser Gly Asp Leu Ser Val Tyr Trp Tyr Gln Gln Ser Leu Asp

165 170 175

Gln Gly Leu Gln Phe Leu Ile Gln Tyr Tyr Asn Gly Glu Glu Arg Ala

180 185 190

Lys Gly Asn Ile Leu Glu Arg Phe Ser Ala Gln Gln Phe Pro Asp Leu

195 200 205

His Ser Glu Leu Asn Ile Ser Ser Leu Glu Pro Gly Asp Ser Ala Leu

210 215 220

Tyr Phe Cys Ala Ser Ser Gly Thr Ser Gly Ile Asn Glu Gln Phe Phe

225 230 235 240

Gly Pro Gly Thr Arg Leu Thr Val Leu

245

<210>31

<211>747

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> Single-chain TCR

<400>31

ggtcaacaac ttaaccagtc cccgcaatca ctgaatattc aggaaggtga agatgtttct 60

attaactgca ccagctctag tatctttaat acgtggctgt ggtataaaca ggacccgggt 120

gaaggtccgg tcctgctgat cgcgctgtac aaagccggcg aactgacgag caacggtcgc 180

ctgaccgccc agttcggcat tacgcgtaaa gattcctcac tgaatatctc tgatgtgcaa 240

ccgagtgacg ttggcattta tttttgtgca ggtccgaccg gcgctggtag ctaccagctg 300

accttcggca agggtacgaa actgtccgtc accccgggcg gtggctccga aggtggcggt 360

tcagaaggcg gtggctcgga aggtggcggt agcgaaggcg gtaccggcga ttcgggtgtg 420

acccagacgc cgaaacatct gagcgtcgca acgggtcaac gtgtgaccct gcgttgctcg 480

ccgcgtagcg gtgatctgtc tgtttattgg taccagcaaa gtctggacca gggcctgcaa 540

tttctgattc agtattacaa cggcgaagaa cgcgcaaaag gtaatatcct ggaacgtttt 600

tccgctcagc aattcccgga tctgcactca gaactgaaca tttcgagcct ggaaccgggt 660

gactctgcgc tgtatttctg tgcctctagt ggcaccagtg gtatcaatga acagtttttc 720

ggcccgggta cccgcctgac ggttctg 747

<210>32

<211>112

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> Single-chain TCR α chain

<400>32

Gly Gln Gln Leu Asn Gln Ser Pro Gln Ser Leu Asn Ile Gln Glu Gly

1 5 10 15

Glu Asp Val Ser Ile Asn Cys Thr Ser Ser Ser Ile Phe Asn Thr Trp

20 25 30

Leu Trp Tyr Lys Gln Asp Pro Gly Glu Gly Pro Val Leu Leu Ile Ala

35 40 45

Leu Tyr Lys Ala Gly Glu Leu Thr Ser Asn Gly Arg Leu Thr Ala Gln

50 55 60

Phe Gly Ile Thr Arg Lys Asp Ser Ser Leu Asn Ile Ser Asp Val Gln

65 70 75 80

Pro Ser Asp Val Gly Ile Tyr Phe Cys Ala Gly Pro Thr Gly Ala Gly

85 90 95

Ser Tyr Gln Leu Thr Phe Gly Lys Gly Thr Lys Leu Ser Val Thr Pro

100 105 110

<210>33

<211>336

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> Single-chain TCR α chain

<400>33

ggtcaacaac ttaaccagtc cccgcaatca ctgaatattc aggaaggtga agatgtttct 60

attaactgca ccagctctag tatctttaat acgtggctgt ggtataaaca ggacccgggt 120

gaaggtccgg tcctgctgat cgcgctgtac aaagccggcg aactgacgag caacggtcgc 180

ctgaccgccc agttcggcat tacgcgtaaa gattcctcac tgaatatctc tgatgtgcaa 240

ccgagtgacg ttggcattta tttttgtgca ggtccgaccg gcgctggtag ctaccagctg 300

accttcggca agggtacgaa actgtccgtc accccg 336

<210>34

<211>113

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> Single-chain TCR β chain

<400>34

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ser Val Ala Thr Gly

1 5 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Ile Ser Ser

65 70 75 80

Leu Glu Pro Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Gly Thr

85 90 95

Ser Gly Ile Asn Glu Gln Phe Phe Gly Pro Gly Thr Arg Leu Thr Val

100 105 110

Leu

<210>35

<211>339

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> Single-chain TCR β chain

<400>35

gattcgggtg tgacccagac gccgaaacat ctgagcgtcg caacgggtca acgtgtgacc 60

ctgcgttgct cgccgcgtag cggtgatctg tctgtttatt ggtaccagca aagtctggac 120

cagggcctgc aatttctgat tcagtattac aacggcgaag aacgcgcaaa aggtaatatc 180

ctggaacgtt tttccgctca gcaattcccg gatctgcact cagaactgaa catttcgagc 240

ctggaaccgg gtgactctgc gctgtatttc tgtgcctcta gtggcaccag tggtatcaat 300

gaacagtttt tcggcccggg tacccgcctg acggttctg 339

<210>36

<211>24

<212>PRT

<213> Artificial sequence (artificial)

<220>

<223> Single-chain TCR linker sequence

<400>36

Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly

15 10 15

Gly Gly Ser Glu Gly Gly Thr Gly

20

<210>37

<211>72

<212>DNA

<213> Artificial sequence (artificial)

<220>

<223> Single-chain TCR linker sequence

<400>37

ggcggtggct ccgaaggtgg cggttcagaa ggcggtggct cggaaggtgg cggtagcgaa 60

ggcggtaccg gc 72

Claims (36)

1. A T Cell Receptor (TCR) capable of binding to the PYLGQMINL-HLA a2402 complex, the TCR comprising a TCR α chain variable domain and a TCR β chain variable domain, wherein the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:

α CDR1- SIFNT (SEQ ID NO: 10)

α CDR2- LYKAGEL (SEQ ID NO: 11)

α CDR3-AGPTGAGSYQL (SEQ ID NO:12), and

the 3 complementarity determining regions of the variable domain of TCR β chain are:

β CDR1- SGDLS (SEQ ID NO: 13)

β CDR2- YYNGEE (SEQ ID NO: 14)

β CDR3- ASSGTSGINEQF (SEQ ID NO: 15)。

2. a TCR as claimed in claim 1 which comprises a TCR α chain variable domain and a TCR β chain variable domain, the TCR α chain variable domain being an amino acid sequence having at least 90% sequence identity to SEQ ID NO 1.

3. A TCR as claimed in claim 2 wherein the TCR β chain variable domain is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 5.

4. A TCR as claimed in claim 1 which comprises the amino acid sequence SEQ id no:1 of the α chain variable domain.

5. A TCR as claimed in claim 1 which comprises the amino acid sequence SEQ id No. 5 of the β chain variable domain.

6. A TCR as claimed in claim 1 which is an αβ heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC 1a 01 or TRBC 2a 01.

7. A TCR as claimed in claim 6 wherein the α chain amino acid sequence of the TCR is SEQ ID NO 3 and/or the β chain amino acid sequence of the TCR is SEQ ID NO 7.

8. A TCR as claimed in any one of claims 1 to 5 which is soluble.

9. A TCR as claimed in claim 8 which is single chain.

10. A TCR as claimed in claim 9 which is formed from the α chain variable domain linked to the β chain variable domain by a peptide linker sequence.

11. A TCR as claimed in claim 10 having one or more mutations in the α chain variable region amino acid position 11, 13, 19, 21, 53, 76, 89, 91 or 94 and/or the α chain J gene short peptide amino acid position 3 last, 5 last or 7 last and/or the β chain variable region amino acid position 11, 13, 19, 21, 53, 76, 89, 91 or 94 th and/or the β chain J gene short peptide amino acid position 2 last, 4 last or 6 last wherein the amino acid position numbering is as set out in the IMGT (International immunogenetics information System).

12. A TCR as claimed in claim 11 wherein the α chain variable domain amino acid sequence of the TCR is as set out in SEQ ID No. 32 and/or the β chain variable domain amino acid sequence of the TCR is as set out in SEQ ID No. 34.

13. A TCR as claimed in claim 12 which has the amino acid sequence SEQ ID No. 30.

14. A TCR as claimed in claim 8 which comprises (a) all or part of a TCR α chain other than the transmembrane domain and (b) all or part of a TCR β chain other than the transmembrane domain;

and (a) and (b) each comprise a functional variable domain, or comprise a functional variable domain, and further comprise at least a portion of the TCR chain constant domain.

15. A TCR as claimed in claim 14 wherein cysteine residues form an artificial disulphide bond between the α and β chain constant domains of the TCR.

16. A TCR as claimed in claim 15 wherein the cysteine residues which form the artificial disulphide bond in the TCR are substituted at one or more groups selected from:

thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;

tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;

ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;

arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;

pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and

tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.

17. A TCR as claimed in claim 16 wherein the α chain amino acid sequence of the TCR is SEQ ID No. 26 and/or the β chain amino acid sequence of the TCR is SEQ ID No. 28.

18. A TCR as claimed in claim 14 which comprises an artificial interchain disulphide bond between the α chain variable region and the β chain constant region of the TCR.

19. A TCR as claimed in claim 18 wherein the cysteine residues which form the artificial interchain disulphide bond in the TCR are substituted at one or more groups selected from:

amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC2 x 01 exon 1; or

Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01.

20. A TCR as claimed in claim 18 or claim 19 which comprises α and β chain variable domains and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the α chain constant domain, the α chain variable domain of the TCR forming a heterodimer with the β chain.

21. A TCR as claimed in claim 1 wherein a conjugate is attached to the C-or N-terminus of the α and/or β chains of the TCR.

22. A TCR as claimed in claim 21 wherein the conjugate to which the TCR is bound is a detectable label, a therapeutic agent, a PK modifying moiety or a combination of any of these.

23. A TCR as claimed in claim 21 wherein the therapeutic agent is an anti-CD 3 antibody.

24. A multivalent TCR complex comprising at least two TCR molecules, and wherein at least one TCR molecule is a TCR as claimed in any one of claims 1 to 23.

25. A nucleic acid molecule comprising a nucleic acid sequence encoding a TCR according to any one of claims 1 to 23, or the complement thereof.

26. The nucleic acid molecule of claim 25, wherein said nucleic acid molecule comprises the nucleotide sequence SEQ ID No. 2 or SEQ ID No. 33 encoding the variable domain of TCR α chain.

27. The nucleic acid molecule of claim 25 or 26, wherein said nucleic acid molecule comprises the nucleotide sequence SEQ ID No. 6 or SEQ ID No. 35 encoding the variable domain of the TCR β chain.

28. The nucleic acid molecule of claim 25, comprising the nucleotide sequence of SEQ ID No. 4 encoding a TCR α chain and/or comprising the nucleotide sequence of SEQ ID No. 8 encoding a TCR β chain.

29. A vector comprising the nucleic acid molecule of any one of claims 25 to 28.

30. The vector of claim 29, wherein said vector is a viral vector.

31. The vector of claim 30, wherein said vector is a lentiviral vector.

32. An isolated host cell comprising the vector or chromosome of any one of claims 29-31 and wherein the exogenous nucleic acid molecule of any one of claims 25-28 is integrated into the host cell.

33. A cell which transduces the nucleic acid molecule of any one of claims 25 to 28 or the vector of any one of claims 29 to 31.

34. The cell of claim 33, wherein the cell is a T cell or a stem cell.

35. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to any one of claims 1 to 23, a TCR complex according to claim 24, a nucleic acid molecule according to any one of claims 25 to 28, or a cell according to claim 33.

36. Use of a TCR as claimed in any one of claims 1 to 23, or a TCR complex as claimed in claim 24 or a cell as claimed in claim 33, in the manufacture of a medicament for the treatment of a tumour.

Images