CN109575120B - TCR for identifying PRAME antigen short peptide and coding sequence thereof - Google Patents

Abstract

The present invention provides a T Cell Receptor (TCR) capable of specifically binding to the short peptide vldgll derived from the PRAME antigen, which can form a complex with HLA a0201 and be presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Description

TCR for identifying PRAME antigen short peptide and coding sequence thereof

Technical Field

The present invention relates to a TCR capable of recognising a short peptide derived from the PRAME antigen, and to PRAME specific T cells obtained by transduction of such TCRs, and their use in the prevention and treatment of PRAME related diseases.

Background

PRAME is a melanoma-specific antigen (PRAME) that is expressed in 88% of primary and 95% of metastatic melanomas (Ikeda H, et al. Immunity,1997,6 (2): 199-208), but not in normal skin tissue and benign melanocytes. PRAME is degraded into small polypeptides after intracellular production and is presented on the cell surface as a complex by binding to MHC (major histocompatibility complex) molecules. VLDGDLLL (SEQ ID NO: 9) is a short peptide derived from the PRAME antigen and is a target for the treatment of PRAME-related diseases. In addition to melanoma, PRAME is expressed in a variety of tumors including squamous cell carcinoma of the lung, breast carcinoma, renal cell carcinoma, head and neck tumors, hodgkin's lymphoma, sarcoma, medulloblastoma, etc. (van't Veer LJ, et al. Nature,2002,415 (6871): 530-536 Boon K, et al. Oncogene,2003,22 (48): 7687-7694). In addition, PRAME is also significantly expressed in leukemia, with 17% -42% acute lymphocytic leukemia, and 30% -64% acute myelocytic leukemia (SteinbachD, et al. Cancer Gent cell, 2002,138 (1): 89-91). For the treatment of the above diseases, chemotherapy, radiotherapy and the like can be used, but both of them cause damages to their normal cells.

T cell adoptive immunotherapy is the transfer of reactive T cells specific for target cell antigens into a patient to allow them to act on the target cells. The T Cell Receptor (TCR) is a membrane protein on the surface of T cells that recognizes a corresponding short peptide antigen on the surface of a target cell. In the immune system, the direct physical contact between T cells and Antigen Presenting Cells (APC) is initiated by the combination of antigen short peptide specific TCR and short peptide-major histocompatibility complex (pMHC complex), and then other cell membrane surface molecules of the T cells and APC interact to cause a series of subsequent cell signaling and other physiological reactions, so that T cells with different antigen specificities can exert immune effects on target cells. Therefore, those skilled in the art have focused on isolating TCRs specific for PRAME antigen short peptides and transducing T cells with the TCRs to obtain T cells specific for PRAME antigen short peptides, thereby making them useful in cellular immunotherapy.

Disclosure of Invention

The invention aims to provide a T cell receptor for recognizing PRAME antigen short peptide.

In a first aspect of the invention, there is provided a T Cell Receptor (TCR) capable of binding to the VLDGLVLL-HLA A0201 complex.

In another preferred embodiment, the TCR comprises a TCR alpha chain variable domain and a TCR beta chain variable domain, the amino acid sequence of CDR3 of the TCR alpha chain variable domain is ALSERILNYGGSQGNLI (SEQ ID NO: 12); and/or the amino acid sequence of CDR3 of the variable domain of the TCR beta chain is ASSGTGTDTQY (SEQ ID NO: 15).

In another preferred embodiment, the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:

αCDR1-TRDTTYY(SEQ ID NO:10)

αCDR2-RNSFDEQN(SEQ ID NO:11)

alpha CDR3-ALSERILNYGGSQGNLI (SEQ ID NO: 12); and/or

The 3 complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGDLS(SEQ ID NO:13)

βCDR2-YYNGEE(SEQ ID NO:14)

βCDR3-ASSGTGTDTQY(SEQ ID NO:15)。

in another preferred embodiment, the TCR comprises a TCR alpha chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1, and a TCR beta chain variable domain; and/or the TCR β chain variable domain is identical to SEQ ID NO:5 an amino acid sequence having at least 90% sequence identity.

In another preferred embodiment, the TCR comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1.

In another preferred embodiment, the TCR comprises the beta chain variable domain amino acid sequence SEQ ID NO 5.

In another preferred embodiment, the TCR is an α β heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.

In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO:3 and/or the beta chain amino acid sequence of the TCR is SEQ ID NO 7.

In another preferred embodiment, the TCR is soluble.

In another preferred embodiment, the TCR is single chain.

In another preferred embodiment, the TCR is formed by linking an α chain variable domain to a β chain variable domain via a peptide linker.

In another preferred embodiment, the TCR has one or more mutations in amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 of the α chain variable region, and/or in the penultimate 3-, 5-, or 7-position of the short peptide amino acid of the α chain J gene; and/or the TCR has one or more mutations in beta chain variable region amino acid position 11, 13, 19, 21, 53, 76, 89, 91, or 94, and/or beta chain J gene short peptide amino acid penultimate 2,4 or 6 positions, wherein amino acid position numbering is according to the position numbering listed in IMGT (international immunogenetic information system).

In another preferred embodiment, the α chain variable domain amino acid sequence of the TCR comprises SEQ ID NO 32 and/or the β chain variable domain amino acid sequence of the TCR comprises SEQ ID NO 34.

In another preferred embodiment, the amino acid sequence of the TCR is SEQ ID NO 30.

In another preferred embodiment, the TCR comprises (a) all or part of a TCR α chain, excluding the transmembrane domain; and (b) all or part of the TCR β chain, excluding the transmembrane domain;

and (a) and (b) each comprise a functional variable domain, or comprise a functional variable domain and at least a portion of the TCR chain constant domain.

In another preferred embodiment, the cysteine residues form an artificial disulfide bond between the alpha and beta chain constant domains of the TCR.

In another preferred embodiment, the cysteine residues forming the artificial disulfide bond in the TCR are substituted at one or more groups of sites selected from the group consisting of:

thr48 of TRAC × 01 exon 1 and TRBC1 × 01 or Ser57 of TRBC2 × 01 exon 1;

thr45 of TRAC × 01 exon 1 and TRBC1 × 01 or Ser77 of TRBC2 × 01 exon 1;

tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01;

thr45 of TRAC × 01 exon 1 and TRBC1 × 01 or Asp59 of TRBC2 × 01 exon 1;

ser15 of TRAC × 01 exon 1 and TRBC1 × 01 or TRBC2 × 01 exon 1 Glu15;

arg53 of TRAC × 01 exon 1 and TRBC1 × 01 or Ser54 of TRBC2 × 01 exon 1;

pro89 of TRAC × 01 exon 1 and TRBC1 × 01 or Ala19 of TRBC2 × 01 exon 1; and

tyr10 of TRAC × 01 exon 1 and TRBC1 × 01 or TRBC2 × 01 exon 1 Glu20.

In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO 26 and/or the β chain amino acid sequence of the TCR is SEQ ID NO 28.

In another preferred embodiment, the TCR comprises an artificial interchain disulfide bond between the α chain variable region and the β chain constant region.

In another preferred embodiment, the cysteine residues that form the artificial interchain disulfide bond in the TCR replace one or more groups of sites selected from the group consisting of:

amino acid 46 of TRAV and amino acid 60 of exon 1 TRBC1 x 01 or TRBC2 x 01;

amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 46 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01; or

Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01.

In another preferred embodiment, the TCR comprises an alpha chain variable domain and a beta chain variable domain and all or part of the beta chain constant domain, excluding the transmembrane domain, but which does not comprise an alpha chain constant domain, the alpha chain variable domain of the TCR forming a heterodimer with the beta chain.

In another preferred embodiment, the TCR comprises a conjugate attached to the C-or N-terminus of the α chain and/or β chain.

In another preferred embodiment, the conjugate that binds to the T cell receptor is a detectable label, a therapeutic agent, a PK modifying moiety or a combination of any of these. Preferably, the therapeutic agent is an anti-CD 3 antibody.

In a second aspect of the invention, there is provided a multivalent TCR complex comprising at least two TCR molecules, and wherein at least one of the TCR molecules is a TCR according to the first aspect of the invention.

In a third aspect of the invention, there is provided a nucleic acid molecule comprising a nucleic acid sequence encoding a TCR molecule according to the first aspect of the invention, or a complement thereof.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence encoding the variable domain of the TCR α chain SEQ ID NO:2 or SEQ ID NO:33.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:6 or SEQ ID NO 35.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence encoding the TCR α chain SEQ ID NO:4 and/or comprises the nucleotide sequence encoding the TCR β chain SEQ ID NO:8.

in a fourth aspect of the invention, there is provided a vector comprising a nucleic acid molecule according to the third aspect of the invention; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector.

In a fifth aspect of the invention, there is provided an isolated host cell comprising a vector according to the fourth aspect of the invention or a genome into which has been integrated an exogenous nucleic acid molecule according to the third aspect of the invention.

In a sixth aspect of the invention, there is provided a cell which transduces a nucleic acid molecule according to the third aspect of the invention or a vector according to the fourth aspect of the invention; preferably, the cell is a T cell or a stem cell.

In a seventh aspect of the invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to the first aspect of the invention, a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention.

In an eighth aspect, the invention provides the use of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, in the manufacture of a medicament for the treatment of a tumour or an autoimmune disease.

In a ninth aspect, the invention provides a method of treating a disease comprising administering to a subject in need thereof an amount of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, or a pharmaceutical composition according to the seventh aspect of the invention;

preferably, the disease is a tumor, preferably the tumor includes melanoma, as well as other solid tumors such as squamous cell lung carcinoma, breast cancer, renal cell carcinoma, head and neck tumors, hodgkin's lymphoma, sarcoma and medulloblastoma.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1a, FIG. 1b, FIG. 1c, FIG. 1d, FIG. 1e and FIG. 1f are the amino acid sequence of the TCR α chain variable domain, the nucleotide sequence of the TCR α chain variable domain, the amino acid sequence of the TCR α chain, the nucleotide sequence of the TCR α chain, the amino acid sequence of the TCR α chain with leader sequence and the nucleotide sequence of the TCR α chain with leader sequence, respectively.

Fig. 2a, fig. 2b, fig. 2c, fig. 2d, fig. 2e and fig. 2f are a TCR β chain variable domain amino acid sequence, a TCR β chain variable domain nucleotide sequence, a TCR β chain amino acid sequence, a TCR β chain nucleotide sequence with a leader sequence, and a TCR β chain nucleotide sequence with a leader sequence, respectively.

FIG. 3 shows CD8 of monoclonal cells ⁺ And tetramer-PE double positive staining results.

Figure 4a and figure 4b are the amino acid and nucleotide sequences, respectively, of a soluble TCR alpha chain.

Figure 5a and figure 5b are the amino acid and nucleotide sequences, respectively, of a soluble TCR β chain.

Figure 6 is a gel diagram of the soluble TCR obtained after purification. The leftmost lane is reducing gel, the middle lane is molecular weight marker (marker), and the rightmost lane is non-reducing gel.

FIGS. 7a and 7b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR.

Figure 8a and figure 8b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR α chain.

Figure 9a and figure 9b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR β chain.

FIGS. 10a and 10b are the amino acid and nucleotide sequences, respectively, of a single-chain TCR linker sequence (linker).

FIG. 11 is a gel diagram of the soluble single chain TCR obtained after purification. The right lane is the molecular weight marker (marker) and the left lane is the non-reducing gel.

FIG. 12 is a BIAcore kinetic profile of binding of soluble TCRs of the invention to the VLDGLVLL-HLA A0201 complex.

FIG. 13 is a BIAcore kinetic profile of binding of soluble single chain TCRs of the invention to the VLDGDVLL-HLA A0201 complex.

FIG. 14 shows the results of functional verification of the ELISPOT activation of the resulting T cell clones.

FIG. 15 results of functional validation of ELISPOT activation of effector cells that have not transduced the TCR of the invention.

Detailed Description

The present inventors have made extensive and intensive studies to find a TCR capable of specifically binding to VLDGLVLL (SEQ ID NO: 9), a PRAME antigen short peptide, which can form a complex with HLA A0201 and be presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Term(s)

MHC molecules are proteins of the immunoglobulin superfamily, which may be MHC class I or class II molecules. Therefore, it is specific for antigen presentation, different individuals have different MHC, and different short peptides in one protein antigen can be presented on the cell surface of respective APC. Human MHC is commonly referred to as an HLA gene or HLA complex.

The T Cell Receptor (TCR), is the only receptor for a specific antigenic peptide presented on the Major Histocompatibility Complex (MHC). In the immune system, direct physical contact between T cells and Antigen Presenting Cells (APCs) is initiated by the binding of antigen-specific TCRs to pMHC complexes, and then other cell membrane surface molecules of both T cells and APCs interact, which causes a series of subsequent cell signaling and other physiological reactions, thereby allowing T cells of different antigen specificities to exert immune effects on their target cells.

TCRs are cell membrane surface glycoproteins that exist as heterodimers from either the α chain/β chain or the γ chain/δ chain. In 95% of T cells the TCR heterodimer consists of α and β chains, while 5% of T cells have TCRs consisting of γ and δ chains. Native α β heterodimeric TCRs have an α chain and a β chain, which constitute subunits of an α β heterodimeric TCR. Broadly, each of the α and β chains comprises a variable region, a linker region and a constant region, and the β chain also typically contains a short diversity region between the variable region and the linker region, but the diversity region is often considered to be part of the linker region. Each variable region comprises 3 CDRs (complementarity determining regions), CDR1, CDR2 and CDR3, which are chimeric in framework structures (framework regions). The CDR regions determine the binding of the TCR to the pMHC complex, where CDR3 is recombined from variable and linking regions, referred to as hypervariable regions. The α and β chains of a TCR are generally regarded as having two "domains" each, namely a variable domain and a constant domain, the variable domain being made up of linked variable regions and linking regions. The sequences of TCR constant domains can be found in public databases of the international immunogenetic information system (IMGT), e.g. the constant domain sequence of the α chain of the TCR molecule is "TRAC 01", the constant domain sequence of the β chain of the TCR molecule is "TRBC1 01" or "TRBC2 01". In addition, the α and β chains of the TCR also comprise a transmembrane region and a cytoplasmic region, the cytoplasmic region being very short.

In the present invention, the terms "polypeptide of the invention", "TCR of the invention", "T cell receptor of the invention" are used interchangeably.

Natural interchain disulfide bond and artificial interchain disulfide bond

A set of disulfide bonds, referred to herein as "native interchain disulfide bonds," exist between the C α and C β chains of the membrane proximal region of native TCRs. In the present invention, the artificially introduced interchain covalent disulfide bond whose position is different from that of the natural interchain disulfide bond is referred to as an "artificial interchain disulfide bond".

For convenience of description of the positions of disulfide bonds, the positions of TRAC 01 and TRBC1 × 01 or TRBC2 × 01 amino acid sequences are numbered in the sequential order from the N-terminus to the C-terminus, and in TRBC1 × 01 or TRBC2 × 01, the 60 th amino acid in the sequential order from the N-terminus to the C-terminus is P (proline), and thus in the present invention, it may be described as TRBC1 × 01 or TRBC2 × 01 exon 1 Pro60, and also as TRBC1 × 01 or TRBC2 × 01 exon 160, in TRBC1 × 01 or TRBC2 × 01, and in TRBC1 × 01 or TRBC2 × 01, the 61 th amino acid in the sequential order from the N-terminus to the C-terminus is Q (glutamine), and in the present invention, it may be described as TRBC1 × 01 or TRBC2 × 01 exon 1 Gln61, and also as TRBC1 × 01 or TRBC2 × 01, and so on, the other TRBC1 × 01 or TRBC2 × 01 amino acid. In the present invention, the position numbering of the amino acid sequences of the variable regions TRAV and TRBV follows the position numbering listed in IMGT. If a certain amino acid in TRAV, the position number listed in IMGT is 46, it is described in the present invention as TRAV amino acid 46, and so on. In the present invention, the sequence position numbers of other amino acids are specifically described.

Detailed Description

TCR molecules

During antigen processing, antigens are degraded intracellularly and then carried to the cell surface through MHC molecules. T cell receptors are capable of recognizing peptide-MHC complexes on the surface of antigen presenting cells. Accordingly, in a first aspect the invention provides a TCR molecule capable of binding to the vldgll-HLA a0201 complex. Preferably, the TCR molecule is isolated or purified. The α and β chains of the TCR each have 3 Complementarity Determining Regions (CDRs).

In a preferred embodiment of the invention, the α chain of the TCR comprises a CDR having the amino acid sequence:

αCDR1-TRDTTYY(SEQ ID NO:10)

αCDR2-RNSFDEQN(SEQ ID NO:11)

alpha CDR3-ALSERILNYGGSQGNLI (SEQ ID NO: 12); and/or

The 3 complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGDLS(SEQ ID NO:13)

βCDR2-YYNGEE(SEQ ID NO:14)

βCDR3-ASSGTGTDTQY(SEQ ID NO:15)。

chimeric TCRs can be prepared by embedding the above-described amino acid sequences of the CDR regions of the invention into any suitable framework. One skilled in the art can design or synthesize a TCR molecule with a corresponding function based on the CDR regions disclosed herein, provided that the framework structure is compatible with the CDR regions of the TCR of the invention. Thus, the TCR molecules of the invention are those which comprise the above-described α and/or β chain CDR region sequences and any suitable framework structure. The TCR α chain variable domain of the invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID No. 1; and/or the TCR β chain variable domain of the invention is a variant of SEQ ID NO:5, having at least 90%, preferably 95%, more preferably 98% sequence identity.

In a preferred embodiment of the invention, the TCR molecules of the invention are heterodimers consisting of α and β chains. In particular, in one aspect the α chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, the α chain variable domain amino acid sequence comprising CDR1 (SEQ ID NO: 10), CDR2 (SEQ ID NO: 11) and CDR3 (SEQ ID NO: 12) of the above-described α chain. Preferably, the TCR molecule comprises an alpha chain variable domain amino acid sequence SEQ ID NO 1. More preferably, the amino acid sequence of the α chain variable domain of the TCR molecule is SEQ ID NO 1. In another aspect, the β chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, and the β chain variable domain amino acid sequence comprises CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 14), and CDR3 (SEQ ID NO: 15) of the above-described β chain. Preferably, the TCR molecule comprises the beta chain variable domain amino acid sequence SEQ ID NO 5. More preferably, the amino acid sequence of the β chain variable domain of the TCR molecule is SEQ ID NO 5.

In a preferred embodiment of the invention, the TCR molecules of the invention are single chain TCR molecules consisting of part or all of the α chain and/or part or all of the β chain. Single chain TCR molecules are described in Chung et al (1994) Proc. Natl. Acad. Sci. USA 91,12654-12658. From the literature, those skilled in the art are readily able to construct single chain TCR molecules comprising the CDRs regions of the invention. In particular, the single chain TCR molecule comprises V α, V β and C β, preferably linked in order from N-terminus to C-terminus.

The alpha chain variable domain amino acid sequence of the single chain TCR molecule comprises CDR1 (SEQ ID NO: 10), CDR2 (SEQ ID NO: 11) and CDR3 (SEQ ID NO: 12) of the alpha chain described above. Preferably, the single chain TCR molecule comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1. More preferably, the α chain variable domain amino acid sequence of the single chain TCR molecule is SEQ ID NO 1. The amino acid sequence of the variable domain of the beta chain of the single-chain TCR molecule comprises CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 14) and CDR3 (SEQ ID NO: 15) of the beta chain described above. Preferably, the single chain TCR molecule comprises the beta chain variable domain amino acid sequence SEQ ID NO 5. More preferably, the amino acid sequence of the β chain variable domain of the single chain TCR molecule is SEQ ID NO 5.

In a preferred embodiment of the invention, the constant domain of the TCR molecules of the invention is a human constant domain. The person skilled in the art knows or can obtain the human constant domain amino acid sequence by consulting public databases of relevant books or IMGT (international immunogenetic information system). For example, the constant domain sequence of the α chain of the TCR molecules of the invention can be "TRAC 01", and the constant domain sequence of the β chain of the TCR molecules can be "TRBC1 01" or "TRBC2 01". Arg at position 53 of the amino acid sequence given in TRAC 01 of IMGT, here denoted: TRAC × 01 Arg53 of exon 1, and so on. Preferably, the amino acid sequence of the α chain of the TCR molecule of the invention is SEQ ID NO 3 and/or the amino acid sequence of the β chain is SEQ ID NO 7.

Naturally occurring TCRs are membrane proteins that are stabilized by their transmembrane regions. Like immunoglobulins (antibodies) as antigen recognition molecules, TCRs can also be developed for diagnostic and therapeutic applications, where soluble TCR molecules are required. Soluble TCR molecules do not include their transmembrane region. Soluble TCRs have a wide range of uses, not only for studying the interaction of TCRs with pmhcs, but also as diagnostic tools for detecting infection or as markers for autoimmune diseases. Similarly, soluble TCRs can be used to deliver therapeutic agents (e.g., cytotoxic or immunostimulatory compounds) to cells presenting a specific antigen, and in addition, soluble TCRs can be conjugated to other molecules (e.g., anti-CD 3 antibodies) to redirect T cells to target them to cells presenting a particular antigen. The invention also provides soluble TCRs specific for PRAME antigen short peptides.

To obtain a soluble TCR, in one aspect, the inventive TCR may be one in which an artificial disulfide bond is introduced between residues of the constant domains of its alpha and beta chains. Cysteine residues form an artificial interchain disulfide bond between the alpha and beta chain constant domains of the TCR. Cysteine residues may be substituted for other amino acid residues at appropriate positions in native TCRs to form artificial interchain disulfide bonds. For example, a cysteine residue substituting Thr48 of TRAC × 01 exon 1 and substituting Ser57 of TRBC1 × 01 or TRBC2 × 01 exon 1 forms a disulfide bond. Other sites for introducing cysteine residues to form disulfide bonds may also be: thr45 of TRAC × 01 exon 1 and TRBC1 × 01 or Ser77 of TRBC2 × 01 exon 1; tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01; thr45 of TRAC × 01 exon 1 and TRBC1 × 01 or Asp59 of TRBC2 × 01 exon 1; ser15 of TRAC × 01 exon 1 and TRBC1 × 01 or TRBC2 × 01 exon 1 Glu15; arg53 of TRAC × 01 exon 1 and TRBC1 × 01 or Ser54 of TRBC2 × 01 exon 1; pro89 of TRAC × 01 exon 1 and TRBC1 × 01 or Ala19 of TRBC2 × 01 exon 1; or Tyr10 of exon 1 of TRAC × 01 and TRBC1 × 01 or TRBC2 × 01, glu20 of exon 1. I.e., a cysteine residue, in place of any of the above-described alpha and beta chain constant domains. The TCR constant domains of the invention may be truncated at one or more of their C-termini by up to 50, or up to 30, or up to 15, or up to 10, or up to 8 or fewer amino acids, so as not to include a cysteine residue for the purpose of deleting the native disulphide bond, or by mutating the cysteine residue forming the native disulphide bond to another amino acid.

As described above, the TCRs of the invention may comprise artificial disulfide bonds introduced between residues of the constant domains of their alpha and beta chains. It should be noted that the TCRs of the invention may each contain a TRAC constant domain sequence and a TRBC1 or TRBC2 constant domain sequence, with or without the artificial disulfide bond introduced as described above between the constant domains. The TRAC constant domain sequence and the TRBC1 or TRBC2 constant domain sequence of the TCR may be linked by the native disulfide bond present in the TCR.

To obtain a soluble TCR, the inventive TCR may, on the other hand, also comprise a TCR having a mutation in its hydrophobic core region, preferably a mutation that results in an improved stability of the inventive soluble TCR, as described in the patent publication WO 2014/206304. Such TCRs may be mutated at the following variable domain hydrophobic core positions: (alpha and/or beta chain) variable region amino acid positions 11, 13, 19, 21, 53, 76, 89, 91, 94, and/or positions 3,5,7 from the last amino acid position of the short peptide of the alpha chain J gene (TRAJ), and/or positions 2,4,6 from the last amino acid position of the short peptide of the beta chain J gene (TRBJ), wherein the position numbering of the amino acid sequence is according to the position numbering listed in the International immunogenetic information System (IMGT). The skilled person is aware of the above international immunogenetic information system and can derive from this database the position numbering of the amino acid residues of different TCRs in IMGT.

The TCR with the mutated hydrophobic core region of the present invention may be a stable soluble single chain TCR consisting of a flexible peptide chain connecting the variable domains of the α and β chains of the TCR. It should be noted that the flexible peptide chain of the present invention can be any peptide chain suitable for linking the variable domains of TCR α and β chains. The single-chain soluble TCR constructed in the embodiment 4 of the invention has the alpha chain variable domain amino acid sequence of SEQ ID NO. 32 and the encoded nucleotide sequence of SEQ ID NO. 33; the amino acid sequence of the beta chain variable domain is SEQ ID NO. 34, and the coded nucleotide sequence is SEQ ID NO. 35.

In addition, for stability, patent document 201510260322.4 also discloses that the stability of TCR can be significantly improved by introducing an artificial interchain disulfide bond between the α chain variable region and the β chain constant region of TCR. Thus, the high affinity TCR of the present invention may also comprise an artificial interchain disulfide bond between the α chain variable region and the β chain constant region. Specifically, the cysteine residues that form the artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR are substituted for: amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01; amino acid 47 of TRAV and amino acid 61 of exon 1 TRBC1 x 01 or TRBC2 x 01; amino acid 46 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01; or amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01. Preferably, such a TCR may comprise (i) all or part of a TCR α chain, excluding its transmembrane domain, and (ii) all or part of a TCR β chain, excluding its transmembrane domain, wherein (i) and (ii) both comprise a variable domain and at least part of a constant domain of the TCR chain, the α chain forming a heterodimer with the β chain. More preferably, such a TCR may comprise the a chain variable domain and the β chain variable domain and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the a chain constant domain, the a chain variable domain of the TCR forming a heterodimer with the β chain.

The TCRs of the invention may also be provided in the form of multivalent complexes. Multivalent TCR complexes of the invention comprise polymers formed by association of two, three, four or more TCRs of the invention, such as might be formed by tetramer formation with the tetrameric domain of p53, or complexes formed by association of a plurality of TCRs of the invention with another molecule. The TCR complexes of the invention can be used to track or target cells presenting a particular antigen in vitro or in vivo, and can also be used to generate intermediates for other multivalent TCR complexes having such applications.

The TCRs of the invention may be used alone or in covalent or other association, preferably covalently, with a conjugate. The conjugates include a detectable label (for diagnostic purposes, wherein the TCR is used to detect the presence of cells presenting the vldglll-HLA a0201 complex), a therapeutic agent, a PK (protein kinase) modifying moiety or a combination of any of the above.

Detectable labels for diagnostic purposes include, but are not limited to: a fluorescent or luminescent label, a radioactive label, an MRI (magnetic resonance imaging) or CT (computed tomography) contrast agent, or an enzyme capable of producing a detectable product.

Therapeutic agents that may be associated or conjugated with the TCRs of the invention include, but are not limited to: 1. radionuclides (Koppe et al, 2005, cancer metastasis reviews (Cancer metastasis) 24, 539); 2. biotoxics (Chaudhary et al, 1989, nature 339, 394, epel et al, 2002, cancer Immunology and Immunotherapy) 51, 565); 3. cytokines such as IL-2 etc (Gillies et al, 1992, national institute of sciences (PNAS) 89, 1428, card et al, 2004, cancer Immunology and Immunotherapy) 53, 345, haiin et al, 2003, cancer Research (Cancer Research) 63, 3202; 4. antibody Fc fragment (Mosquera et al, 2005, journal Of Immunology 174, 4381); 5. antibody scFv fragments (Zhu et al, 1995, international Journal of Cancer 62, 319); 6. gold nanoparticles/nanorods (Lapotko et al, 2005, cancer communications (Cancer letters) 239, 36, huang et al, 2006, journal of the American Chemical Society 128, 2115); 7. viral particles (Peng et al, 2004, gene therapy) 11, 1234); 8. liposomes (Mamot et al, 2005, cancer research) 65, 11631); 9. nano magnetic particles; 10. prodrug activating enzymes (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 11. chemotherapeutic agents (e.g., cisplatin) or nanoparticles in any form, and the like.

In addition, the TCRs of the invention may also be hybrid TCRs comprising sequences derived from more than one species. For example, studies have shown that murine TCRs are more efficiently expressed in human T cells than human TCRs. Thus, the inventive TCR may comprise a human variable domain and a murine constant domain. The drawback of this approach is the possibility of eliciting an immune response. Therefore, there should be a regulatory scheme for immunosuppression when it is used for adoptive T cell therapy to allow for the engraftment of murine expressing T cells.

It should be understood that the amino acid names herein are expressed in terms of international single-letter or three-letter english letters, and the single-letter english letter and three-letter english letters of the amino acid names correspond to the following relationships: ala (A), arg (R), asn (N), asp (D), cys (C), gln (Q), glu (E), gly (G), his (H), ile (I), leu (L), lys (K), met (M), phe (F), pro (P), ser (S), thr (T), trp (W), tyr (Y), val (V).

Nucleic acid molecules

A second aspect of the invention provides a nucleic acid molecule encoding a TCR molecule of the first aspect of the invention or a part thereof, which part may be one or more CDRs, variable domains of the alpha and/or beta chains, and the alpha and/or beta chains.

The nucleotide sequence encoding the α chain CDR regions of the TCR molecules of the first aspect of the invention is as follows:

αCDR1-acccgtgatactacttattac(SEQ ID NO:16)

αCDR2-cggaactcttttgatgagcaaaat(SEQ ID NO:17)

αCDR3-gctctgagtgagagaattctgaattatggaggaagccaaggaaatctcatc (SEQ ID NO:18)

the nucleotide sequence encoding the CDR regions of the β chain of the TCR molecules of the first aspect of the invention is as follows:

βCDR1-tctggagacctctct(SEQ ID NO:19)

βCDR2-tattataatggagaagag(SEQ ID NO:20)

βCDR3-gccagctccgggacaggcacagatacgcagtat(SEQ ID NO:21)

thus, the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR alpha chain of the invention comprises SEQ ID NO 16, 17 and 18 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR beta chain of the invention comprises SEQ ID NO 19, 20 and 21.

The nucleotide sequence of the nucleic acid molecule of the invention may be single-stranded or double-stranded, the nucleic acid molecule may be RNA or DNA, and may or may not comprise an intron. Preferably, the nucleotide sequence of the nucleic acid molecule of the invention does not comprise an intron but is capable of encoding a polypeptide of the invention, e.g. the nucleotide sequence of the nucleic acid molecule of the invention encoding a TCR alpha chain variable domain of the invention comprises SEQ ID NO 2 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding a TCR beta chain variable domain of the invention comprises SEQ ID NO 6. Alternatively, the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR α chain variable domain of the invention comprises SEQ ID NO 33 and/or the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR β chain variable domain of the invention comprises SEQ ID NO 35. More preferably, the nucleotide sequence of the nucleic acid molecule of the invention comprises SEQ ID NO 4 and/or SEQ ID NO 8. Alternatively, the nucleic acid molecule of the invention has the nucleotide sequence of SEQ ID NO. 31.

It will be appreciated that, due to the degeneracy of the genetic code, different nucleotide sequences may encode the same polypeptide. Thus, the nucleic acid sequence encoding the TCR of the present invention may be identical to or a degenerate variant of the nucleic acid sequences shown in the figures of the present invention. As illustrated by one of the examples herein, a "degenerate variant" refers to a nucleic acid sequence that encodes a protein sequence having SEQ ID NO. 1, but differs from the sequence of SEQ ID NO. 2.

The nucleotide sequence may be codon optimized. Different cells differ in the utilization of specific codons, and the expression level can be increased by changing the codons in the sequence according to the type of the cell. Codon usage tables for mammalian cells as well as for various other organisms are well known to those skilled in the art.

The full-length sequence of the nucleic acid molecule of the present invention or a fragment thereof can be obtained by, but not limited to, PCR amplification, recombination, or artificial synthesis. At present, DNA sequences encoding the TCRs of the invention (or fragments or derivatives thereof) have been obtained entirely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or e.g., vectors) and cells known in the art. The DNA may be the coding strand or the non-coding strand.

Carrier

The invention also relates to vectors comprising the nucleic acid molecules of the invention, including expression vectors, i.e. constructs capable of expression in vivo or in vitro. Commonly used vectors include bacterial plasmids, bacteriophages and animal and plant viruses.

Viral delivery systems include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, baculoviral vectors.

Preferably, the vector can transfer the nucleotide of the invention into a cell, e.g., a T cell, such that the cell expresses a TCR specific for the PRAME antigen. Ideally, the vector should be capable of sustained high level expression in T cells.

Cells

The invention also relates to genetically engineered host cells using the vectors or coding sequences of the invention. The host cell comprises a vector of the invention or has integrated into its chromosome a nucleic acid molecule of the invention. The host cell is selected from: prokaryotic and eukaryotic cells, such as E.coli, yeast cells, CHO cells, and the like.

In addition, the invention also includes isolated cells, particularly T cells, that express the TCRs of the invention. The T cell may be derived from a T cell isolated from a subject, or may be part of a mixed population of cells isolated from a subject, such as a population of Peripheral Blood Lymphocytes (PBLs). For example, the cells may be isolated from Peripheral Blood Mononuclear Cells (PBMC), which may be CD4 ⁺ Helper T cell or CD8 ⁺ Cytotoxic T cells. The cells can be in CD4 ⁺ Helper T cell/CD 8 ⁺ A mixed population of cytotoxic T cells. Generally, the cells can be activated with an antibody (e.g., an anti-CD 3 or anti-CD 28 antibody) to render them more amenable to transfection, e.g., transfection with a vector comprising a nucleotide sequence encoding a TCR molecule of the invention.

Alternatively, the cell of the invention may also be or be derived from a stem cell, such as a Hematopoietic Stem Cell (HSC). Gene transfer to HSCs does not result in TCR expression on the cell surface, since the CD3 molecule is not expressed on the stem cell surface. However, when stem cells differentiate into lymphoid precursors (lymphoid precursors) that migrate to the thymus, expression of the CD3 molecule will initiate expression of the introduced TCR molecule on the surface of the thymocytes.

There are many methods suitable for T cell transfection using DNA or RNA encoding the TCR of the invention (e.g., robbins et al, (2008) J.Immunol.180: 6116-6131). T cells expressing the TCRs of the invention may be used for adoptive immunotherapy. Those skilled in the art will be able to recognize many suitable methods for adoptive therapy (e.g., rosenberg et al, (2008) Nat Rev Cancer8 (4): 299-308).

PRAME antigen associated diseases

The invention also relates to a method of treating and/or preventing a PRAME-associated disease in a subject comprising the step of adoptively transferring PRAME-specific T cells to the subject. The PRAME-specific T cells recognize the VLDGDVLL-HLA A0201 complex.

The PRAME specific T cells of the invention can be used to treat any PRAME-associated disease that presents the PRAME antigen short peptide VLDGDLL-HLA A0201 complex. Including but not limited to tumors such as melanoma, as well as other solid tumors such as squamous cell lung carcinoma, breast carcinoma, renal cell carcinoma, head and neck tumors, hodgkin's lymphoma, sarcoma, and medulloblastoma.

Method of treatment

Treatment may be effected by isolating T cells from patients or volunteers suffering from a disease associated with the PRAME antigen and introducing the TCR of the invention into such T cells, followed by reinfusion of these genetically engineered cells into the patient. Accordingly, the present invention provides a method of treating a PRAME associated disease comprising administering to a patient an isolated T cell expressing a TCR of the invention, preferably the T cell is derived from the patient per se. Generally, this involves (1) isolating T cells from the patient, (2) transducing T cells in vitro with a nucleic acid molecule of the invention or a nucleic acid molecule capable of encoding a TCR molecule of the invention, and (3) infusing the genetically modified T cells into the patient. The number of cells isolated, transfected and transfused can be determined by a physician.

The main advantages of the invention are:

(1) The TCR can be combined with a PRAME antigen short peptide complex VLDGDVLL-HLA A0201, and cells transduced with the TCR can be specifically activated and have strong killing effect on target cells.

The following specific examples further illustrate the invention. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not indicated in the following examples, are generally carried out according to conventional conditions, for example as described in Sambrook and Russell et al, molecular Cloning: A Laboratory Manual (third edition) (2001) CSHL Press, or according to the conditions as recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Example 1 cloning of PRAME antigen short peptide specific T cells

Peripheral Blood Lymphocytes (PBLs) from healthy volunteers of genotype HLA-A0201 were stimulated using the synthetic short peptide VLDGLL (SEQ ID NO: 9; baisheng Gene technologies, beijing). The VLDGDVLL short peptide and HLA-A0201 with biotin labels are renatured to prepare pHLA haploids. These haploids combined with streptavidin labeled with PE (BD Co.) to form PE-labeled tetramers, which were sorted from anti-CD 8-APC double positive cells. The sorted cells were expanded and subjected to secondary sorting as described above, followed by single cloning by limiting dilution. Monoclonal cells were stained with tetramer and double positive clones selected are shown in FIG. 3.

The function and specificity of the T cell clone were further tested by ELISPOT assay. Methods for detecting cell function using the ELISPOT assay are well known to those skilled in the art. The effector cells used in the IFN-gamma ELISPOT experiment in this example were T cell clones obtained in the present invention, the target cells were T2 cells loaded with the short peptide of the present invention, and the control group was T2 cells not loaded with any short peptide.

Firstly, preparing an ELISPOT plate, wherein the ELISPOT experiment steps are as follows: the components of the assay were added to the ELISPOT plates in the following order: 40 μ l T2 cells 5X 10 ⁵ After 40 μ l of effector cells (2000T cell clones/well) per ml of cells (i.e. 20,000T 2 cells/well), 20 μ l of specific short peptide was added to the experimental group, 20 μ l of medium (test medium) was added to the blank group, and 2 wells were set. Then incubated overnight (37 ℃,5% CO) ₂ ). The plates were then washed and subjected to secondary detection and color development, the plates were dried for 1 hour, and spots formed on the membrane were counted using an immuno-spot plate READER (ELISPOT READER system; AID Co.). As shown in FIG. 14, the obtained T cell clone specific to a specific antigen reacted specifically with T2 cells loaded with the short peptide of the present invention, but did not react substantially with T2 cells not loaded with the short peptide. Selecting the monoclonal cell meeting the functional condition to extract the TCR gene.

Example 2 construction of TCR Gene and vector for obtaining PRAME antigen short peptide specific T cell clone

Using Quick-RNA ^TM Extraction of antigen short peptide VLDGLVLL-specific HLA-A0201-restricted T cell clones selected in example 1 by MiniPrep (ZYMO research)Total RNA. The cDNA was synthesized using a SMART RACE cDNA amplification kit from clontech, using primers designed in the C-terminal conserved region of the human TCR gene. The sequences were cloned into the T vector (TAKARA) and sequenced. It should be noted that the sequence is a complementary sequence, not including introns. The alpha chain and beta chain sequence structures of the TCR expressed by the double positive clone are respectively shown in figure 1 and figure 2 by sequencing, and figure 1a, figure 1b, figure 1c, figure 1d, figure 1e and figure 1f are respectively a TCR alpha chain variable domain amino acid sequence, a TCR alpha chain variable domain nucleotide sequence, a TCR alpha chain amino acid sequence, a TCR alpha chain nucleotide sequence, a TCR alpha chain amino acid sequence with a leader sequence and a TCR alpha chain nucleotide sequence with the leader sequence; fig. 2a, fig. 2b, fig. 2c, fig. 2d, fig. 2e and fig. 2f are the TCR β 0 chain variable domain amino acid sequence, the TCR β 1 chain variable domain nucleotide sequence, the TCR β 2 chain amino acid sequence, the TCR β 3 chain nucleotide sequence, the TCR β chain amino acid sequence with leader sequence and the TCR β chain nucleotide sequence with leader sequence, respectively.

The alpha chain was identified to comprise CDRs with the following amino acid sequences:

αCDR1-TRDTTYY(SEQ ID NO:10)

αCDR2-RNSFDEQN(SEQ ID NO:11)

αCDR3-ALSERILNYGGSQGNLI(SEQ ID NO:12)

the beta chain comprises CDRs having the amino acid sequences:

βCDR1-SGDLS(SEQ ID NO:13)

βCDR2-YYNGEE(SEQ ID NO:14)

βCDR3-ASSGTGTDTQY(SEQ ID NO:15)

the full-length genes of the TCR α and β chains were cloned into the lentiviral expression vector pllenti (addendum) by overlap (overlap) PCR, respectively. The method comprises the following specific steps: the TCR alpha chain and the TCR beta chain are connected by overlap PCR to obtain the TCR alpha-2A-TCR beta segment. And (3) carrying out enzyme digestion and connection on the lentivirus expression vector and the TCR alpha-2A-TCR beta to obtain pLenti-TRA-2A-TRB-IRES-NGFR plasmid. As a control, a lentiviral vector pLenti-eGFP expressing eGFP was also constructed. The pseudovirus was then packaged again at 293T/17.

Example 3 expression, refolding and purification of PRAME antigen short peptide specific soluble TCR

To obtain soluble TCR molecules, the α and β chains of the TCR molecules of the invention may comprise only the variable domain and part of the constant domain thereof, respectively, and a cysteine residue has been introduced into the constant domains of the α and β chains, respectively, to form artificial interchain disulfide bonds, at the positions Thr48 of exon 1 TRAC × 01 and Ser57 of exon 1 TRBC2 × 01, respectively; the amino acid sequence and nucleotide sequence of the alpha chain are shown in FIGS. 4a and 4b, respectively, and the amino acid sequence and nucleotide sequence of the beta chain are shown in FIGS. 5a and 5b, respectively, and the introduced cysteine residues are shown in bold and underlined letters. The above-mentioned desired gene sequences for the TCR alpha and beta chains were synthesized and inserted into the expression vector pET28a + (Novagene) by standard methods described in Molecular Cloning A Laboratory Manual (third edition, sambrook and Russell), and the upstream and downstream Cloning sites were NcoI and NotI, respectively. The insert was confirmed by sequencing without error.

The expression vectors of TCR alpha and beta chains are respectively transformed into expression bacteria BL21 (DE 3) by a chemical transformation method, and the bacteria grow in LB culture solution and grow on OD ₆₀₀ At 0.6 induction with final concentration of 0.5mM IPTG, inclusion bodies formed after expression of the α and β chains of the TCR were extracted by BugBuster Mix (Novagene) and washed repeatedly with BugBuster solution several times, and finally dissolved in 6M guanidine hydrochloride, 10mM Dithiothreitol (DTT), 10mM ethylenediaminetetraacetic acid (EDTA), 20mM Tris (pH 8.1).

The TCR α and β chains after lysis were separated by 1:1 was rapidly mixed in 5M urea, 0.4M arginine, 20mM Tris (pH 8.1), 3.7mM cystamine,6.6mM ss-mericapoethylamine (4 ℃ C.) to a final concentration of 60mg/mL. After mixing, the solution was dialyzed against 10 volumes of deionized water (4 ℃ C.) and, after 12 hours, the deionized water was changed to a buffer (20mM Tris, pH 8.0) and dialysis was continued at 4 ℃ for 12 hours. The solution after completion of dialysis was filtered through a 0.45. Mu.M filter and then purified by an anion exchange column (HiTrap Q HP,5ml, GE Healthcare). The TCR eluted with peaks containing successfully renatured α and β dimers was confirmed by SDS-PAGE gel. The TCR was subsequently further purified by gel filtration chromatography (HiPrep 16/60, sephacryl S-100HR, GE Healthcare). The purity of the purified TCR was greater than 90% as determined by SDS-PAGE and the concentration was determined by BCA. The SDS-PAGE gel of the soluble TCR of the invention is shown in FIG. 6.

Example 4 Generation of soluble Single chain TCR specific for PRAME antigen short peptides

The variable domains of TCR α and β chains in example 2 were constructed as a stable soluble single-chain TCR molecule linked by a short flexible peptide (linker) using site-directed mutagenesis as described in WO 2014/206304. The amino acid sequence and the nucleotide sequence of the single-chain TCR molecule are shown in fig. 7a and 7b, respectively. The amino acid sequence and the nucleotide sequence of the alpha chain variable domain are shown in FIG. 8a and FIG. 8b respectively; the amino acid sequence and the nucleotide sequence of the beta chain variable domain are shown in FIG. 9a and FIG. 9b respectively; the amino acid sequence and the nucleotide sequence of the linker sequence are shown in FIG. 10a and FIG. 10b, respectively.

The target gene was digested simultaneously with Nco I and Not I, and ligated to pET28a vector digested simultaneously with Nco I and Not I. The ligation product was transformed into e.coli DH5 α, coated with LB plates containing kanamycin, inverted cultured overnight at 37 ℃, positive clones were selected for PCR screening, positive recombinants were sequenced, and after the correct sequence was determined, recombinant plasmids were extracted and transformed into e.coli BL21 (DE 3) for expression.

Example 5 expression, renaturation and purification of soluble Single chain TCR specific for the PRAME antigen short peptide

The BL21 (DE 3) colonies containing the recombinant plasmid pET28 a-template strand prepared in example 4 were all inoculated in LB medium containing kanamycin, cultured at 37 ℃ to OD600 of 0.6 to 0.8, IPTG was added to a final concentration of 0.5mM, and the culture was continued at 37 ℃ for 4 hours. The cell pellet was harvested by centrifugation at 5000rpm for 15min, the cell pellet was lysed by Bugbuster Master Mix (Merck), inclusion bodies were recovered by centrifugation at 6000rpm for 15min, washed with Bugbuster (Merck) to remove cell debris and membrane components, centrifuged at 6000rpm for 15min, and the inclusion bodies were collected. The inclusion bodies were dissolved in buffer (20 mM Tris-HCl pH 8.0, 8M urea), the insoluble material was removed by high speed centrifugation, and the supernatant was quantified by BCA method and stored at-80 ℃ for further use.

To 5mg of solubilized single-chain TCR inclusion body protein, 2.5mL of buffer (6M Gua-HCl, 50mM Tris-HCl pH 8.1, 100mM NaCl,10mM EDTA) was added, DTT was added to a final concentration of 10mM, and treatment was carried out at 37 ℃ for 30min. The treated single-chain TCR was added dropwise to 125mL of renaturation buffer (100 mM Tris-HCl pH 8.1,0.4M L-arginine, 5M urea, 2mM EDTA,6.5mM beta-mercaptoethylamine, 1.87mM Cystamine) with a syringe, stirred at 4 ℃ for 10min, and then the renaturation solution was filled into a cellulose membrane dialysis bag with a cut-off of 4kDa, and the dialysis bag was placed in 1L of precooled water and stirred slowly at 4 ℃ overnight. After 17 hours, the dialysate was changed to 1L of pre-chilled buffer (20 mM Tris-HCl pH 8.0), dialysis was continued at 4 ℃ for 8h, and then dialysis was continued overnight with the same fresh buffer. After 17 hours, the sample was filtered through a 0.45 μ M filter, vacuum degassed and then passed through an anion exchange column (HiTrap Q HP, GE Healthcare), the protein was purified by a 0-1M NaCl linear gradient eluent formulated in 20mM Tris-HCl pH 8.0, the fractions collected were subjected to SDS-PAGE analysis, the fractions containing single-chain TCR were concentrated and then further purified by a gel filtration column (Superdex 75/300, GE Healthcare), and the target fraction was also subjected to SDS-PAGE analysis.

The eluted fractions for BIAcore analysis were further tested for purity using gel filtration. The conditions are as follows: the chromatography column Agilent Bio SEC-3 (300A, phi 7.8X 300 mM) and the mobile phase were 150mM phosphate buffer, the flow rate was 0.5mL/min, the column temperature was 25 ℃ and the UV detection wavelength was 214nm.

The SDS-PAGE gel of the soluble single-chain TCR obtained by the invention is shown in FIG. 11.

Example 6 binding characterization

BIAcore analysis

This example demonstrates that soluble TCR molecules of the invention are capable of specifically binding to the vldglll-HLA a0201 complex.

Binding activity of the TCR molecules obtained in examples 3 and 5 to the vldgll-HLA a0201 complex was measured using a BIAcore T200 real-time assay system. Anti-streptavidin antibody (GenScript) was added to coupling buffer (10 mM sodium acetate buffer, pH 4.77), and then the antibody was passed through CM5 chip previously activated with EDC and NHS to immobilize the antibody on the chip surface, and finally the unreacted activated surface was blocked with ethanolamine hydrochloric acid solution to complete the coupling process at a coupling level of about 15,000 RU.

A low concentration of streptavidin was flowed over the antibody coated chip surface, then the VLDGLVLL-HLA A0201 complex was flowed over the detection channel, the other channel served as a reference channel, and 0.05 mM biotin was flowed over the chip at a flow rate of 10. Mu.L/min for 2min to block the remaining binding sites of streptavidin.

The procedure for the preparation of the above VLDGLVLL-HLA A0201 complex is as follows:

a. purification of

Collecting 100ml E.coli liquid for inducing expression of heavy chain or light chain, centrifuging at 4 ℃ for 10min at 8000g, washing the thalli once with 10ml PBS, then resuspending the thalli with 5ml BugBuster Master Mix Extraction Reagents (Merck) by vigorous shaking, rotatably incubating at room temperature for 20min, centrifuging at 4 ℃ for 15min at 6000g, discarding supernatant, and collecting inclusion body.

Resuspending the inclusion bodies in 5ml of BugBuster Master Mix, and rotary incubating at room temperature for 5min; adding 30ml of 10-fold diluted BugBuster, uniformly mixing, and centrifuging at 4 ℃ at 6000g for 15min; discarding supernatant, adding 30ml of 10-fold diluted BugBuster to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, repeating twice, adding 30ml of 20mM Tris-HCl with pH of 8.0 to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, finally dissolving the inclusion bodies by using 20mM Tris-HCl 8M urea, detecting the purity of the inclusion bodies by SDS-PAGE, and detecting the concentration by using a BCA kit.

b. Renaturation

The synthesized short peptide VLDGLLL (Beijing Cenbuterol Gene technology Co., ltd.) was dissolved in DMSO to a concentration of 20 mg/ml. Inclusion of light and heavy chains was solubilized using 8M urea, 20mM Tris pH 8.0, 10mM DTT, and further denatured by addition of 3M guanidine hydrochloride, 10mM sodium acetate, 10mM EDTA prior to renaturation. VLDGLVLL peptide was added to a renaturation buffer (0.4M L-arginine, 100mM Tris pH 8.3, 2mM EDTA, 0.5mM oxidative glutathione, 5mM reduced glutathione, 0.2mM PMSF, cooled to 4 ℃) at 25mg/L (final concentration), followed by the addition of 20mg/L of light chain and 90mg/L of heavy chain in sequence (final concentration, heavy chain was added in three portions, 8 h/time), renaturation was carried out at 4 ℃ for at least 3 days until completion, and SDS-PAGE was checked for success or failure.

c. Purification after renaturation

The renaturation buffer was replaced by dialysis against 10 volumes of 20mM Tris pH 8.0, at least twice to reduce the ionic strength of the solution sufficiently. After dialysis, the protein solution was filtered through a 0.45 μm cellulose acetate filter and then loaded on a HiTrap Q HP (GE general electric) anion exchange column (5 ml bed volume). The protein was eluted using a linear gradient of 0-400mM NaCl prepared using an Akta purifier (GE general electric) at 20mM Tris pH 8.0, pMHC was eluted at about 250mM NaCl, and the peak fractions were collected and subjected to purity detection using SDS-PAGE.

d. Biotinylation of the peptide

The purified pMHC molecules were concentrated using Millipore ultrafiltration tubes while the buffer was replaced with 20mM Tris pH 8.0, followed by addition of biotinylation reagent 0.05M Bicine pH 8.3, 10mM ATP, 10mM MgOAc, 50. Mu.M D-Biotin, 100. Mu.g/ml BirA enzyme (GST-BirA), incubation of the mixture overnight at room temperature, and SDS-PAGE to determine the completion of biotinylation.

e. Purification of biotinylated complexes

The biotinylated pMHC molecules were concentrated to 1ml using Millipore ultrafiltration tubes, the biotinylated pMHC was purified by gel filtration chromatography, and HiPrep was pre-equilibrated with filtered PBS using an Akta purifier (GE general electric Co., ltd.) ^TM A16/60S 200HR column (GE general electric) was loaded with 1ml of concentrated biotinylated pMHC molecules and then eluted with PBS at a flow rate of 1 ml/min. Biotinylated pMHC molecules appeared as a single peak elution at approximately 55 ml. The fractions containing the protein were pooled, concentrated using Millipore ultrafiltration tubes, protein concentration was determined by BCA (Thermo), and biotinylated pMHC molecules were stored in aliquots at-80 ℃ by addition of the protease inhibitor cocktail (Roche).

Kinetic parameters are calculated by BIAcore Evaluation software, and kinetic maps of the combination of the soluble TCR molecule and the VLDGDLVL-HLA A0201 compound constructed by the soluble TCR molecule and the VLDGDLVL-HLA A0201 compound are obtained and are respectively shown in figure 12 and figure 13. The maps show that both soluble TCR molecules and soluble single-chain TCR molecules obtained by the invention can bind to the VLDGLVLL-HLA A0201 complex. Meanwhile, the method is utilized to detect the binding activity of the soluble TCR molecule and the short peptides of other irrelevant antigens and the HLA compound, and the result shows that the TCR molecule is not bound with other irrelevant antigens.

Example 7 activation of T cells transducing TCRs of the invention

Constructing a lentivirus vector containing the TCR target gene, transducing T cells, and carrying out an ELISPOT functional verification test.

ELISPOT scheme

The following assays were performed to demonstrate the specific activation response of T cells transduced by the inventive TCR on target cells. IFN-. Gamma.production as measured by the ELISPOT assay was used as a readout for T cell activation.

Reagent

Test medium: 10% of FBS (Gibco, catalog number 16000-044), RPMI 1640 (Gibco, catalog number C11875500 bt)

Wash buffer (PBST): 0.01M PBS/0.05% Tween 20

PBS (Gibbo Co., catalog number C10010500 BT)

PVDF ELISPOT 96-well plate (Merck Millipore, cat. No. MSIPS 4510)

Human IFN-. Gamma.ELISPOT PVDF-enzyme kit (BD) contains all other reagents required (capture and detection antibodies, streptavidin-alkaline phosphatase and BCIP/NBT solution)

Method

Target cell preparation

The target cells used in this experiment were T2 cells loaded with specific short peptides. Target cells were prepared in experimental media: the concentration of the target cells is adjusted to 2.0X 10 ⁵ One/ml, 100. Mu.l/well to obtain 2.0X 10 ⁴ Individual cells/well.

Effector cell preparation

The effector cells (T cells) of this experiment were CD8 expressing the TCR specific for the PRAME antigen oligopeptide of the invention ⁺ T cells and CD8 cells not transfected with the TCR of the invention by the same volunteer ⁺ T was used as a control group. Stimulation of T cells with anti-CD 3/CD28 coated beads (T cell amplicons), with PRAME-carrying antibodiesLentiviral transduction of the original short peptide-specific TCR gene was amplified in 10% FBS-containing 1640 medium containing 50IU/ml IL-2 and 10ng/ml IL-7 until 9-12 days after transduction, and then the cells were placed in the test medium and centrifuged at 300g at room temperature for 10 minutes for washing. The cells were then resuspended in the test medium at 2 × the desired final concentration. Negative control effector cells were treated as well.

Preparation of short peptide solution

The corresponding short peptide was added to the corresponding target cell (T2) experimental group to give a final concentration of 1. Mu.g/ml in the ELISPOT well plate.

ELISPOT

The well plates were prepared as follows according to the manufacturer's instructions: 10ml of sterile PBS per plate 1: anti-human IFN- γ capture antibody was diluted 200, and 100 μ l of the diluted capture antibody was then added in aliquots to each well. The plates were incubated overnight at 4 ℃. After incubation, the well plates were washed to remove excess capture antibody. Add 100. Mu.l/well RPMI 1640 medium containing 10% FBS and incubate the well plates at room temperature for 2 hours to close the well plates. The media was then washed from the well plate, and any residual wash buffer was removed by flicking and tapping the ELISPOT well plate on paper.

The components of the assay were then added to ELISPOT well plates in the following order:

100 microliter of target cells 2 x 10 ⁵ Cells/ml (total of about 2 x 10 was obtained) ⁴ One target cell/well).

100 microliter of effector cells (1 x 10) ⁴ Individual control effector cells/well and PRAME TCR positive T cells/well).

All wells were prepared in duplicate for addition.

The plates were then incubated overnight (37 ℃/5% CO) ₂ ) The next day, the medium was discarded, the well plate was washed 2 times with double distilled water, then 3 times with wash buffer, and tapped on a paper towel to remove residual wash buffer. Then, the mixture was diluted with 10-vol FBS-containing PBS in a proportion of 1: the test antibody was diluted 200 and added to each well at 100. Mu.l/well. The well plates were incubated at room temperature for 2 hours, washed 3 times with wash buffer, and the well plates were tapped on paper towels to remove excess wash buffer.

Using PBS containing 10% FBS, 1: streptavidin-alkaline phosphatase was diluted 100, 100 microliters of diluted streptavidin-alkaline phosphatase was added to each well and the wells were incubated for 1 hour at room temperature. The plates were then washed 2 times with 4 washes of PBS and tapped on a paper towel to remove excess wash buffer and PBS. After washing, 100 microliter of BCIP/NBT solution provided by the kit is added for development. And covering the well plate with tin foil paper in dark during development, and standing for 5-15 minutes. Spots on the developing plate were routinely detected during this period to determine the optimum time for terminating the reaction. The BCIP/NBT solution was removed and the well plate was rinsed with double-distilled water to stop the development reaction, spun-dried, then the bottom of the well plate was removed, the well plate was dried at room temperature until each well was completely dried, and then the spots formed in the bottom film of the well plate were counted using an immune spot plate counter (CTL, cell Technology Limited).

As a result, the

The TCR-transduced T cells of the invention were tested for IFN- γ release in response to target cells loaded with the PRAME antigen short peptide vldgll by ELISPOT assay (as described above). The number of ELSPOT spots observed in each well was plotted using a graphpad prism 6.

As shown in FIG. 15, T cells transduced with the TCR of the invention were shown to be very active against target cells loaded with their specific short peptides, whereas T cells not transduced with the TCR of the invention were shown to be essentially non-active against the corresponding target cells.

All documents mentioned in this application are incorporated by reference in this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes or modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the appended claims of the present application.

Sequence listing

<110> Guangdong Xiangxue accurate medical technology Limited

<120> TCR for identifying PRAME antigen short peptide and coding sequence thereof

<130> P2017-1881

<160> 37

<170> PatentIn version 3.5

<210> 1

<211> 121

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 1

Ala Gln Lys Val Thr Gln Ala Gln Thr Glu Ile Ser Val Val Glu Lys

1 5 10 15

Glu Asp Val Thr Leu Asp Cys Val Tyr Glu Thr Arg Asp Thr Thr Tyr

20 25 30

Tyr Leu Phe Trp Tyr Lys Gln Pro Pro Ser Gly Glu Leu Val Phe Leu

35 40 45

Ile Arg Arg Asn Ser Phe Asp Glu Gln Asn Glu Ile Ser Gly Arg Tyr

50 55 60

Ser Trp Asn Phe Gln Lys Ser Thr Ser Ser Phe Asn Phe Thr Ile Thr

65 70 75 80

Ala Ser Gln Val Val Asp Ser Ala Val Tyr Phe Cys Ala Leu Ser Glu

85 90 95

Arg Ile Leu Asn Tyr Gly Gly Ser Gln Gly Asn Leu Ile Phe Gly Lys

100 105 110

Gly Thr Lys Leu Ser Val Lys Pro Asn

115 120

<210> 2

<211> 363

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

gctcagaagg taactcaagc gcagactgaa atttctgtgg tggagaagga ggatgtgacc 60

ttggactgtg tgtatgaaac ccgtgatact acttattact tattctggta caagcaacca 120

ccaagtggag aattggtttt ccttattcgt cggaactctt ttgatgagca aaatgaaata 180

agtggtcggt attcttggaa cttccagaaa tccaccagtt ccttcaactt caccatcaca 240

gcctcacaag tcgtggactc agcagtatac ttctgtgctc tgagtgagag aattctgaat 300

tatggaggaa gccaaggaaa tctcatcttt ggaaaaggca ctaaactctc tgttaaacca 360

aat 363

<210> 3

<211> 261

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 3

Ala Gln Lys Val Thr Gln Ala Gln Thr Glu Ile Ser Val Val Glu Lys

1 5 10 15

Glu Asp Val Thr Leu Asp Cys Val Tyr Glu Thr Arg Asp Thr Thr Tyr

20 25 30

Tyr Leu Phe Trp Tyr Lys Gln Pro Pro Ser Gly Glu Leu Val Phe Leu

35 40 45

Ile Arg Arg Asn Ser Phe Asp Glu Gln Asn Glu Ile Ser Gly Arg Tyr

50 55 60

Ser Trp Asn Phe Gln Lys Ser Thr Ser Ser Phe Asn Phe Thr Ile Thr

65 70 75 80

Ala Ser Gln Val Val Asp Ser Ala Val Tyr Phe Cys Ala Leu Ser Glu

85 90 95

Arg Ile Leu Asn Tyr Gly Gly Ser Gln Gly Asn Leu Ile Phe Gly Lys

100 105 110

Gly Thr Lys Leu Ser Val Lys Pro Asn Ile Gln Asn Pro Asp Pro Ala

115 120 125

Val Tyr Gln Leu Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu

130 135 140

Phe Thr Asp Phe Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser

145 150 155 160

Asp Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp

165 170 175

Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala

180 185 190

Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe

195 200 205

Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe

210 215 220

Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe

225 230 235 240

Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu

245 250 255

Arg Leu Trp Ser Ser

260

<210> 4

<211> 783

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

gctcagaagg taactcaagc gcagactgaa atttctgtgg tggagaagga ggatgtgacc 60

ttggactgtg tgtatgaaac ccgtgatact acttattact tattctggta caagcaacca 120

ccaagtggag aattggtttt ccttattcgt cggaactctt ttgatgagca aaatgaaata 180

agtggtcggt attcttggaa cttccagaaa tccaccagtt ccttcaactt caccatcaca 240

gcctcacaag tcgtggactc agcagtatac ttctgtgctc tgagtgagag aattctgaat 300

tatggaggaa gccaaggaaa tctcatcttt ggaaaaggca ctaaactctc tgttaaacca 360

aatatccaga accctgaccc tgccgtgtac cagctgagag actctaaatc cagtgacaag 420

tctgtctgcc tattcaccga ttttgattct caaacaaatg tgtcacaaag taaggattct 480

gatgtgtata tcacagacaa aactgtgcta gacatgaggt ctatggactt caagagcaac 540

agtgctgtgg cctggagcaa caaatctgac tttgcatgtg caaacgcctt caacaacagc 600

attattccag aagacacctt cttccccagc ccagaaagtt cctgtgatgt caagctggtc 660

gagaaaagct ttgaaacaga tacgaaccta aactttcaaa acctgtcagt gattgggttc 720

cgaatcctcc tcctgaaagt ggccgggttt aatctgctca tgacgctgcg gctgtggtcc 780

agc 783

<210> 5

<211> 112

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 5

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr Ala Thr Gly

1 5 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Leu Ser Ser

65 70 75 80

Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Gly Thr

85 90 95

Gly Thr Asp Thr Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Leu

100 105 110

<210> 6

<211> 336

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

gattctggag tcacacaaac cccaaagcac ctgatcacag caactggaca gcgagtgacg 60

ctgagatgct cccctaggtc tggagacctc tctgtgtact ggtaccaaca gagcctggac 120

cagggcctcc agttcctcat tcagtattat aatggagaag agagagcaaa aggaaacatt 180

cttgaacgat tctccgcaca acagttccct gacttgcact ctgaactaaa cctgagctct 240

ctggagctgg gggactcagc tttgtatttc tgtgccagct ccgggacagg cacagatacg 300

cagtattttg gcccaggcac ccggctgaca gtgctc 336

<210> 7

<211> 291

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 7

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr Ala Thr Gly

1 5 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Leu Ser Ser

65 70 75 80

Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Gly Thr

85 90 95

Gly Thr Asp Thr Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Leu

100 105 110

Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro

115 120 125

Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu

130 135 140

Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn

145 150 155 160

Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys

165 170 175

Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu

180 185 190

Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys

195 200 205

Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp

210 215 220

Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg

225 230 235 240

Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser

245 250 255

Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala

260 265 270

Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp

275 280 285

Ser Arg Gly

290

<210> 8

<211> 873

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

gattctggag tcacacaaac cccaaagcac ctgatcacag caactggaca gcgagtgacg 60

ctgagatgct cccctaggtc tggagacctc tctgtgtact ggtaccaaca gagcctggac 120

cagggcctcc agttcctcat tcagtattat aatggagaag agagagcaaa aggaaacatt 180

cttgaacgat tctccgcaca acagttccct gacttgcact ctgaactaaa cctgagctct 240

ctggagctgg gggactcagc tttgtatttc tgtgccagct ccgggacagg cacagatacg 300

cagtattttg gcccaggcac ccggctgaca gtgctcgagg acctgaaaaa cgtgttccca 360

cccgaggtcg ctgtgtttga gccatcagaa gcagagatct cccacaccca aaaggccaca 420

ctggtgtgcc tggccacagg cttctacccc gaccacgtgg agctgagctg gtgggtgaat 480

gggaaggagg tgcacagtgg ggtcagcaca gacccgcagc ccctcaagga gcagcccgcc 540

ctcaatgact ccagatactg cctgagcagc cgcctgaggg tctcggccac cttctggcag 600

aacccccgca accacttccg ctgtcaagtc cagttctacg ggctctcgga gaatgacgag 660

tggacccagg atagggccaa acctgtcacc cagatcgtca gcgccgaggc ctggggtaga 720

gcagactgtg gcttcacctc cgagtcttac cagcaagggg tcctgtctgc caccatcctc 780

tatgagatct tgctagggaa ggccaccttg tatgccgtgc tggtcagtgc cctcgtgctg 840

atggccatgg tcaagagaaa ggattccaga ggc 873

<210> 9

<211> 9

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 9

Val Leu Asp Gly Leu Asp Val Leu Leu

1 5

<210> 10

<211> 7

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 10

Thr Arg Asp Thr Thr Tyr Tyr

1 5

<210> 11

<211> 8

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 11

Arg Asn Ser Phe Asp Glu Gln Asn

1 5

<210> 12

<211> 17

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 12

Ala Leu Ser Glu Arg Ile Leu Asn Tyr Gly Gly Ser Gln Gly Asn Leu

1 5 10 15

Ile

<210> 13

<211> 5

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 13

Ser Gly Asp Leu Ser

1 5

<210> 14

<211> 6

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 14

Tyr Tyr Asn Gly Glu Glu

1 5

<210> 15

<211> 11

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 15

Ala Ser Ser Gly Thr Gly Thr Asp Thr Gln Tyr

1 5 10

<210> 16

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 16

acccgtgata ctacttatta c 21

<210> 17

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 17

cggaactctt ttgatgagca aaat 24

<210> 18

<211> 51

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 18

gctctgagtg agagaattct gaattatgga ggaagccaag gaaatctcat c 51

<210> 19

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 19

tctggagacc tctct 15

<210> 20

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 20

tattataatg gagaagag 18

<210> 21

<211> 33

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 21

gccagctccg ggacaggcac agatacgcag tat 33

<210> 22

<211> 281

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 22

Met Leu Thr Ala Ser Leu Leu Arg Ala Val Ile Ala Ser Ile Cys Val

1 5 10 15

Val Ser Ser Met Ala Gln Lys Val Thr Gln Ala Gln Thr Glu Ile Ser

20 25 30

Val Val Glu Lys Glu Asp Val Thr Leu Asp Cys Val Tyr Glu Thr Arg

35 40 45

Asp Thr Thr Tyr Tyr Leu Phe Trp Tyr Lys Gln Pro Pro Ser Gly Glu

50 55 60

Leu Val Phe Leu Ile Arg Arg Asn Ser Phe Asp Glu Gln Asn Glu Ile

65 70 75 80

Ser Gly Arg Tyr Ser Trp Asn Phe Gln Lys Ser Thr Ser Ser Phe Asn

85 90 95

Phe Thr Ile Thr Ala Ser Gln Val Val Asp Ser Ala Val Tyr Phe Cys

100 105 110

Ala Leu Ser Glu Arg Ile Leu Asn Tyr Gly Gly Ser Gln Gly Asn Leu

115 120 125

Ile Phe Gly Lys Gly Thr Lys Leu Ser Val Lys Pro Asn Ile Gln Asn

130 135 140

Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys Ser Ser Asp Lys

145 150 155 160

Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr Asn Val Ser Gln

165 170 175

Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met

180 185 190

Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys

195 200 205

Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu

210 215 220

Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val

225 230 235 240

Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser

245 250 255

Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu

260 265 270

Leu Met Thr Leu Arg Leu Trp Ser Ser

275 280

<210> 23

<211> 843

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 23

atgctgactg ccagcctgtt gagggcagtc atagcctcca tctgtgttgt atccagcatg 60

gctcagaagg taactcaagc gcagactgaa atttctgtgg tggagaagga ggatgtgacc 120

ttggactgtg tgtatgaaac ccgtgatact acttattact tattctggta caagcaacca 180

ccaagtggag aattggtttt ccttattcgt cggaactctt ttgatgagca aaatgaaata 240

agtggtcggt attcttggaa cttccagaaa tccaccagtt ccttcaactt caccatcaca 300

gcctcacaag tcgtggactc agcagtatac ttctgtgctc tgagtgagag aattctgaat 360

tatggaggaa gccaaggaaa tctcatcttt ggaaaaggca ctaaactctc tgttaaacca 420

aatatccaga accctgaccc tgccgtgtac cagctgagag actctaaatc cagtgacaag 480

tctgtctgcc tattcaccga ttttgattct caaacaaatg tgtcacaaag taaggattct 540

gatgtgtata tcacagacaa aactgtgcta gacatgaggt ctatggactt caagagcaac 600

agtgctgtgg cctggagcaa caaatctgac tttgcatgtg caaacgcctt caacaacagc 660

attattccag aagacacctt cttccccagc ccagaaagtt cctgtgatgt caagctggtc 720

gagaaaagct ttgaaacaga tacgaaccta aactttcaaa acctgtcagt gattgggttc 780

cgaatcctcc tcctgaaagt ggccgggttt aatctgctca tgacgctgcg gctgtggtcc 840

agc 843

<210> 24

<211> 310

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 24

Met Gly Phe Arg Leu Leu Cys Cys Val Ala Phe Cys Leu Leu Gly Ala

1 5 10 15

Gly Pro Val Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr

20 25 30

Ala Thr Gly Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp

35 40 45

Leu Ser Val Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe

50 55 60

Leu Ile Gln Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu

65 70 75 80

Glu Arg Phe Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn

85 90 95

Leu Ser Ser Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser

100 105 110

Ser Gly Thr Gly Thr Asp Thr Gln Tyr Phe Gly Pro Gly Thr Arg Leu

115 120 125

Thr Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val

130 135 140

Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu

145 150 155 160

Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp

165 170 175

Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln

180 185 190

Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser

195 200 205

Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His

210 215 220

Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp

225 230 235 240

Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala

245 250 255

Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly

260 265 270

Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr

275 280 285

Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys

290 295 300

Arg Lys Asp Ser Arg Gly

305 310

<210> 25

<211> 930

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 25

atgggcttca ggctcctctg ctgtgtggcc ttttgtctcc tgggagcagg cccagtggat 60

tctggagtca cacaaacccc aaagcacctg atcacagcaa ctggacagcg agtgacgctg 120

agatgctccc ctaggtctgg agacctctct gtgtactggt accaacagag cctggaccag 180

ggcctccagt tcctcattca gtattataat ggagaagaga gagcaaaagg aaacattctt 240

gaacgattct ccgcacaaca gttccctgac ttgcactctg aactaaacct gagctctctg 300

gagctggggg actcagcttt gtatttctgt gccagctccg ggacaggcac agatacgcag 360

tattttggcc caggcacccg gctgacagtg ctcgaggacc tgaaaaacgt gttcccaccc 420

gaggtcgctg tgtttgagcc atcagaagca gagatctccc acacccaaaa ggccacactg 480

gtgtgcctgg ccacaggctt ctaccccgac cacgtggagc tgagctggtg ggtgaatggg 540

aaggaggtgc acagtggggt cagcacagac ccgcagcccc tcaaggagca gcccgccctc 600

aatgactcca gatactgcct gagcagccgc ctgagggtct cggccacctt ctggcagaac 660

ccccgcaacc acttccgctg tcaagtccag ttctacgggc tctcggagaa tgacgagtgg 720

acccaggata gggccaaacc tgtcacccag atcgtcagcg ccgaggcctg gggtagagca 780

gactgtggct tcacctccga gtcttaccag caaggggtcc tgtctgccac catcctctat 840

gagatcttgc tagggaaggc caccttgtat gccgtgctgg tcagtgccct cgtgctgatg 900

gccatggtca agagaaagga ttccagaggc 930

<210> 26

<211> 215

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 26

Met Ala Gln Lys Val Thr Gln Ala Gln Thr Glu Ile Ser Val Val Glu

1 5 10 15

Lys Glu Asp Val Thr Leu Asp Cys Val Tyr Glu Thr Arg Asp Thr Thr

20 25 30

Tyr Tyr Leu Phe Trp Tyr Lys Gln Pro Pro Ser Gly Glu Leu Val Phe

35 40 45

Leu Ile Arg Arg Asn Ser Phe Asp Glu Gln Asn Glu Ile Ser Gly Arg

50 55 60

Tyr Ser Trp Asn Phe Gln Lys Ser Thr Ser Ser Phe Asn Phe Thr Ile

65 70 75 80

Thr Ala Ser Gln Val Val Asp Ser Ala Val Tyr Phe Cys Ala Leu Ser

85 90 95

Glu Arg Ile Leu Asn Tyr Gly Gly Ser Gln Gly Asn Leu Ile Phe Gly

100 105 110

Lys Gly Thr Lys Leu Ser Val Lys Pro Asn Ile Gln Asn Pro Asp Pro

115 120 125

Ala Val Tyr Gln Leu Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys

130 135 140

Leu Phe Thr Asp Phe Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp

145 150 155 160

Ser Asp Val Tyr Ile Thr Asp Lys Cys Val Leu Asp Met Arg Ser Met

165 170 175

Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe

180 185 190

Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe

195 200 205

Phe Pro Ser Pro Glu Ser Ser

210 215

<210> 27

<211> 645

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 27

atggcgcaga aagtgaccca agcgcagact gaaatttctg tggtggagaa ggaggatgtg 60

accttggact gtgtgtatga aacccgtgat actacttatt acttattctg gtacaagcaa 120

ccaccaagtg gagaattggt tttccttatt cgtcggaact cttttgatga gcaaaatgaa 180

ataagtggtc ggtattcttg gaacttccag aaatccacca gttccttcaa cttcaccatc 240

acagcctcac aagtcgtgga ctcagcagta tacttctgtg ctctgagtga gagaattctg 300

aattatggag gaagccaagg aaatctcatc tttggaaaag gcactaaact ctctgttaaa 360

ccaaatatcc agaaccctga ccctgccgtg taccagctga gagactctaa gtcgagtgac 420

aagtctgtct gcctattcac cgattttgat tctcaaacaa atgtgtcaca aagtaaggat 480

tctgatgtgt atatcacaga caaatgtgtg ctagacatga ggtctatgga cttcaagagc 540

aacagtgctg tggcctggag caacaaatct gactttgcat gtgcaaacgc cttcaacaac 600

agcattattc cagaagacac cttcttcccc agcccagaaa gttcc 645

<210> 28

<211> 243

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 28

Met Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ile Thr Ala Thr

1 5 10 15

Gly Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser

20 25 30

Val Tyr Trp Tyr Gln Gln Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile

35 40 45

Gln Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg

50 55 60

Phe Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Leu Ser

65 70 75 80

Ser Leu Glu Leu Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Gly

85 90 95

Thr Gly Thr Asp Thr Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val

100 105 110

Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu

115 120 125

Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys

130 135 140

Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val

145 150 155 160

Asn Gly Lys Glu Val His Ser Gly Val Cys Thr Asp Pro Gln Pro Leu

165 170 175

Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Ala Leu Ser Ser Arg

180 185 190

Leu Arg Val Ser Ala Thr Phe Trp Gln Asp Pro Arg Asn His Phe Arg

195 200 205

Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln

210 215 220

Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly

225 230 235 240

Arg Ala Asp

<210> 29

<211> 729

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 29

atggatagcg gcgtgaccca aaccccaaag cacctgatca cagcaactgg acagcgagtg 60

acgctgagat gctcccctag gtctggagac ctctctgtgt actggtacca acagagcctg 120

gaccagggcc tccagttcct cattcagtat tataatggag aagagagagc aaaaggaaac 180

attcttgaac gattctccgc acaacagttc cctgacttgc actctgaact aaacctgagc 240

tctctggagc tgggggactc agctttgtat ttctgtgcca gctccgggac aggcacagat 300

acgcagtatt ttggcccagg cacccggctg acagtgctcg aggacctgaa aaacgtgttc 360

ccacccgagg tcgctgtgtt tgagccatca gaagcagaga tctcccacac ccaaaaggcc 420

acactggtgt gcctggccac cggtttctac cccgaccacg tggagctgag ctggtgggtg 480

aatgggaagg aggtgcacag tggggtctgc acagacccgc agcccctcaa ggagcagccc 540

gccctcaatg actccagata cgctctgagc agccgcctga gggtctcggc caccttctgg 600

caggaccccc gcaaccactt ccgctgtcaa gtccagttct acgggctctc ggagaatgac 660

gagtggaccc aggatagggc caaacccgtc acccagatcg tcagcgccga ggcctggggt 720

agagcagac 729

<210> 30

<211> 256

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 30

Ala Gln Lys Val Thr Gln Ala Gln Thr Glu Leu Ser Val Pro Glu Gly

1 5 10 15

Glu Asp Val Thr Ile Asp Cys Val Tyr Glu Thr Arg Asp Thr Thr Tyr

20 25 30

Tyr Leu Phe Trp Tyr Arg Gln Asp Pro Gly Gly Glu Leu Val Phe Leu

35 40 45

Ile Arg Arg Asn Ser Phe Asp Glu Gln Asn Glu Ile Ser Gly Arg Tyr

50 55 60

Ser Trp Asn Phe Gln Lys Ser Thr Ser Ser Phe Asn Phe Thr Ile Thr

65 70 75 80

Ala Val Gln Pro Val Asp Ser Ala Val Tyr Phe Cys Ala Leu Ser Glu

85 90 95

Arg Ile Leu Asn Tyr Gly Gly Ser Gln Gly Asn Leu Ile Phe Gly Lys

100 105 110

Gly Thr Lys Leu Ser Val Lys Pro Gly Gly Gly Ser Glu Gly Gly Gly

115 120 125

Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Thr Gly

130 135 140

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ser Val Ala Thr Gly

145 150 155 160

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

165 170 175

Tyr Trp Tyr Arg Gln Asp Pro Gly Gln Gly Leu Gln Phe Leu Ile Gln

180 185 190

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

195 200 205

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Ile Ser Ser

210 215 220

Val Glu Pro Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Gly Thr

225 230 235 240

Gly Thr Asp Thr Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Asp

245 250 255

<210> 31

<211> 768

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 31

gctcagaaag tgacccaggc ccagaccgaa ctgagtgttc cggaaggtga agatgttacc 60

attgattgtg tttatgaaac ccgcgatacc acctattatc tgttttggta tcgccaggat 120

ccgggcggcg aactggtgtt tctgattcgt cgtaatagtt ttgatgaaca gaatgaaatc 180

agcggtcgtt atagctggaa ttttcagaaa agcaccagca gttttaattt taccattacc 240

gcagttcagc cggtggatag cgccgtgtat ttttgtgcac tgagcgaacg cattctgaat 300

tatggcggta gccagggtaa tctgattttt ggtaaaggca ccaaactgag tgttaaaccg 360

ggcggtggta gcgaaggcgg tggcagtgaa ggtggtggca gcgaaggtgg tggtagcgag 420

ggtggtaccg gcgatagcgg cgtgacccag accccgaaac atctgagcgt ggcaaccggt 480

cagcgtgtga ccctgcgctg tagcccgcgc agtggcgatc tgagcgttta ttggtatcgt 540

caggatccgg gtcagggtct gcagtttctg attcagtatt ataatggcga agaacgcgcc 600

aaaggcaata ttctggaacg ttttagcgcc cagcagtttc cggatctgca tagcgaactg 660

aatattagta gtgttgaacc gggcgatagc gccctgtatt tttgtgcgag tagcggtacc 720

ggcaccgata cccagtattt tggtccgggc acccgcctga ccgtggat 768

<210> 32

<211> 120

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 32

Ala Gln Lys Val Thr Gln Ala Gln Thr Glu Leu Ser Val Pro Glu Gly

1 5 10 15

Glu Asp Val Thr Ile Asp Cys Val Tyr Glu Thr Arg Asp Thr Thr Tyr

20 25 30

Tyr Leu Phe Trp Tyr Arg Gln Asp Pro Gly Gly Glu Leu Val Phe Leu

35 40 45

Ile Arg Arg Asn Ser Phe Asp Glu Gln Asn Glu Ile Ser Gly Arg Tyr

50 55 60

Ser Trp Asn Phe Gln Lys Ser Thr Ser Ser Phe Asn Phe Thr Ile Thr

65 70 75 80

Ala Val Gln Pro Val Asp Ser Ala Val Tyr Phe Cys Ala Leu Ser Glu

85 90 95

Arg Ile Leu Asn Tyr Gly Gly Ser Gln Gly Asn Leu Ile Phe Gly Lys

100 105 110

Gly Thr Lys Leu Ser Val Lys Pro

115 120

<210> 33

<211> 360

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 33

gctcagaaag tgacccaggc ccagaccgaa ctgagtgttc cggaaggtga agatgttacc 60

attgattgtg tttatgaaac ccgcgatacc acctattatc tgttttggta tcgccaggat 120

ccgggcggcg aactggtgtt tctgattcgt cgtaatagtt ttgatgaaca gaatgaaatc 180

agcggtcgtt atagctggaa ttttcagaaa agcaccagca gttttaattt taccattacc 240

gcagttcagc cggtggatag cgccgtgtat ttttgtgcac tgagcgaacg cattctgaat 300

tatggcggta gccagggtaa tctgattttt ggtaaaggca ccaaactgag tgttaaaccg 360

<210> 34

<211> 112

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 34

Asp Ser Gly Val Thr Gln Thr Pro Lys His Leu Ser Val Ala Thr Gly

1 5 10 15

Gln Arg Val Thr Leu Arg Cys Ser Pro Arg Ser Gly Asp Leu Ser Val

20 25 30

Tyr Trp Tyr Arg Gln Asp Pro Gly Gln Gly Leu Gln Phe Leu Ile Gln

35 40 45

Tyr Tyr Asn Gly Glu Glu Arg Ala Lys Gly Asn Ile Leu Glu Arg Phe

50 55 60

Ser Ala Gln Gln Phe Pro Asp Leu His Ser Glu Leu Asn Ile Ser Ser

65 70 75 80

Val Glu Pro Gly Asp Ser Ala Leu Tyr Phe Cys Ala Ser Ser Gly Thr

85 90 95

Gly Thr Asp Thr Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Asp

100 105 110

<210> 35

<211> 336

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 35

gatagcggcg tgacccagac cccgaaacat ctgagcgtgg caaccggtca gcgtgtgacc 60

ctgcgctgta gcccgcgcag tggcgatctg agcgtttatt ggtatcgtca ggatccgggt 120

cagggtctgc agtttctgat tcagtattat aatggcgaag aacgcgccaa aggcaatatt 180

ctggaacgtt ttagcgccca gcagtttccg gatctgcata gcgaactgaa tattagtagt 240

gttgaaccgg gcgatagcgc cctgtatttt tgtgcgagta gcggtaccgg caccgatacc 300

cagtattttg gtccgggcac ccgcctgacc gtggat 336

<210> 36

<211> 24

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 36

Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly

1 5 10 15

Gly Gly Ser Glu Gly Gly Thr Gly

20

<210> 37

<211> 72

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 37

ggcggtggta gcgaaggcgg tggcagtgaa ggtggtggca gcgaaggtgg tggtagcgag 60

ggtggtaccg gc 72

Claims (37)

1. A T Cell Receptor (TCR), wherein the TCR is capable of binding to the vldgll-HLA a0201 complex; and, the TCR comprises a TCR α chain variable domain and a TCR β chain variable domain, wherein the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:

αCDR1-TRDTTYY (SEQ ID NO:10)

αCDR2-RNSFDEQN (SEQ ID NO:11)

alpha CDR3-ALSERILNYGGSQGNLI (SEQ ID NO: 12); and

the 3 complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGDLS (SEQ ID NO:13)

βCDR2-YYNGEE (SEQ ID NO:14)

βCDR3-ASSGTGTDTQY (SEQ ID NO:15)。

2. a TCR as claimed in claim 1 wherein the TCR α chain variable domain is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1.

3. A TCR as claimed in claim 1 wherein the TCR β chain variable domain is substantially identical to SEQ ID NO:5 an amino acid sequence having at least 90% sequence identity.

4. A TCR as claimed in claim 1 which comprises the α chain variable domain amino acid sequence SEQ ID NO 1.

5. A TCR as claimed in claim 1 which comprises the β chain variable domain amino acid sequence SEQ ID NO 5.

6. A TCR as claimed in claim 1 which is an α β heterodimer comprising a TCR α chain constant domain TRAC 01 and a TCR β chain constant domain TRBC1 x 01 or TRBC2 x 01.

7. A TCR as claimed in claim 6 wherein the α chain amino acid sequence of the TCR is SEQ ID NO:3 and the beta chain amino acid sequence of the TCR are SEQ ID NO 7.

8. A TCR as claimed in any one of claims 1 to 5 which is soluble.

9. A TCR as claimed in claim 8 which is single chain.

10. A TCR as claimed in claim 9 which is formed from an α chain variable domain linked to a β chain variable domain by a peptide linker.

11. A TCR as claimed in claim 10 which has one or more mutations in amino acid positions 11, 13, 19, 21, 53, 76, 89, 91, or 94 of the variable domain of the α chain, and/or in amino acid positions 3,5 or 7 of the short peptide of the α chain J gene from the last; and/or the TCR has one or more mutations in beta chain variable domain amino acid position 11, 13, 19, 21, 53, 76, 89, 91, or 94, and/or beta chain J gene short peptide amino acid penultimate 2,4 or 6, wherein the amino acid position numbering is according to the position numbering listed in IMGT (international immunogenetics information system).

12. A TCR as claimed in claim 11 in which the α chain variable domain amino acid sequence of the TCR comprises SEQ ID No. 32 and/or the β chain variable domain amino acid sequence of the TCR comprises SEQ ID No. 34.

13. A TCR as claimed in claim 12 wherein the amino acid sequence of the TCR is SEQ ID No. 30.

14. A TCR as claimed in claim 8 which comprises (a) all or part of a TCR α chain excluding the transmembrane domain; and (b) all or part of the TCR β chain, excluding the transmembrane domain;

and (a) and (b) each comprise a functionally variable domain.

15. A TCR as claimed in claim 14 wherein (a) and (b) each further comprise at least part of the constant domain of the TCR chain.

16. A TCR as claimed in claim 15 in which cysteine residues form an artificial disulphide bond between the α and β chain constant domains of the TCR.

17. A TCR as claimed in claim 16 wherein the cysteine residues which form the artificial disulphide bond in the TCR are substituted at one or more groups of sites selected from:

thr48 of TRAC × 01 exon 1 and TRBC1 × 01 or Ser57 of TRBC2 × 01 exon 1;

thr45 of TRAC × 01 exon 1 and TRBC1 × 01 or Ser77 of TRBC2 × 01 exon 1;

tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01;

thr45 of TRAC × 01 exon 1 and TRBC1 × 01 or Asp59 of TRBC2 × 01 exon 1;

ser15 of TRAC × 01 exon 1 and TRBC1 × 01 or TRBC2 × 01 exon 1 Glu15;

arg53 of TRAC × 01 exon 1 and TRBC1 × 01 or Ser54 of TRBC2 × 01 exon 1;

pro89 of exon 1 TRAC × 01 and TRBC1 × 01 or TRBC2 × 01 of Ala19 of exon 1; and

tyr10 of exon 1 TRAC × 01 and TRBC1 × 01 or TRBC2 × 01 Glu20 of exon 1.

18. A TCR as claimed in claim 17 in which the α chain amino acid sequence of the TCR is SEQ ID No. 26 and/or the β chain amino acid sequence of the TCR is SEQ ID No. 28.

19. A TCR as claimed in claim 15 which comprises an artificial interchain disulphide bond between the variable domain of the α chain and the constant domain of the β chain of the TCR.

20. A TCR as claimed in claim 19 wherein the cysteine residues which form the artificial interchain disulphide bond in the TCR are substituted at one or more groups of sites selected from:

amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 46 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01; or

Amino acid 47 of TRAV and amino acid 60 of exon 1 TRBC1 x 01 or TRBC2 x 01.

21. A TCR as claimed in claim 19 which comprises the α chain variable domain and the β chain variable domain and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the α chain constant domain, the α chain variable domain of the TCR forming a heterodimer with the β chain.

22. A TCR as claimed in claim 1 wherein a conjugate is attached to the C-or N-terminus of the α and/or β chain of the TCR.

23. A TCR as claimed in claim 22 wherein the conjugate to which the TCR is bound is a detectable label, a therapeutic agent, a PK modifying moiety or a combination thereof.

24. A TCR as claimed in claim 23 wherein the therapeutic agent is an anti-CD 3 antibody.

25. A multivalent TCR complex comprising at least two TCR molecules, and wherein at least one TCR molecule is a TCR as claimed in any one of claims 1 to 24.

26. A nucleic acid molecule comprising a nucleic acid sequence encoding a TCR of any one of claims 1-24, or the complement thereof.

27. The nucleic acid molecule of claim 26, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:33.

28. The nucleic acid molecule of claim 26 or 27, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:6 or SEQ ID NO 35.

29. The nucleic acid molecule of claim 26, comprising the nucleotide sequence encoding a TCR α chain of SEQ ID NO:4 and/or comprises the nucleotide sequence encoding the TCR β chain SEQ ID NO:8.

30. a vector comprising the nucleic acid molecule of any one of claims 26-29.

31. The vector of claim 30, wherein said vector is a viral vector.

32. The vector of claim 30, wherein said vector is a lentiviral vector.

33. An isolated host cell comprising the vector of claim 30 or a nucleic acid molecule of any one of claims 26-29 integrated into the chromosome.

34. A cell transduced with the nucleic acid molecule of any one of claims 26 to 29 or the vector of claim 30.

35. The cell of claim 34, wherein the cell is a T cell or a stem cell.

36. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to any one of claims 1 to 24, a TCR complex according to claim 25 or a cell according to claim 34.

37. Use of a TCR as claimed in any of claims 1 to 24, or a TCR complex as claimed in claim 25 or a cell as claimed in claim 34, for the manufacture of a medicament for the treatment of a PRAME-associated tumour presenting the PRAME antigen short peptide vldgvldll-HLA a0201 complex, said tumour being melanoma, lung squamous cell carcinoma, renal cell carcinoma, head and neck tumour, or a sarcoma.

Images