WO2017076308A1

WO2017076308A1 - Tcr for identifying ny-eso-1 antigen oligopeptide

Info

Publication number: WO2017076308A1
Application number: PCT/CN2016/104453
Authority: WO
Inventors: 李懿; 相瑞瑞; 吴万里; 林燕梅; 李思韵
Original assignee: 广州市香雪制药股份有限公司
Priority date: 2015-11-04
Filing date: 2016-11-03
Publication date: 2017-05-11
Also published as: CN106632660A; CN106632660B

Abstract

Provided is a T cell receptor (TCR) capable of specifically binding oligopeptide SLLMWITQC derived from NY-ESO-1 antigens. The antigen oligopeptide SLLMWITQC can form a compound with HLA A0201, and the compound is presented to a cell surface. Also provided are a nucleic acid molecule for coding the TCR and a carrier containing the nucleic acid molecule as well as a cell transducing the TCR.

Description

Identification of TCR of NY-ESO-1 antigen short peptide

Technical field

The present invention relates to a TCR capable of recognizing a short peptide derived from the NY-ESO-1 antigen, and to a NY-ESO-1 specific T cell obtained by transducing the above TCR, and their prevention and treatment of NY-ESO- 1 use in related diseases.

Background technique

NY-ESO-1 belongs to the family of Cancer-Testis Antigen (CTA). It can be expressed in testis, ovarian tissue and many different types of tumor tissues, but not in other normal tissues. It is a kind of specificity. Strong tumor antigens. NY-ESO-1 is an endogenous antigen that is degraded into small molecule polypeptides after intracellular production and binds to MHC (main histocompatibility complex) molecules to form a complex that is presented to the cell surface. SLLMWITQC is a short peptide derived from the NY-ESO-1 antigen and is a target for the treatment of NY-ESO-1 related diseases. Studies have shown that NY-ESO-1 is expressed in a variety of tumor tissues, in neuroblastoma (Rodolfo M, et al., Cancer Res, 2003, 63 (20): 6948-6955), sarcoma (Jungbhth A A et al., Int J Cancer, 2001, 94(2): 252-256), malignant melanoma (Barrow C, et al., Clin Cancer Res, 2006, 12 (3Pt 1): 764-771) Very high expression in prostate cancer, bladder cancer, breast cancer, multiple myeloma, hepatocellular carcinoma, oral squamous cell carcinoma (Ries J, et al., Anticancer RES, 2009, 29(12): 5125-5130) There is also a higher expression in esophageal cancer (Fujita S, Clin Cancer Res, 2004, 10(19): 6551-6558). For the treatment of the above diseases, chemotherapy and radiotherapy can be used, but all of them will cause damage to their normal cells.

T cell adoptive immunotherapy is the transfer of reactive T cells specific for the target cell antigen into the patient to act on the target cells. The T cell receptor (TCR) is a membrane protein on the surface of T cells that recognizes antigenic short peptides on the surface of the corresponding target cells. In the immune system, direct binding of T cells to antigen presenting cells (APCs) by TCR binding to the short peptide-primary histocompatibility complex (pMHC complex), and then T cells and The other cell membrane surface molecules of APC interact, causing a series of subsequent cell signaling and other physiological responses, allowing different antigen-specific T cells to exert an immune effect on their target cells. Therefore, those skilled in the art are working to isolate a TCR specific for the NY-ESO-1 antigen short peptide, and transducing the TCR to T cells to obtain T cells specific for the NY-ESO-1 antigen short peptide. So that they play a role in cellular immunotherapy.

Summary of the invention

It is an object of the present invention to provide a T cell receptor which recognizes a NY-ESO-1 antigen short peptide.

In a first aspect of the invention, there is provided a T cell receptor (TCR) capable of binding to a SLLMWITQC-HLA A0201 complex.

In another preferred embodiment, the TCR comprises a TCR alpha chain variable domain and a TCR beta chain variable domain, the amino acid sequence of the CDR3 of the TCR alpha chain variable domain is ATDANGKII (SEQ ID NO: 12); and/or The amino acid sequence of CDR3 of the TCR β chain variable domain is ASSLGSNEQY (SEQ ID NO: 15).

In another preferred embodiment, the three complementarity determining regions (CDRs) of the TCR alpha chain variable domain are:

αCDR1-TSINN (SEQ ID NO: 10)

αCDR2-IRSNERE (SEQ ID NO: 11)

αCDR3-ATDANGKII (SEQ ID NO: 12); and/or

The three complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGHDY (SEQ ID NO: 13)

βCDR2-FNNNVP (SEQ ID NO: 14)

βCDR3-ASSLGSNEQY (SEQ ID NO: 15).

In another preferred embodiment, the TCR comprises a TCR alpha chain variable domain and a TCR beta chain variable domain, the TCR alpha chain variable domain being an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1; Or the TCR β chain variable domain is an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 5.

In another preferred embodiment, the TCR comprises an alpha chain variable domain amino acid sequence of SEQ ID NO: 1.

In another preferred embodiment, the TCR comprises the β chain variable domain amino acid sequence of SEQ ID NO: 5.

In another preferred embodiment, the TCR is an alpha beta heterodimer comprising a TCR alpha chain constant region TRAC*01 and a TCR beta chain constant region TRBC1*01 or TRBC2*01.

In another preferred embodiment, the amino acid sequence of the α chain of the TCR is SEQ ID NO: 3 and/or the β chain amino acid sequence of the TCR is SEQ ID NO: 7.

In another preferred embodiment, the TCR is soluble.

In another preferred embodiment, the TCR is single stranded.

In another preferred embodiment, the TCR is formed by linking an alpha chain variable domain to a beta chain variable domain via a peptide linker sequence.

In another preferred embodiment, the TCR is in the alpha chain variable region amino acid at the 11th, 13th, 19th, 21st, 53th, 76th, 89th, 91th or 94th position, and/or the alpha chain J gene short peptide amino acid reciprocal One or more mutations in the third position, the fifth last position or the seventh in the last number; and/or the TCRs in the β chain variable region amino acids 11, 13, 19, 21, 53, 76, 89, 91 Or the 94th, and/or β chain J gene short peptide amino acid reciprocal number 2, the last 4th or the last 6th position has one or more mutations, wherein the amino acid position number according to IMGT (International Immunogenetics Information The location number listed in the system).

In another preferred embodiment, the alpha chain variable domain amino acid sequence of the TCR comprises SEQ ID NO: 32 and/or the beta chain variable domain amino acid sequence of the TCR comprises SEQ ID NO:34.

In another preferred embodiment, the amino acid sequence of the TCR is SEQ ID NO:30.

In another preferred embodiment, the TCR comprises (a) all or part of a TCR alpha chain other than a transmembrane domain; and (b) all or part of a TCR beta chain other than a transmembrane domain;

And (a) and (b) each comprise a functional variable domain or comprise at least a portion of a functional variable domain and said TCR chain constant domain.

In another preferred embodiment, the cysteine residue forms an artificial disulfide bond between the alpha and beta chain constant domains of the TCR.

In another preferred embodiment, the cysteine residue forming an artificial disulfide bond in the TCR replaces one or more sets of sites selected from the group consisting of:

Thr48 of TRAC*01 exon 1 and Ser57 of TRBC1*01 or TRBC2*01 exon 1;

Thr45 of TRAC*01 exon 1 and Ser77 of exon 1 of TRBC1*01 or TRBC2*01;

Tyr10 and TRBC1*01 of exon 1 of TRAC*01 or Ser17 of exon 1 of TRBC2*01;

Thr45 of TRAC*01 exon 1 and Asp59 of TRBC1*01 or TRBC2*01 exon 1;

Ser15 and TRBC1*01 of exon 1 of TRAC*01 or Glu15 of exon 1 of TRBC2*01;

Arg53 of TRAC*01 exon 1 and Ser54 of TRBC1*01 or TRBC2*01 exon 1;

Pro89 and TRBC1*01 of exon 1 of TRAC*01 or Ala19 of exon 1 of TRBC2*01;

Tyr10 and TRBC1*01 of exon 1 of TRAC*01 or Glu20 of exon 1 of TRBC2*01.

In another preferred embodiment, the amino acid sequence of the O chain of the TCR is SEQ ID NO: 26 and/or the β chain amino acid sequence of the TCR is SEQ ID NO: 28.

In another preferred embodiment, the alpha chain variable region of the TCR and the beta chain constant region contain an artificial strand. Disulfide bond.

In another preferred embodiment, the cysteine residue forming an artificial interchain disulfide bond in the TCR replaces one or more sets of sites selected from the group consisting of:

The amino acid at position 46 of TRAV and the amino acid at position 60 of exon 1 of TRBC1*01 or TRBC2*01;

The amino acid at position 47 of TRAV and the amino acid at position 61 of exon 1 of TRBC1*01 or TRBC2*01;

The amino acid at position 46 of TRAV and the amino acid at position 61 of exon 1 of TRBC1*01 or TRBC2*01;

The 47th amino acid of TRAV and the 60th amino acid of exon 1 of TRBC1*01 or TRBC2*01.

In another preferred embodiment, the TCR comprises an alpha chain variable domain and a beta chain variable domain and all or part of a beta chain constant domain other than a transmembrane domain, but which does not comprise an alpha chain constant domain, said TCR The alpha chain variable domain forms a heterodimer with the beta chain.

In another preferred embodiment, the C- or N-terminus of the alpha chain and/or beta strand of the TCR incorporates a conjugate.

In another preferred embodiment, the conjugate that binds to the T cell receptor is a detectable label, a therapeutic agent, a PK modified moiety, or a combination of any of these. Preferably, the therapeutic agent is an anti-CD3 antibody.

In a second aspect of the invention, there is provided a multivalent TCR complex comprising at least two TCR molecules, and wherein at least one TCR molecule is the TCR of the first aspect of the invention.

In a third aspect of the invention, a nucleic acid molecule comprising a nucleic acid sequence encoding the TCR molecule of the first aspect of the invention or a complement thereof is provided.

In another preferred embodiment, the nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 33 encoding a TCR alpha chain variable domain.

In another preferred embodiment, the nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 35 encoding a TCR β chain variable domain.

In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 4 encoding the TCR alpha chain and/or comprises the nucleotide sequence SEQ ID NO: 8 encoding the TCR beta chain.

According to a fourth aspect of the invention, a vector comprising the nucleic acid molecule of the third aspect of the invention is provided; preferably, the vector is a viral vector; more preferably, the vector is slow Viral vector.

According to a fifth aspect of the invention, there is provided an isolated host cell comprising the vector of the fourth aspect of the invention or the nucleic acid molecule of the third aspect of the invention integrated with exogenous in the genome .

According to a sixth aspect of the invention, the invention provides a cell which is transduced with the nucleic acid molecule of the third aspect of the invention or the vector of the fourth aspect of the invention; preferably, the cell is a T cell or a stem cell .

According to a seventh aspect of the present invention, a pharmaceutical composition comprising a pharmaceutically acceptable carrier, a TCR according to the first aspect of the present invention, a TCR complex according to the second aspect of the present invention, and a present invention are provided. The nucleic acid molecule of the third aspect of the invention, the vector of the fourth aspect of the invention, or the sixth aspect of the invention The cells described in the aspects.

According to an eighth aspect of the invention, the T cell receptor of the first aspect of the invention, or the TCR complex of the second aspect of the invention, the nucleic acid molecule of the third aspect of the invention, the fourth aspect of the invention The use of the vector of the aspect, or the cell of the sixth aspect of the invention, for the manufacture of a medicament for the treatment of a tumor or an autoimmune disease.

According to a ninth aspect of the invention, a method of treating a disease comprising administering an appropriate amount of the T cell receptor of the first aspect of the invention, or the TCR complex of the second aspect of the invention to a subject in need of treatment The nucleic acid molecule of the third aspect of the invention, the vector of the fourth aspect of the invention, or the cell of the sixth aspect of the invention, or the pharmaceutical composition of the seventh aspect of the invention;

Preferably, the disease is a tumor, preferably the tumor comprises neuroblastoma, sarcoma, melanoma, prostate cancer, bladder cancer, breast cancer, multiple myeloma, hepatocellular carcinoma, oral squamous cell carcinoma, esophageal cancer And gastric cancer, lung cancer, head and neck squamous cell carcinoma, colon cancer, ovarian cancer and the like.

It is to be understood that within the scope of the present invention, the various technical features of the present invention and the various technical features specifically described hereinafter (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. Due to space limitations, we will not repeat them here.

DRAWINGS

Figure 1a, Figure 1b, Figure 1c, Figure 1d, Figure 1e and Figure 1f are the TCR alpha chain variable domain amino acid sequence, the TCR alpha chain variable domain nucleotide sequence, the TCR alpha chain amino acid sequence, the TCR alpha chain nucleotide sequence, respectively. The TCR alpha chain amino acid sequence of the leader sequence and the TCR alpha chain nucleotide sequence having the leader sequence.

2a, 2b, 2c, 2d, 2e, and 2f are a TCR β chain variable domain amino acid sequence, a TCR β chain variable domain nucleotide sequence, a TCR β chain amino acid sequence, a TCR β chain nucleotide sequence, respectively. The TCR β chain amino acid sequence of the leader sequence and the TCR β chain nucleotide sequence having the leader sequence.

Figure 3 shows the results of double positive staining of CD8 ⁺ and tetramer-PE in monoclonal cells.

Figures 4a and 4b are the amino acid sequence and nucleotide sequence of the soluble TCR alpha chain, respectively.

Figures 5a and 5b are the amino acid sequence and nucleotide sequence of the soluble TCR β chain, respectively.

Figure 6 is a gel diagram of the soluble TCR obtained after purification. The leftmost lane is the reducing gel, the middle lane is the molecular weight marker, and the rightmost lane is the non-reducing gel.

Figures 7a and 7b are the amino acid sequence and nucleotide sequence of a single-chain TCR, respectively.

Figures 8a and 8b are the amino acid sequence and nucleotide sequence, respectively, of a single-chain TCR alpha chain.

Figures 9a and 9b are the amino acid sequence and nucleotide sequence of a single-chain TCR β chain, respectively.

Figures 10a and 10b are the amino acid sequence and nucleotide sequence, respectively, of a single-chain TCR linker.

Figure 11 is a gel diagram of the soluble single-chain TCR obtained after purification.

Figure 12 is a BIAcore kinetic map of the soluble TCR of the present invention in combination with the SLLMWITQC-HLA A0201 complex.

Figure 13 is a BIAcore kinetic map of the soluble single chain TCR of the present invention in combination with the SLLMWITQC--HLA A0201 complex.

Figure 14 shows that cells transducing the TCR of the present invention have a killing effect on target cells expressing the relevant antigen, but have substantially no killing effect on target cells that do not express the relevant antigen.

detailed description

The inventors have found extensively and intensively, and found a TCR capable of specifically binding to the NY-ESO-1 antigen short peptide SLLMWITQC (SEQ ID NO: 9), which forms a complex with HLA A0201 and They are presented together to the cell surface. The invention also provides a nucleic acid fragment encoding the TCR And a vector comprising the nucleic acid molecule. In addition, the invention also provides cells that transduce the TCR of the invention.

the term

The MHC molecule is a protein of the immunoglobulin superfamily and may be a class I or class II MHC molecule. Therefore, it is specific for the presentation of antigens, and different individuals have different MHCs that can present different short peptides of a protein antigen to the surface of the respective APC cells. Human MHC is commonly referred to as the HLA gene or the HLA complex.

The T cell receptor (TCR) is the only receptor that presents a specific antigenic peptide on the major histocompatibility complex (MHC). In the immune system, the binding of antigen-specific TCR to the pMHC complex triggers direct physical contact between T cells and antigen presenting cells (APC), and then the other cell membrane surface molecules of both T cells and APC interact. This leads to a series of subsequent cell signaling and other physiological responses, allowing different antigen-specific T cells to exert an immune effect on their target cells.

TCR is a glycoprotein on the surface of a cell membrane in the form of a heterodimer formed by an alpha chain/beta chain or a gamma chain/delta chain. The TCR heterodimer consists of alpha and beta chains in 95% of T cells, while 5% of T cells have a TCR consisting of gamma and delta chains. The native αβ heterodimeric TCR has an α chain and a β chain, and the α chain and the β chain constitute a subunit of the αβ heterodimeric TCR. Broadly speaking, each of the alpha and beta chains comprises a variable region, a junction region, and a constant region, and the beta chain typically also contains a short polymorphic region between the variable region and the junction region, but the polymorphic region is often considered as a junction region. a part of. Each variable region comprises three CDRs (complementarity determining regions), CDR1, CDR2 and CDR3, which are chimeric in framework regions. The CDR regions determine the binding of the TCR to the pMHC complex, wherein the CDR3 is recombined from the variable region and the junction region and is referred to as the hypervariable region. The alpha and beta chains of TCR are generally considered to have two "domains", namely a variable domain and a constant domain, and the variable domain consists of linked variable and linking regions. The sequence of the TCR constant domain can be found in the public database of the International Immunogenetics Information System (IMGT). For example, the constant domain sequence of the TCR molecule α chain is “TRAC*01”, and the constant domain sequence of the TCR molecule β chain is “TRBC1*”. 01" or "TRBC2*01". In addition, the alpha and beta chains of TCR also contain a transmembrane and cytoplasmic regions with a short cytoplasmic region.

In the present invention, the terms "polypeptide of the present invention", "TCR of the present invention", and "T cell receptor of the present invention" are used interchangeably.

Natural interchain disulfide bond and artificial interchain disulfide bond

There is a set of disulfide bonds between the Cα and Cβ chains in the membrane proximal region of the native TCR, which is referred to herein as the "natural interchain disulfide bond". In the present invention, an inter-chain covalent disulfide bond which is artificially introduced and whose position is different from the position of a disulfide bond between natural chains is referred to as "artificial interchain disulfide bond".

In order to facilitate the description of the position of the disulfide bond, in the present invention, the position numbers of the amino acid sequences of TROC*01 and TRBC1*01 or TRBC2*01 are numbered in order from N-terminus to C-terminus, such as TRBC1*01 or TRBC2*01. In the order from the N-terminus to the C-terminus, the 60th amino acid is P (valine), which may be described as Pro60 of TRBC1*01 or TRBC2*01 exon 1 in the present invention, or may be It is expressed as the 60th amino acid of exon 1 of TRBC1*01 or TRBC2*01, and in the case of TRBC1*01 or TRBC2*01, the 61st amino acid is Q in the order from N to C. Amide), which may be described as Gln61 of TRBC1*01 or TRBC2*01 exon 1 in the present invention, or may be expressed as amino acid 61 of exon 1 of TRBC1*01 or TRBC2*01, other And so on. In the present invention, the position numbers of the amino acid sequences of the variable regions TRAV and TRBV are numbered according to the positions listed in the IMGT. As for an amino acid in TRAV, the position number listed in IMGT is 46, which is described in the present invention as amino acid 46 of TRAV, and so on. In the present invention, if the sequence position numbers of other amino acids are specifically described, special instructions will be given.

Detailed description of the invention

TCR molecule

During antigen processing, the antigen is degraded within the cell and then carried to the cell surface by MHC molecules. The T cell receptor is capable of recognizing the peptide-MHC complex on the surface of the antigen presenting cell. Accordingly, a first aspect of the invention provides a TCR molecule capable of binding to the SLLMWITQC-HLA A0201 complex. Preferably, the TCR molecule is isolated or purified. The alpha and beta strands of the TCR each have three complementarity determining regions (CDRs).

In a preferred embodiment of the invention, the alpha chain of the TCR comprises a CDR having the following amino acid sequence:

αCDR1-TSINN (SEQ ID NO: 10)

αCDR2-IRSNERE (SEQ ID NO: 11)

αCDR3-ATDANGKII (SEQ ID NO: 12); and/or

βCDR1-SGHDY (SEQ ID NO: 13)

βCDR2-FNNNVP (SEQ ID NO: 14)

βCDR3-ASSLGSNEQY (SEQ ID NO: 15).

The chimeric TCR can be prepared by embedding the above-described CDR region amino acid sequences of the present invention into any suitable framework structure. As long as the framework structure is compatible with the CDR regions of the TCRs of the present invention, one skilled in the art can design or synthesize TCR molecules having corresponding functions in accordance with the CDR regions disclosed herein. Thus, a TCR molecule of the invention refers to a TCR molecule comprising the above-described alpha and/or beta chain CDR region sequences and any suitable framework structure. The TCR alpha chain variable domain of the invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID NO: 1; and/or the TCR β chain variable domain of the invention is SEQ ID NO: 5 has an amino acid sequence of at least 90%, preferably 95%, more preferably 98% sequence identity.

In a preferred embodiment of the invention, the TCR molecule of the invention is a heterodimer composed of alpha and beta chains. Specifically, in one aspect, the alpha chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, the alpha chain variable domain amino acid sequence comprising the CDR1 (SEQ ID NO: 10), CDR2 (SEQ) ID NO: 11) and CDR3 (SEQ ID NO: 12). Preferably, the TCR molecule comprises an alpha chain variable domain amino acid sequence of SEQ ID NO: 1. More preferably, the alpha chain variable domain amino acid sequence of the TCR molecule is SEQ ID NO: 1. In another aspect, the beta strand of the heterodimeric TCR molecule comprises a variable domain and a constant domain, the beta strand variable domain amino acid sequence comprising the CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID) NO: 14) and CDR3 (SEQ ID NO: 15). Preferably, the TCR molecule comprises a beta chain variable domain amino acid sequence of SEQ ID NO:5. More preferably, the beta strand variable domain amino acid sequence of the TCR molecule is SEQ ID NO:5.

In a preferred embodiment of the invention, the TCR molecule of the invention is a single-chain TCR molecule consisting of part or all of the alpha chain and/or part or all of the beta chain. A description of single-chain TCR molecules can be found in Chung et al (1994) Proc. Natl. Acad. Sci. USA 91, 12654-12658. One skilled in the art can readily construct single-chain TCR molecules comprising the CDRs regions of the invention, as described in the literature. Specifically, the single-chain TCR molecule comprises Vα, Vβ and Cβ, preferably linked in order from N-terminus to C-terminus.

The alpha chain variable domain amino acid sequence of the single chain TCR molecule comprises CDR1 (SEQ ID NO: 10), CDR2 (SEQ ID NO: 11) and CDR3 (SEQ ID NO: 12) of the above alpha chain. Preferably, the single-chain TCR molecule comprises an alpha chain variable domain amino acid sequence of SEQ ID NO: 1. More preferably, the alpha chain variable domain amino acid sequence of the single chain TCR molecule is SEQ ID NO: 1. The β chain variable domain amino acid sequence of the single-chain TCR molecule comprises CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 14) and CDR3 (SEQ ID NO: 15) of the above-described β chain. Preferably, the single-chain TCR molecule comprises the β-chain variable domain amino acid sequence of SEQ ID NO: 5. More preferably, the β chain variable domain amino acid of the single-chain TCR molecule The sequence is SEQ ID NO:5.

In a preferred embodiment of the invention, the constant domain of the TCR molecule of the invention is a human constant domain. Those skilled in the art are aware of or can obtain a human constant domain amino acid sequence by consulting a related book or a public database of IMGT (International Immunogenetics Information System). For example, the constant domain sequence of the α chain of the TCR molecule of the present invention may be "TRAC*01", and the constant domain sequence of the β chain of the TCR molecule may be "TRBC1*01" or "TRBC2*01". The 53rd position of the amino acid sequence given in TRAC*01 of IMGT is Arg, which is represented here as: Arg53 of exon 1 of TRAC*01, and so on. Preferably, the amino acid sequence of the α chain of the TCR molecule of the present invention is SEQ ID NO: 3, and/or the amino acid sequence of the β chain is SEQ ID NO: 7.

The naturally occurring TCR is a membrane protein that is stabilized by its transmembrane domain. Like immunoglobulins (antibodies) as antigen-recognizing molecules, TCR can also be developed for diagnosis and treatment, when soluble TCR molecules are required. Soluble TCR molecules do not include their transmembrane regions. Soluble TCR has a wide range of uses, not only for studying the interaction of TCR with pMHC, but also as a diagnostic tool for detecting infection or as a marker for autoimmune diseases. Similarly, soluble TCR can be used to deliver therapeutic agents (such as cytotoxic compounds or immunostimulatory compounds) to cells that present specific antigens. In addition, soluble TCRs can also bind to other molecules (eg, anti-CD3 antibodies). To redirect T cells so that they target cells that present a particular antigen. The present invention also obtains a soluble TCR specific for the NY-ESO-1 antigen short peptide.

To obtain a soluble TCR, in one aspect, the TCR of the invention can be a TCR that introduces an artificial disulfide bond between the residues of its alpha and beta chain constant domains. The cysteine residue forms an artificial interchain disulfide bond between the alpha and beta chain constant domains of the TCR. A cysteine residue can replace other amino acid residues at a suitable position in the native TCR to form an artificial interchain disulfide bond. For example, a Thr248 residue of the exon 1 of TRAC*01 and a cysteine residue of Ser57 of the exon 1 of TRBC1*01 or TRBC2*01 are substituted to form a disulfide bond. Other sites for introducing a cysteine residue to form a disulfide bond may also be: Thr45 of TRAC*01 exon 1 and Ser77 of TRBC1*01 or TRBC2*01 exon 1; TRAC*01 exon 1 of Tyr10 and TRBC1*01 or TRBC2*01 exon 1 of Ser17; TRAC*01 exon 1 of Thr45 and TRBC1*01 or TRBC2*01 exon 1 of Asp59; TRAC*01 exon 1 Ser15 and TRBC1*01 or TRBC2*01 exon 1 of Glu15; TRAC*01 exon 1 of Arg53 and TRBC1*01 or TRBC2*01 exon 1 of Ser54; TRAC*01 exon 1 of Pro89 and ABC19 of exon 1 of TRBC1*01 or TRBC2*01; or Tyr10 and TRBC1*01 of exon 1 of TRAC*01 or Glu20 of exon 1 of TRBC2*01. That is, a cysteine residue replaces any of the above-mentioned sites in the α and β chain constant domains. A maximum of 50, or a maximum of 30, or a maximum of 15, or a maximum of 10, or a maximum of 8 or fewer amino acids may be truncated at one or more C-termini of the TCR constant domains of the invention such that they are not included The cysteine residue is used for the purpose of deleting the natural disulfide bond, and the above object can also be achieved by mutating the cysteine residue forming the natural disulfide bond to another amino acid.

As described above, the TCR of the present invention may comprise an artificial disulfide bond introduced between residues of its α and β chain constant domains. It should be noted that the constant domains may or may not contain the introduced artificial disulfide bonds as described above, and the TCRs of the present invention may each contain a TRAC constant domain sequence and a TRBC1 or TRBC2 constant domain sequence. The TRAC constant domain sequence of TCR and the TRBC1 or TRBC2 constant domain sequence can be joined by a native disulfide bond present in the TCR.

In order to obtain a soluble TCR, in another aspect, the TCR of the present invention further comprises a TCR having a mutation in its hydrophobic core region, and the mutation of these hydrophobic core regions is preferably a mutation capable of improving the stability of the soluble TCR of the present invention, as in the publication number It is described in the patent document of WO2014/206304. Such a TCR can be mutated at its position in the following variable domain hydrophobic core: (alpha and/or beta chain) variable region amino acids 11, 13, 19, 21, 53, 76, 89, 91, 94, and / Or the α-chain J gene (TRAJ) short peptide amino acid position

reciprocal position

3, 5, 7 and/or β chain J gene (TRBJ) short peptide amino acid position reciprocal position 2, 4, 6 where the amino acid sequence position number Locations listed in the International Immunogenetics Information System (IMGT) Numbering. Those skilled in the art are aware of the above-described international immunogenetic information system and can obtain the position number of the amino acid residues of different TCRs in the IMGT according to the database.

The TCR in which the hydrophobic core region is mutated in the present invention may be a stable soluble single-chain TCR composed of a flexible peptide chain linking the variable domains of the α and β chains of the TCR. It should be noted that the flexible peptide chain of the present invention may be any peptide chain suitable for linking the TCR alpha and beta chain variable domains. The single-chain soluble TCR constructed in Example 4 of the present invention has the α chain variable domain amino acid sequence of SEQ ID NO: 32, the encoded nucleotide sequence of SEQ ID NO: 33, and the β chain variable domain amino acid sequence. For SEQ ID NO: 34, the nucleotide sequence encoded is SEQ ID NO:35.

In addition, in terms of stability, Patent Document 201510260322.4 also discloses that introduction of an artificial interchain disulfide bond between the α chain variable region of the TCR and the β chain constant region can significantly improve the stability of the TCR. Therefore, the α chain variable region of the high affinity TCR of the present invention and the β chain constant region may further contain an artificial interchain disulfide bond. Specifically, a cysteine residue forming an artificial interchain disulfide bond between the α chain variable region of the TCR and the β chain constant region is substituted with: amino acid 46 of TRAV and TRBC1*01 or TRBC2* 01 amino acid at position 60 of exon 1; amino acid at position 47 of TRAV and amino acid at position 61 of exon 1 of TRBC1*01 or TRBC2*01; amino acid at position 46 of TRAV and TRBC1*01 or TRBC2*01 The amino acid at position 61 of the 1st; or the amino acid at position 47 of TRAV and the amino acid at position 60 of exon 1 of TRBC1*01 or TRBC2*01. Preferably, such a TCR may comprise (i) all or part of a TCR alpha chain other than its transmembrane domain, and (ii) all or part of a TCR beta chain other than its transmembrane domain, wherein (i) and (ii) Both comprise a variable domain of the TCR chain and at least a portion of the constant domain, the alpha chain forming a heterodimer with the beta chain. More preferably, such a TCR may comprise an alpha chain variable domain and a beta chain variable domain and all or part of a beta chain constant domain other than a transmembrane domain, but which does not comprise an alpha chain constant domain, said TCR alpha The chain variable domain forms a heterodimer with the beta chain.

The TCR of the present invention can also be provided in the form of a multivalent complex. The multivalent TCR complex of the present invention comprises a polymer formed by combining two, three, four or more TCRs of the present invention, such as a tetrameric domain of p53 to produce a tetramer, or more A complex formed by combining a TCR of the invention with another molecule. The TCR complexes of the invention can be used to track or target cells that present a particular antigen in vitro or in vivo, as well as intermediates that produce other multivalent TCR complexes for such applications.

The TCR of the present invention may be used singly or in combination with the conjugate in a covalent or other manner, preferably in a covalent manner. The conjugate comprises a detectable label (for diagnostic purposes, wherein the TCR is used to detect the presence of a cell presenting the SLLMWITQC-HLA A0201 complex), a therapeutic agent, a PK (protein kinase) modified moiety or any of these substances The combination is combined or coupled.

Detectable labels for diagnostic purposes include, but are not limited to, fluorescent or luminescent labels, radioactive labels, MRI (magnetic resonance imaging) or CT (electron computed tomography) contrast agents, or capable of producing detectable products Enzyme.

Therapeutic agents that can be combined or coupled to the TCRs of the invention include, but are not limited to: 1. Radionuclides (Koppe et al, 2005, Cancer metastasis reviews 24, 539); 2. Biotoxicity (Chaudhary et al, 1989) , Nature 339, 394; Epel et al, 2002, Cancer Immunology and Immunotherapy 51, 565); 3. Cytokines such as IL-2, etc. (Gillies et al., 1992, National Academy of Sciences (PNAS) 89, 1428; Card et al, 2004, Cancer Immunology and Immunotherapy 53, 345; Halin et al, 2003, Cancer Research 63, 3202); (Mosquera et al, 2005, The Journal Of Immunology 174, 4381); 5. Antibody scFv fragment (Zhu et al, 1995, International Journal of Cancer 62, 319); 6. Gold nanoparticles / nanometer Rod (Lapotko et al, 2005, Cancer letters 239, 36; Huang et al, 2006, Journal of the American Chemical Society 128, 2115); 7. Viral particles (Peng et al, 2004, Gene Treatment (Ge Ne Therapy) 11, 1234); 8. Liposomes (Mamot et al., 2005, Cancer research 65, 11631); 9. Nanomagnetic particles; 10. Prodrug activating enzymes (eg, DT-diaphorase) DTD) or biphenyl hydrolase-like protein (BPHL); 11. chemotherapeutic agent (eg, cisplatin) or any form of nanoparticles, and the like.

Additionally, the TCR of the invention may also be a hybrid TCR comprising sequences derived from more than one species. For example, studies have shown that murine TCR can be expressed more efficiently in human T cells than human TCR. Thus, the TCR of the invention may comprise a human variable domain and a murine constant domain. A drawback of this approach is that it may trigger an immune response. Therefore, there should be a regulatory regimen for immunosuppression when used in adoptive T cell therapy to allow for the implantation of murine T cells.

It should be understood that the amino acid names in this article are represented by the international single letter or three English letters. The correspondence between the single English letters of the amino acid name and the three English letters is as follows: Ala (A), Arg (R), Asn (N), Asp (D), Cys (C), Gln (Q), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y), Val (V).

Nucleic acid molecule

A second aspect of the invention provides a nucleic acid molecule encoding a TCR molecule of the first aspect of the invention, or a portion thereof, which may be one or more CDRs, a variable domain of an alpha and/or beta chain, and an alpha chain and/or Or beta chain.

The nucleotide sequence encoding the CDR region of the alpha chain of the TCR molecule of the first aspect of the invention is as follows:

αCDR1- actagtataaacaat (SEQ ID NO: 16)

αCDR2- atacgttcaaatgaaagagag (SEQ ID NO: 17)

αCDR3- gctacggacgcaaacggcaagatcatc (SEQ ID NO: 18)

The nucleotide sequence encoding the CDR region of the β chain of the TCR molecule of the first aspect of the invention is as follows:

βCDR1- tcaggacacgactac (SEQ ID NO: 19)

βCDR2- tttaacaacaacgttccg (SEQ ID NO: 20)

βCDR3- gccagcagtttagggagcaacgagcagtac (SEQ ID NO: 21)

Thus, the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR alpha chain of the invention comprises SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, and/or a nucleic acid molecule of the invention encoding a TCR β chain of the invention The nucleotide sequence includes SEQ ID NO: 19, SEQ ID NO: 20, and SEQ ID NO: 21.

The nucleotide sequence of the nucleic acid molecule of the present invention may be single-stranded or double-stranded, and the nucleic acid molecule may be RNA or DNA, and may or may not contain an intron. Preferably, the nucleotide sequence of the nucleic acid molecule of the invention does not comprise an intron but is capable of encoding a polypeptide of the invention, for example, the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR alpha chain variable domain of the invention comprises SEQ ID NO: 2 and / or the nucleotide sequence of the nucleic acid molecule of the invention encoding a TCR beta chain variable domain of the invention comprises SEQ ID NO: 6. Alternatively, the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR alpha chain variable domain of the invention comprises SEQ ID NO: 33 and/or the nucleotide sequence of a nucleic acid molecule of the invention encoding a TCR beta chain variable domain of the invention comprising the SEQ ID NO: 35. More preferably, the nucleotide sequence of the nucleic acid molecule of the invention comprises SEQ ID NO: 4 and/or SEQ ID NO: 8. Alternatively, the nucleotide sequence of the nucleic acid molecule of the invention is SEQ ID NO:31.

It will be appreciated that due to the degeneracy of the genetic code, different nucleotide sequences may encode the same polypeptide. Thus, a nucleic acid sequence encoding a TCR of the invention may be the same or a degenerate variant of the nucleic acid sequence set forth in the Figures of the invention. As an example of the present invention, a "degenerate variant" refers to a nucleic acid sequence which encodes a protein sequence having SEQ ID NO: 1, but differs from the sequence of SEQ ID NO: 2.

The nucleotide sequence can be codon optimized. Different cells are different in the utilization of specific codons, and the number of expressions can be increased by changing the codons in the sequence depending on the type of the cell. Codon selection tables for mammalian cells as well as a variety of other organisms are well known to those skilled in the art.

The full length sequence of the nucleic acid molecule of the present invention or a fragment thereof can generally be used, but not limited to, PCR amplification method, heavy Obtained by group method or synthetic method. At present, it has been possible to obtain a DNA sequence encoding the TCR (or a fragment thereof, or a derivative thereof) of the present invention completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. The DNA can be a coding strand or a non-coding strand.

Carrier

The invention also relates to vectors comprising the nucleic acid molecules of the invention, including expression vectors, ie, constructs that are capable of expression in vivo or in vitro. Commonly used vectors include bacterial plasmids, bacteriophages, and animal and plant viruses.

Viral delivery systems include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, herpesvirus vectors, retroviral vectors, lentiviral vectors, baculovirus vectors.

Preferably, the vector can transfer a nucleotide of the invention into a cell, such as a T cell, such that the cell expresses a TCR specific for the NY-ESO-1 antigen. Ideally, the vector should be capable of sustained high levels of expression in T cells.

cell

The invention also relates to host cells genetically engineered using the vectors or coding sequences of the invention. The host cell contains the vector of the present invention or a nucleic acid molecule of the present invention in which the chromosome is integrated. The host cell is selected from the group consisting of prokaryotic cells and eukaryotic cells, such as E. coli, yeast cells, CHO cells, and the like.

In addition, the invention also encompasses isolated cells, particularly T cells, which express the TCR of the invention. The T cell can be derived from a T cell isolated from the subject, or can be a mixed cell population isolated from the subject, such as a portion of a peripheral blood lymphocyte (PBL) population. For example, the cells can be isolated from peripheral blood mononuclear cells (PBMC), which can be CD4 ⁺ helper T cells or CD8 ⁺ cytotoxic T cells. The cells can be in a mixed population of CD4 ⁺ helper T cells/CD8 ⁺ cytotoxic T cells. Generally, the cells can be activated with antibodies (e.g., anti-CD3 or anti-CD28 antibodies) to enable them to be more readily transfected, e.g., with a vector comprising a nucleotide sequence encoding a TCR molecule of the invention. dye.

Alternatively, the cells of the invention may also be or be derived from stem cells, such as hematopoietic stem cells (HSCs). Transfer of the gene to HSC does not result in the expression of TCR on the cell surface because the stem cell surface does not express CD3 molecules. However, when stem cells differentiate into lymphoid precursors that migrate to the thymus, expression of the CD3 molecule will initiate expression of the introduced TCR molecule on the surface of thymocytes.

There are a number of methods suitable for T cell transfection with DNA or RNA encoding the TCR of the invention (e.g., Robbins et al., (2008) J. Immunol. 180: 6116-6131). T cells expressing the TCR of the present invention can be used in adoptive immunotherapy. Those skilled in the art will be aware of many suitable methods for performing adoptive therapy (e.g., Rosenberg et al., (2008) Nat Rev Cancer 8(4): 299-308).

NY-ESO-1 antigen related diseases

The invention also relates to a method of treating and/or preventing a NY-ESO-1 related disease in a subject comprising the step of adoptively transferring NY-ESO-1 specific T cells to the subject. The NY-ESO-1 specific T cell recognizes the SLLMWITQC-HLA A0201 complex.

The NY-ESO-1 specific T cells of the invention can be used to treat any NY-ESO-1 related diseases presenting the NY-ESO-1 antigen short peptide SLLMWITQC-HLA A0201 complex, including but not limited to tumors, preferably Tumors include neuroblastoma, sarcoma, melanoma, prostate cancer, bladder cancer, breast cancer, multiple myeloma, hepatocellular carcinoma, oral squamous cell carcinoma, esophageal cancer, and gastric cancer, lung cancer, head and neck squamous cell carcinoma, Colon cancer, ovarian cancer, etc.

treatment method

The T cells of a patient or a volunteer having a disease associated with the NY-ESO-1 antigen can be isolated, and the TCR of the present invention can be introduced into the above T cells, and then these genetically engineered cells can be returned to the patient. treatment. Accordingly, the present invention provides a method for treating NY-ESO-1 related diseases. The method comprises separating an isolated T cell expressing a TCR of the invention, preferably, the T cell is derived from the patient itself and is administered to the patient. Generally, it comprises (1) isolating a patient's T cells, (2) transducing T cells in vitro with a nucleic acid molecule of the invention or a nucleic acid molecule capable of encoding the TCR molecule of the invention, and (3) inputting genetically engineered T cells into the patient in vivo. The number of cells that are isolated, transfected, and returned can be determined by the physician.

The main advantages of the invention are:

(1) The TCR of the present invention can bind to the NY-ESO-1 antigen short peptide complex SLLMWITQC-HLA A0201, and the cells transduced with the TCR of the present invention can be specifically activated and have a strong killing effect on target cells.

The invention is further illustrated by the following specific examples. It is to be understood that the examples are not intended to limit the scope of the invention. The experimental methods in the following examples which do not specify the specific conditions are usually published under conventional conditions, for example, (Sambrook and Russell et al., Molecular Cloning-A Laboratory Manual (Third Edition) (2001) CSHL Publishing The conditions stated in the company, or in accordance with the conditions recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Percentages and parts are by weight unless otherwise stated. The experimental materials and reagents used in the following examples are available from commercially available sources unless otherwise specified.

Example 1 Cloning NY-ESO-1 Antigen Short Peptide-Specific T Cells

Peripheral blood lymphocytes (PBL) from healthy volunteers with genotype HLA-A0201 were stimulated with synthetic short peptide SLLMWITQC (SEQ ID NO.: 9; Beijing Cypress Biotech Co., Ltd.). The SLLMWITQC short peptide was renatured with biotinylated HLA-A0201 to prepare a pHLA haploid. These haploids were combined with PE-labeled streptavidin (BD) into PE-labeled tetramers, and the tetramer and anti-CD8-APC double positive cells were sorted. The sorted cells were expanded and subjected to secondary sorting as described above, followed by monoclonalization by limiting dilution. Monoclonal cells were stained with tetramers and the double positive clones screened are shown in Figure 3.

Example 2 Construction of TCR Gene and Vector for Obtaining NY-ESO-1 Antigen Short Peptide-Specific T Cell Clone

Extracted with ^{Quick-RNA TM MiniPrep (ZYMO research} ) in Example 1 Screening of short peptides to antigen SLLMWITQC-specific, HLA-A0201 restricted T cell clones Total RNA. The cDNA was synthesized using clontech's SMART RACE cDNA Amplification Kit, and the primers were designed to be conserved in the C-terminal region of the human TCR gene. The sequence was cloned into a T vector (TAKARA) for sequencing. It should be noted that this sequence is a complementary sequence and does not contain introns. After sequencing, the α chain and β chain sequence structures of the TCR expressed by the double positive clone are shown in FIG. 1 and FIG. 2 respectively, and FIG. 1a, FIG. 1b, FIG. 1c, FIG. 1d, FIG. 1e and FIG. 1f are respectively TCR α chains. A domain amino acid sequence, a TCR alpha chain variable domain nucleotide sequence, a TCR alpha chain amino acid sequence, a TCR alpha chain nucleotide sequence, a TCR alpha chain amino acid sequence having a leader sequence, and a TCR alpha chain nucleotide sequence having a leader sequence; Figure 2b, Figure 2c, Figure 2d, Figure 2e and Figure 2f are the TCR β chain variable domain amino acid sequence, the TCR β chain variable domain nucleotide sequence, the TCR β chain amino acid sequence, the TCR β chain nucleotide sequence, and the leader sequence, respectively. The TCR β chain amino acid sequence and the TCR β chain nucleotide sequence having a leader sequence.

The alpha chain has been identified to comprise a CDR having the following amino acid sequence:

αCDR1-TSINN (SEQ ID NO: 10)

αCDR2-IRSNERE (SEQ ID NO: 11)

αCDR3-ATDANGKII (SEQ ID NO: 12)

The beta strand comprises a CDR having the following amino acid sequence:

βCDR1-SGHDY (SEQ ID NO: 13)

βCDR2-FNNNVP (SEQ ID NO: 14)

βCDR3-ASSLGSNEQY (SEQ ID NO: 15)

The full-length genes of the TCR alpha chain and the beta chain were cloned into the lentiviral expression vector pLenti (addgene) by overlap PCR, respectively. Specifically, the TCRα-2A-TCRβ fragment was obtained by ligating the full-length genes of the TCR α chain and the TCR β chain by overlap PCR. The lentiviral expression vector and TCRα-2A-TCRβ were digested to obtain a pLenti-TRA-2A-TRB-IRES-NGFR plasmid. As a control, a lentiviral vector pLenti-eGFP expressing eGFP was also constructed. The 1981T/17 is then used to package the pseudovirus.

Example 3 Expression, Refolding and Purification of NY-ESO-1 Antigen Short Peptide-Specific Soluble TCR

In order to obtain a soluble TCR molecule, the α and β chains of the TCR molecule of the present invention may comprise only their variable domains and partial constant domains, respectively, and a cysteine residue is introduced in the constant domains of the α and β chains, respectively. To form an artificial interchain disulfide bond, the positions at which cysteine residues are introduced are Thr48 of exon 1 of TRAC*01 and Ser57 of exon 1 of TRBC2*01, respectively; amino acid sequence and nucleotide of α chain thereof The sequences are shown in Figures 4a and 4b, respectively, and the amino acid sequence and nucleotide sequence of the β chain are shown in Figures 5a and 5b, respectively, and the introduced cysteine residues are indicated by bold and underlined letters. The above TCRα and β chain target gene sequences were synthesized and inserted into the expression vector pET28a+ (Novagene) by standard methods described in the Molecular Cloning a Laboratory Manual (3rd edition, Sambrook and Russell). ), the upstream and downstream cloning sites are NcoI and NotI, respectively. The insert was sequenced to confirm that it was correct.

The expression vectors of TCRα and β chain were transformed into expression plasmid BL21(DE3) by chemical transformation, respectively, and the bacteria were grown in LB medium. The expression of α and β chain of TCR was induced by LD ₆₀₀ =0.6 with a final concentration of 0.5 mM IPTG. The resulting inclusion bodies were extracted by BugBuster Mix (Novagene) and washed repeatedly with BugBuster solution. The inclusion bodies were finally dissolved in 6 M guanidine hydrochloride, 10 mM dithiothreitol (DTT), 10 mM ethylenediaminetetraacetic acid (EDTA). ), in 20 mM Tris (pH 8.1).

The dissolved TCRα and β chains were rapidly mixed in 5 M urea, 0.4 M arginine, 20 mM Tris (pH 8.1), 3.7 mM cystamine, 6.6 mM β-mercapoethylamine (4 ° C) at a final concentration of 1:1. 60 mg/mL. After mixing, the solution was dialyzed against 10 volumes of deionized water (4 ° C), and after 12 hours, deionized water was exchanged for buffer (20 mM Tris, pH 8.0) and dialysis was continued at 4 ° C for 12 hours. The solution after completion of dialysis was filtered through a 0.45 μM filter, and then purified by an anion exchange column (HiTrap Q HP, 5 ml, GE Healthcare). The TCR containing the refolding successful alpha and beta dimers was confirmed by SDS-PAGE gel. The TCR was then further purified by gel filtration chromatography (HiPrep 16/60, Sephacryl S-100HR, GE Healthcare). The purified TCR purity was determined by SDS-PAGE to be greater than 90%, and the concentration was determined by the BCA method. The SDS-PAGE gel of the soluble TCR obtained by the present invention is shown in Fig. 6.

Example 4 Production of soluble single-chain TCR specific for NY-ESO-1 antigen short peptide

The variable domains of TCRα and β-chain in Example 2 were constructed as a stable soluble single-chain TCR molecule linked by a flexible short linker using the method of site-directed mutagenesis as described in the patent document WO2014/206304. The amino acid sequence and nucleotide sequence of the single-chain TCR molecule are shown in Figures 7a and 7b, respectively. The amino acid sequence and nucleotide sequence of the α chain variable domain are shown in Figure 8a and Figure 8b, respectively; the amino acid sequence and nucleotide sequence of the β chain variable domain are shown in Figure 9a and Figure 9b, respectively; The amino acid sequence and nucleotide sequence of the sequence are shown in Figures 10a and 10b, respectively.

The gene of interest was digested with NcoI and NotI and ligated with the pET28a vector digested with NcoI and NotI. The ligation product was transformed into E. coli DH5α, coated with kanamycin-containing LB plate, inverted culture at 37 ° C overnight, and the positive clones were picked for PCR screening. The positive recombinants were sequenced to determine the correct sequence and the recombinant plasmid was extracted. To E. coli BL21 (DE3) for expression.

Example 5 Expression, renaturation and purification of soluble single-chain TCR specific for NY-ESO-1 antigen short peptide

The BL21(DE 3) colonies containing the recombinant plasmid pET28a-template strand prepared in Example 4 were all inoculated into LB medium containing kanamycin, cultured at 37 ° C until the OD600 was 0.6-0.8, and IPTG was added to the final concentration. The culture was continued at 37 ° C for 4 h at 0.5 mM. The cell pellet was harvested by centrifugation at 5000 rpm for 15 min, the cell pellet was lysed with Bugbuster Master Mix (Merck), the inclusion bodies were recovered by centrifugation at 6000 rpm for 15 min, and then washed with Bugbuster (Merck) to remove cell debris and membrane fraction, centrifuged at 6000 rpm for 15 min, and collected. body. The inclusion body was dissolved in a buffer (20 mM Tris-HCl pH 8.0, 8 M urea), and the insoluble matter was removed by high-speed centrifugation. The supernatant was fractionated by the BCA method, and then stored at -80 ° C until use.

To 5 mg of the dissolved single-chain TCR inclusion body protein, 2.5 mL of buffer (6 M Gua-HCl, 50 mM Tris-HCl pH 8.1, 100 mM NaCl, 10 mM EDTA) was added, and DTT was added to a final concentration of 10 mM, and treated at 37 ° C for 30 min. . The above-treated single-chain TCR was added dropwise to a 125 mL refolding buffer (100 mM Tris-HCl pH 8.1, 0.4 M L-arginine, 5 M urea, 2 mM EDTA, 6.5 mM β-mercapthoethylamine, 1.87 mM Cystamine) with a syringe. After stirring at 4 ° C for 10 min, the reconstituted solution was placed in a cellulose membrane dialysis bag with a cut-off amount of 4 kDa, and the dialysis bag was placed in 1 L of pre-cooled water and slowly stirred at 4 ° C overnight. After 17 hours, the dialysate was changed to 1 L of pre-cooled buffer (20 mM Tris-HCl pH 8.0), dialysis was continued for 8 h at 4 ° C, and the dialysate was replaced with the same fresh buffer to continue dialysis overnight. After 17 hours, the sample was filtered through a 0.45 μm filter, and the protein was purified by vacuum degassing through an anion exchange column (HiTrap Q HP, GE Healthcare) in a linear gradient of 0-mM NaCl prepared with 20 mM Tris-HCl pH 8.0. The collected fractions were subjected to SDS-PAGE analysis, and the fractions containing the single-chain TCR were concentrated and further purified by a gel filtration column (Superdex 7510/300, GE Healthcare), and the target components were also subjected to SDS-PAGE analysis.

The eluted fraction for BIAcore analysis was further tested for purity using gel filtration. The conditions were as follows: column Agilent Bio SEC-3 (300A, φ 7.8×300 mm), mobile phase 150 mM phosphate buffer, flow rate 0.5 mL/min, column temperature 25 ° C, UV detection wavelength 214 nm.

The SDS-PAGE gel of the soluble single-chain TCR obtained by the present invention is shown in FIG.

Example 6 combined characterization

BIAcore analysis

This example demonstrates that soluble TCR molecules of the invention are capable of specifically binding to the SLLMWITQC-HLA A0201 complex.

The binding activity of the TCR molecule obtained in Example 3 and Example 5 to the SLLMWITQC-HLA A0201 complex was examined using a BIAcore T200 real-time analysis system. The anti-streptavidin antibody (GenScript) was added to a coupling buffer (10 mM sodium acetate buffer, pH 4.77), and then the antibody was passed through a CM5 chip previously activated with EDC and NHS to immobilize the antibody on the surface of the chip. Finally, the unreacted activated surface was blocked with a solution of ethanolamine in hydrochloric acid to complete the coupling process at a coupling level of about 15,000 RU.

A low concentration of streptavidin is passed over the surface of the coated antibody chip, then the SLLMWITQC-HLA A0201 complex is flowed through the detection channel, the other channel is used as a reference channel, and 0.05 mM biotin is then added at 10 μL/min. The flow rate was passed through the chip for 2 min, blocking the remaining binding sites of streptavidin.

The preparation process of the above SLLMWITQC-HLA A0201 complex is as follows:

Purification

100 ml of E. coli bacterial solution inducing expression of heavy or light chain was collected, and the cells were washed once with 8000 g of PBS at 10 ° C for 10 min, and then resuspended by vigorous shaking with 5 ml of BugBuster Master Mix Extraction Reagents (Merck). Incubate for 20 min at room temperature, Thereafter, the mixture was centrifuged at 6000 g for 15 min at 4 ° C, and the supernatant was discarded to collect inclusion bodies.

The above-mentioned inclusion weight was suspended in 5 ml BugBuster Master Mix, and incubated at room temperature for 5 min; 30 ml of BugBuster diluted 10 times, mixed, centrifuged at 6000 g for 15 min at 4 ° C; the supernatant was discarded, and 30 ml of BugBuster resuspended inclusion body was diluted 10 times. , mix, centrifuge at 6000g for 4min at 4°C for 15min, repeat twice, add 30ml 20mM Tris-HCl pH 8.0, resuspend the inclusion body, mix, centrifuge at 6000g for 15min at 4°C, and finally dissolve the inclusion body with 20mM Tris-HCl 8M urea, SDS- The inclusion body purity was measured by PAGE and the concentration was measured by BCA kit.

b. renaturation

The synthesized short peptide SLLMWITQC (Beijing Saibaisheng Gene Technology Co., Ltd.) was dissolved in DMSO to a concentration of 20 mg/ml. The inclusion bodies of the light and heavy chains were dissolved with 8 M urea, 20 mM Tris pH 8.0, 10 mM DTT, and further denatured by adding 3 M guanidine hydrochloride, 10 mM sodium acetate, 10 mM EDTA before renaturation. The SLLMWITQC peptide was added to the refolding buffer (0.4 M L-arginine, 100 mM Tris pH 8.3, 2 mM EDTA, 0.5 mM oxidized glutathione, 5 mM reduced glutathione, at 25 mg/L (final concentration), 0.2 mM PMSF, cooled to 4 ° C), then add 20 mg / L light chain and 90 mg / L heavy chain (final concentration, heavy chain added three times, 8h / time), renaturation at 4 ° C for at least 3 days By the time of completion, SDS-PAGE can be used to detect renaturation.

c. renaturation and purification

The renaturation buffer was replaced with 10 volumes of 20 mM Tris pH 8.0 for dialysis, and at least two buffers were exchanged to substantially reduce the ionic strength of the solution. After dialysis, the protein solution was filtered through a 0.45 μm cellulose acetate filter and then loaded onto a HiTrap Q HP (GE General Electric Company) anion exchange column (5 ml bed volume). The protein was eluted using a linear gradient of 0-400 mM NaCl prepared by an Akta Purifier (GE General Electric Company), 20 mM Tris pH 8.0, pMHC was eluted at approximately 250 mM NaCl, peak fractions were collected, and purity was determined by SDS-PAGE.

d. Biotinylation

The purified pMHC molecule was concentrated using a Millipore ultrafiltration tube while the buffer was replaced with 20 mM Tris pH 8.0, followed by biotinylation reagent 0.05M Bicine pH 8.3, 10 mM ATP, 10 mM MgOAc, 50 μM D-Biotin, 100 μg/ml BirA The enzyme (GST-BirA) was incubated overnight at room temperature and SDS-PAGE was used to determine if biotinylation was complete.

e. Purification of the biotinylated complex

The biotinylated labeled pMHC molecule was concentrated to 1 ml using a Millipore ultrafiltration tube, biotinylated pMHC was purified by gel filtration chromatography, and HiPrep was pre-equilibrated with filtered PBS using an Akta Purifier (GE General Electric Company). ^{A TM} 16/60S200 HR column (GE General Electric Company) was loaded with 1 ml of concentrated biotinylated pMHC molecules and then eluted with PBS at a flow rate of 1 ml/min. The biotinylated pMHC molecule appeared as a single peak elution at about 55 ml. The protein-containing fractions were pooled, concentrated using a Millipore ultrafiltration tube, protein concentration was determined by BCA method (Thermo), and biotinylated pMHC molecules were dispensed at -80 °C by adding protease inhibitor cocktail (Roche).

The kinetic parameters of the soluble TCR molecule of the present invention and the soluble single-chain TCR molecule constructed by the present invention in combination with the SLLMWITQC-HLA A0201 complex were calculated using BIAcore Evaluation software, as shown in Figures 12 and 13, respectively. The map shows that the soluble TCR molecule and the soluble single-chain TCR molecule obtained by the present invention are capable of binding to the SLLMWITQC-HLA A0201 complex. At the same time, the binding activity of the soluble TCR molecule of the present invention and other several unrelated antigenic short peptides to the HLA complex was also detected by the above method, and the results showed that the TCR molecule of the present invention did not bind to other unrelated antigens.

Example 7: Killing experiments of cells transducing TCR of the present invention

This example measures the release of LDH by a non-radioactive cytotoxicity assay to verify the killing function of cells transducing the TCR of the present invention.

Methods for detecting cellular function using release assays of LDH are well known to those skilled in the art. This embodiment In LDH experiments, PBL cells isolated from the blood of healthy volunteers were transfected with TCR as effector cells via lentivirus. The target cell lines were A375 (3525), MEL624 (1605), NCI-H1650 (2) and MEL526 (4) cells. According to the nanostring results, among them, A375 (3525) and MEL624 (1605) expressed the NY-ESO-1 antigen. NCI-H1650 (2) and MEL526 (4) did not substantially express the NY-ESO-1 antigen as a control.

First prepare the LDH plate. On the first day of the experiment, the components of the assay were added to the plates in the following order: medium was adjusted to effect cells to 2×10 ⁶ cells/ml, and the medium was adjusted to ⁵ ×10 ⁵ cells/ml. After mixing well, 100 μL of target cell line ⁵ ×10 ⁵ cells/ml (ie 50,000 cells/well) and 100 μL of effector cells 2×10 ⁶ cells/ml (ie 200,000 cells/well) were added to the corresponding wells, and Set up three duplicate holes. At the same time, the spontaneous cells of the effector cells, the spontaneous pores of the target cells, the largest pores of the target cells, the volume corrected control wells and the medium background control wells were set. Incubate overnight (37 ° C, 5% CO ₂ ). On the second day of the experiment, color development was detected, and after the reaction was terminated, the absorbance was recorded at 490 nm using a microplate reader (Bioteck). As shown in Fig. 14, the cells transducing the TCR of the present invention have a killing effect on target cells expressing the relevant antigen, but have no killing effect on target cells which do not express the relevant antigen.

All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the In addition, it should be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims

A T cell receptor (TCR) characterized in that the TCR is capable of binding to the SLLMWITQC-HLAA0201 complex.
The TCR according to claim 1, which comprises a TCR alpha chain variable domain and a TCR beta chain variable domain, wherein the amino acid sequence of the CDR3 of the TCR alpha chain variable domain is ATDANGKII (SEQ ID NO: 12); / or the amino acid sequence of CDR3 of the TCR β chain variable domain is ASSLGSNEQY (SEQ ID NO: 15).
The TCR according to claim 1 or 2, wherein the three complementarity determining regions (CDRs) of the TCR alpha chain variable domain are:

αCDR1-TSINN (SEQ ID NO: 10)

αCDR2-IRSNERE (SEQ ID NO: 11)

αCDR3-ATDANGKII (SEQ ID NO: 12); and/or

The three complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGHDY (SEQ ID NO: 13)

βCDR2-FNNNVP (SEQ ID NO: 14)

βCDR3-ASSLGSNEQY (SEQ ID NO: 15).
A TCR according to any of the preceding claims, which comprises a TCR alpha chain variable domain and a TCR beta chain variable domain, said TCR alpha chain variable domain having at least 90% sequence identity to SEQ ID NO: The amino acid sequence; and/or the TCR β chain variable domain is an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 5.
A TCR according to any of the preceding claims, wherein the TCR comprises an alpha chain variable domain amino acid sequence of SEQ ID NO: 1.
A TCR according to any of the preceding claims, wherein the TCR comprises the β chain variable domain amino acid sequence SEQ ID NO: 5.
A TCR according to any of the preceding claims, wherein the TCR is an alpha beta heterodimer comprising a TCR alpha chain constant region TRAC*01 and a TCR beta chain constant region TRBC1*01 or TRBC2*01.
The TCR according to claim 7, wherein the amino acid sequence of the α chain of the TCR is SEQ ID NO: 3 and/or the β chain amino acid sequence of the TCR is SEQ ID NO: 7.
A TCR according to any of claims 1-6, wherein the TCR is soluble.
The TCR of claim 9 wherein said TCR is single stranded.
The TCR according to claim 10, wherein the TCR is formed by linking an α chain variable domain and a β chain variable domain through a peptide linking sequence.
The TCR according to claim 11, wherein the TCR is at the 11th, 13, 19, 21, 53, 76, 89, 91, or 94th, and/or alpha chain of the alpha chain variable region amino acid. J gene short peptide amino acid has the one or more mutations in the third, the fifth or the third of the penultimate amino acid; and/or the TCR is in the beta chain variable region amino acids 11, 13, 19, 21, 53 , 76, 89, 91, or 94th, and / or β chain J gene short peptide amino acid reciprocal number 2, the last 4th or the last 6th position has one or more mutations, wherein the amino acid position number according to IMGT The location number listed in the International Immunogenetics Information System.
The TCR according to claim 12, wherein the α chain variable domain amino group of the TCR The amino acid sequence comprising the acid sequence comprising SEQ ID NO: 32 and/or the TCR of the TCR comprises SEQ ID NO:34.
The TCR according to claim 13, wherein the amino acid sequence of the TCR is SEQ ID NO:30.
The TCR according to claim 9, wherein said TCR comprises (a) all or part of a TCR alpha chain other than a transmembrane domain; and (b) all or part of a TCR beta chain other than a transmembrane domain;

And (a) and (b) each comprise a functional variable domain or comprise at least a portion of a functional variable domain and said TCR chain constant domain.
The TCR of claim 15 wherein the cysteine residue forms an artificial disulfide bond between the alpha and beta chain constant domains of said TCR.
The TCR according to claim 16, wherein the cysteine residue forming an artificial disulfide bond in said TCR replaces one or more sets of sites selected from the group consisting of:

Thr48 of TRAC*01 exon 1 and Ser57 of TRBC1*01 or TRBC2*01 exon 1;

Thr45 of TRAC*01 exon 1 and Ser77 of exon 1 of TRBC1*01 or TRBC2*01;

Tyr10 and TRBC1*01 of exon 1 of TRAC*01 or Ser17 of exon 1 of TRBC2*01;

Thr45 of TRAC*01 exon 1 and Asp59 of TRBC1*01 or TRBC2*01 exon 1;

Ser15 and TRBC1*01 of exon 1 of TRAC*01 or Glu15 of exon 1 of TRBC2*01;

Arg53 of TRAC*01 exon 1 and Ser54 of TRBC1*01 or TRBC2*01 exon 1;

Pro89 and TRBC1*01 of exon 1 of TRAC*01 or Ala19 of exon 1 of TRBC2*01;

Tyr10 and TRBC1*01 of exon 1 of TRAC*01 or Glu20 of exon 1 of TRBC2*01.
The TCR according to claim 17, wherein the amino acid sequence of the α chain of the TCR is SEQ ID NO: 26 and/or the β chain amino acid sequence of the TCR is SEQ ID NO: 28.
The TCR according to claim 15, wherein an artificial interchain disulfide bond is contained between the α chain variable region of the TCR and the β chain constant region.
The TCR according to claim 19, wherein the cysteine residue forming an artificial interchain disulfide bond in said TCR replaces one or more groups of sites selected from the group consisting of:

The amino acid at position 46 of TRAV and the amino acid at position 60 of exon 1 of TRBC1*01 or TRBC2*01;

The amino acid at position 47 of TRAV and the amino acid at position 61 of exon 1 of TRBC1*01 or TRBC2*01;

The amino acid at position 46 of TRAV and the amino acid at position 61 of exon 1 of TRBC1*01 or TRBC2*01;

The 47th amino acid of TRAV and the 60th amino acid of exon 1 of TRBC1*01 or TRBC2*01.
The TCR according to claim 19 or 20, wherein the TCR comprises an alpha chain variable domain and a beta chain variable domain and all or part of a beta chain constant domain other than a transmembrane domain, but does not comprise The alpha chain constant domain, the alpha chain variable domain of the TCR forms a heterodimer with the beta chain.
A TCR according to any of the preceding claims, characterized in that the C- or N-terminus of the alpha chain and/or beta chain of the TCR is bound to a conjugate.
The T cell receptor according to claim 22, wherein the conjugate that binds to the T cell receptor is a detectable label, a therapeutic agent, a PK modified moiety or a combination of any of these; preferably, The therapeutic agent is an anti-CD3 antibody.
A multivalent TCR complex characterized by comprising at least two TCR molecules, and wherein at least one TCR molecule is the TCR of any of the preceding claims.
A nucleic acid molecule, characterized in that the nucleic acid molecule comprises any of the above-mentioned claims The nucleic acid sequence of the TCR molecule or its complement is sought.
The nucleic acid molecule according to claim 25, which comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 33 which encodes a TCR alpha chain variable domain.
The nucleic acid molecule according to claim 25 or 26, which comprises the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 35 which encodes a TCR β chain variable domain.
The nucleic acid molecule according to claim 25, which comprises the nucleotide sequence SEQ ID NO: 4 encoding the TCR alpha chain and/or comprises the nucleotide sequence SEQ ID NO: 8 encoding the TCR β chain.
A vector comprising the nucleic acid molecule of any one of claims 25-28; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector .
An isolated host cell, characterized in that the host cell comprises the vector of claim 29 or the nucleic acid molecule of any one of claims 25-28 integrated into the chromosome.
A cell characterized by transducing the nucleic acid molecule of any one of claims 25-28 or the vector of claim 29; preferably, the cell is a T cell or a stem cell.
A pharmaceutical composition comprising a pharmaceutically acceptable carrier and the TCR according to any one of claims 1 to 23, the TCR complex according to claim 24, claim 25 The nucleic acid molecule of any of -28, or the cell of claim 31.
Use of a T cell receptor according to any one of claims 1 to 23, or a TCR complex as claimed in claim 24 or a cell according to claim 31, for the preparation of a therapeutic tumor or A drug for autoimmune diseases.
A method for treating a disease, comprising administering to a subject in need of treatment an appropriate amount of the TCR according to any one of claims 1 to 23, the TCR complex of claim 24, the method of claim 31, a cell or a pharmaceutical composition as claimed in claim 32;

Preferably, the disease is a tumor, preferably the tumor comprises neuroblastoma, sarcoma, melanoma, prostate cancer, bladder cancer, breast cancer, multiple myeloma, hepatocellular carcinoma, oral squamous cell carcinoma, esophageal cancer And gastric cancer, lung cancer, head and neck squamous cell carcinoma, colon cancer, ovarian cancer and the like.