CN106381299A - Paddy rice seed dormancy gene OsQSOXL1 and its coded protein and use - Google Patents
Paddy rice seed dormancy gene OsQSOXL1 and its coded protein and use Download PDFInfo
- Publication number
- CN106381299A CN106381299A CN201610762831.1A CN201610762831A CN106381299A CN 106381299 A CN106381299 A CN 106381299A CN 201610762831 A CN201610762831 A CN 201610762831A CN 106381299 A CN106381299 A CN 106381299A
- Authority
- CN
- China
- Prior art keywords
- gene
- seq
- sequence
- osqsoxl1
- dormancy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8267—Seed dormancy, germination or sprouting
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Physiology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a paddy rice seed dormancy gene OsQSOXL1 and its coded protein and use, relates to separation, cloning, function verification and use and belongs to the technical field of plant gene engineering. The paddy rice seed dormancy gene OsQSOXL1 has a nucleotide sequence shown in the formula of SEQ ID NO: 1 and an amino acid sequence is shown in the formula of SEQ ID NO: 3. Through cloning and identification of the paddy rice seed dormancy gene OsQSOXL1, expression and analysis of the gene and verification of gene functions, overexpression of the gene OsQSOXL1 can improve paddy rice seed dormancy at a certain degree and expression inhibition of the gene OsQSOXL1 can reduce paddy rice seed dormancy. The paddy rice seed dormancy gene OsQSOXL1 has a certain effect of cultivation of paddy rice with appropriate dormancy.
Description
Technical field
The invention belongs to genetic engineering field is and in particular to a kind of rice paddy seed dormancy related gene OsQSOXL1 and its volume
Code protein and application.
Background technology
Grain Dormancy is an important economical character.For a long time people seed dormant requirement is had dual
Property：On the one hand, it is desirable to after planting germination is rapid, neat, seedling is fast, to obtain higher economic flow rate；The opposing party
Face is it is desirable to seed has certain dormant trait, and prevents seed from running into unfavorable weather in the harvest season and sprouting.In recent years
Rice varieties to cultivate often ignore seed dormant importance, show stronger Spike sprouting the high-yield variety of cultivation more
Property, due to the increase of " 920 " amount of application especially during the hybrid paddy rice production of hybrid seeds, breeding, Spike sprouting phenomenon is increasingly serious.There is research
Show, coastal area normal year Spike sprouting rate is 5% about, once running into the weather of high temperature and rainy, fringe in maturation process
Germination percentage, up to 20%-30%, has a strong impact on the yield and quality of rice.Therefore, the heredity of rice paddy seed dormant trait and molecule machine
The research of system is significant to the Oryza sativa L. improved seeds cultivating appropriate dormant trait.
During seed maturity, with stopping of the accumulation of seed storage material, the acquisition of Desiccation-tolerance and metabolic activity
Only, seed dormancy is formed.Seed dormancy is a kind of extremely complex quantitative trait, is not only regulated and controled by many genes, plant
Hormone and envirment factor also produce a very large impact to seed dormancy.Phytohormone is very close with seed dormant relation, comes off
Sour (ABA) and gibberellins (GA) are main regulatory factors, and brassinosteroid (BR) and ethylene also assist in seed dormant part
Regulation and control.ABA promotes and maintains seed dormancy, and suppression seed is sprouted；And GA, ethylene and BR can promote seed with breaking dormancy
Germinate.With the development of molecular marking technique, the structure of Oryza sativa L. dense genetic map makes this kind of character is carried out quantitative
The positioning in shape site and clone are possibly realized.In recent years, the positioning of Oryza sativa L. dormancy QTL and clone make some progress, and lead to
Cross qtl analysis and find that seed dormancy QTL is widely distributed on 12 chromosomes of Oryza sativa L..So far, there are some rice seed
Sub- dormant gene is by finely positioning and clone, but the regulatory mechanism of rice paddy seed dormancy is not clear, and it is fixed that this is accomplished by us
Position to disclose the mechanism of rice paddy seed dormancy further with cloning more dormant genes.
Content of the invention
It is an object of the invention to disclosing a kind of nucleotide sequence of rice paddy seed dormancy related gene OsQSOXL1.Its core
Nucleotide sequence as shown in SEQ ID NO.1, containing 5020bp.
Second object of the present invention also provides the albumen sequence of described rice paddy seed dormancy related gene OsQSOXL1 coding
Row, its aminoacid sequence as shown in SEQ ID NO.3, containing 513 aminoacid.
The encoding gene of described protein be preferably following 1) or 2) or 3) described in DNA molecular：
1) DNA molecular shown in SEQ ID NO.1；
2) DNA molecular shown in SEQ ID NO.2；
3) under strict conditions with 1) or 2) DNA molecular of the DNA sequence hybridization that limits and encoding said proteins；
4) with 1) or 2) or 3) DNA sequence that limits has more than 90% homology, and coded plant Grain Dormancy phase
Close the DNA molecular of albumen.
Recombinant expression carrier containing gene described in any of the above falls within protection scope of the present invention.
Can use the recombinant expression carrier that existing plant expression vector construction contains described gene.
Described plant expression vector includes double base agrobacterium vector and can be used for carrier of plant micropellet bombardment etc..Described plant
Thing expression vector also can comprise 3 ' end untranslated regions of exogenous gene, that is, comprise polyadenylation signals and any other participation
MRNA processing or the DNA fragmentation of gene expression.The bootable polyadenylic acid of described polyadenylation signals is added to the 3 ' of mRNA precursor
End, such as Agrobacterium crown gall nodule induction (Ti) plasmid gene (as kermes synzyme Nos gene), plant gene are (as soybean storage egg
White gene) untranslated region of 3 ' end transcriptions is respectively provided with similar functions.
During using described gene constructed recombinant plant expression vector, can be plus any one before its transcription initiation nucleotide
Enhancement mode promoter or constitutive promoter, such as cauliflower mosaic viruses (CAMV) 35S promoter, the ubiquitin promoter of Semen Maydiss
(Ubiquitin), they be can be used alone or are used in combination with other plant promoters；Additionally, the gene using the present invention
When building plant expression vector, it is also possible to use enhancer, including translational enhancer or transcriptional enhancer, these enhancer regions can
To be ATG initiation codon or neighboring region start codon etc., but must be identical with the reading frame of coded sequence, whole to ensure
The correct translation of individual sequence.The source of described translation control signal and start codon is extensive, can be natural, also may be used
To be synthesis.Translation initiation region can come from transcription initiation region or structural gene.
For the ease of being identified to transgenic plant cells or plant and screening, plant expression vector used can be carried out
Processing, such as add the coding that can express in plant can produce the enzyme of color change or luminophor gene (gus gene,
Luciferase genes etc.), there is the antibiotic marker thing (gentamycin label, kanamycin label etc.) of resistance or anti-
Chemical reagent marker gene (as anti-herbicide gene) etc..From the security consideration of transgenic plant, any selectivity can be not added with
Marker gene, directly screens transformed plant with adverse circumstance.
Described restructuring over-express vector can be with restricted enzyme KpnI and SpeI double digestion carrier pCAMBIA1390
Recombination site insert described gene (OsQSOXL1) recombiant plasmid that obtains.By the life of the pCAMBIA1390 containing OsQSOXL1
Entitled pCAMBIA1390-OsQSOXL1.Restructuring interference carrier can be the Kpn I and Sac I in LH-FAD2-1390RNAi carrier
Recombination site and Pst I and BamH I recombination site insert the weight that the Partial Fragment of described gene (OsQSOXL1) obtains respectively
Group plasmid.LH-FAD2-1390RNAi containing OsQSOXL1 is named as LH-FAD2-1390RNAi-OsQSOXL1.
Expression cassette containing gene described in any of the above (OsQSOXL1), transgenic cell line and recombinant bacterium belong to this
Bright protection domain.
Expand described gene (OsQSOXL1) total length or the primer pair of arbitrary fragment falls within protection scope of the present invention, institute
Primer pair preferred Primer1/Primer2, Primer3/Primer4, Primer5/Primer6 and the Primer7/ stating
Primer8；Wherein Primer1 sequence as shown in SEQ ID NO.4, Primer2 sequence as shown in SEQ ID NO.5, Primer3
Sequence as shown in SEQ ID NO.6, Primer4 sequence as shown in SEQ ID NO.7, Primer5 sequence such as SEQ ID NO.8 institute
Show, as shown in SEQ ID NO.9, as shown in SEQ ID NO.10, Primer8 sequence is such as Primer7 sequence for Primer6 sequence
Shown in SEQ ID NO.11.
The positioning primer (being shown in Table 1) being related to during this gene of finely positioning, in addition to primer RM19080, remaining
InDel primer is that this experiment needs and the primer of designed, designed, and the primer of these designed, designeds falls within the protection model of the present invention
Enclose.
Beneficial effect：
The Oryza sativa L. dormant trait related gene of the present invention affects the dormant trait of rice paddy seed.This locus gene of overexpression may result in
Grain Dormancy strengthens.Described site and its encoding gene can apply to genetic modification of plants, have appropriate dormancy to obtain
The kind of property it is ensured that under mal-condition yield and quality of rice be not affected or less affected by impact.
Brief description
Fig. 1 is parent N22, southern round-grained rice 35, the phenotype analytical of the comparison of NIL5 and NIL.
A is the plant type figure of parent；B is the germination percentage of parent's latter 35 days seeds of heading；C is parental seed after dry heat treatment
Germination percentage.
Fig. 2 is the finely positioning of qSdn-5.
A is the finely positioning of qSdn-5；B is to exchange individual plant checking；C is candidate gene.
Fig. 3 is over-express vector pCAMBIA1390 plasmid map.
The interference carrier LH-FAD2-1390RNAi plasmid map that Fig. 4 transforms for Li Hui.
Fig. 5 is the germination of transgenic overexpression plant.
Fig. 6 disturbs the germination of plant for transgenic.
Specific embodiment
Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, if no special instructions, is conventional method.Test material used in following embodiments, if no special instructions, is certainly
Routine biochemistry reagent shop is commercially available.
The discovery of embodiment 1, Oryza sativa L. dormant trait related locus and its encoding gene
First, the identification of Oryza sativa L. dormant trait, NIL build and genetic analyses
N22 is the rice variety with extremely strong dormant trait, and southern round-grained rice 35 is the japonica rice variety of no dormancy.Investigation N22 and southern round-grained rice
On the heading date of 35 each individual plants, the date that individual plant the first fringe fringe point is exposed sheath 2～3cm is designated as this individual plant heading day, individual plant
After heading, 35d harvests, and often selects good strains in the field for seed and takes 2 fringes, takes the seed of 50 mature and plump to be placed in the 9cm culture dish being covered with 2 filter paper, in
Under 30 DEG C and 100% relative humidities, light culture germinates, the detection germination percentage of the 7th day, is repeated 3 times.Exceeded with radicle/plumule
Half granule seed length, as germination standard, evaluates the power of dormant trait with percentage of seedgermination.As seen from Figure 1, the germination percentage of N22 is
0%, the germination percentage of southern round-grained rice 35 is close to 100%.The segregating population that N22 is obtained with southern round-grained rice 35 hybridization carries out dormancy phenotypic evaluation,
And after binding molecule labeled analysis are analyzed to the site of impact Grain Dormancy, choose the higher site qSdn-5 of contribution rate
It is analyzed.Contribution rate due to this site is derived from N22, so round-grained rice 35 is background parent on the south constructing, N22 (qSdn-5) is
The NIL (NIL5) of Insert Fragment.NIL5 and southern round-grained rice 35 are analyzed, NIL5 dormant trait is better than outside southern round-grained rice 35, in strain
No significant difference on the economical characters such as height, heading stage, filling rate, imbibition speed, tiller number, setting percentage and mass of 1000 kernel.
2nd, the acquisition of Oryza sativa L. dormancy site and its related gene
1st, the finely positioning of Oryza sativa L. dormancy site and its related gene
On the south round-grained rice 35 be female parent, N22 be paternal hybrid acquisition F1, continuously it is returned with southern round-grained rice 35 afterwards.BC2F2Only before
Carry out Phenotypic Selection, that is, select the individual plant that germination percentage is less than 1% to be used for further backcrossing, in BC2F2In generation, 10 germination percentages are little
Individual plant in 1% is chosen, and selfing produces BC2F3, continue to carry out being returned with southern round-grained rice 35 to arrive BC4F1In generation, selfing afterwards obtains BC4F2
(qSdn-5), in BC4F2(qSdn-5), in colony, qSdn-5 is positioned between labelling RM480 and RM3664.In order to further
Finely positioning is carried out to qSdn-5, we devise between RM480 and RM3664 according to the fine sequence in 9311 and Japan
InDel labelling.Further finely positioning we take the mode that two steps walk：On the one hand between labelling RM480 and RM3664
The further encrypted indicia of exchange individual plant interval to reduce positioning, and by way of offspring verifies, the phenotype exchanging individual plant is entered
Row identification；On the other hand pass through in 2011 Nanjing positive season to expand F2Target group's (7500 plants), a point individual plant takes blade and extracts DNA,
Screened using RM480 and RM3664 and exchange individual plant, in conjunction with the dormancy phenotype of each individual plant, choose the extreme individual plant that exchanges and be used for follow-up examination
Test.By both modes, we obtain between RM480 and qSdn-5 19 exchange individual plants, RM3664 and qSdn-5 it
Between obtain 20 exchange individual plants.The phenotype exchanging individual plant is verified by offspring in Hainan in 2011 and Nanjing in 2012 positive season respectively
Mode carry out phenotypic evaluation.It is analyzed to exchanging individual plant by exploitation InDel labelling between RM480 and RM3664, knot
Fruit shows that labelling InDel5-6, W20 and D4 and qSdn-5 isolate (Fig. 2A and Fig. 2 B)：Exchange individual plant Y368 and Y358 this three
Individual mark is the genotype of heterozygosity, and the germination percentage of its offspring checking is also detached phenotype；Exchange individual plant Y399 and Y426
Carry the genotype of southern round-grained rice 35 in these three mark, the result of its offspring checking shows as high germination；Exchange individual plant Y356 to exist
These three mark carry the genotype of N22, and the result of its offspring checking also shows as low germination.Finally we are fixed by qSdn-5
Between InDel labelling D9 and D7, according to the sequence prediction that Japan is fine, the physical distance of this section is about 50kb (Fig. 2) for position.
Above-mentioned exchange individual plant offspring's verification method is as follows：
(1) the exchange individual plant that each is used for analysis is planted, each 40 plants of plantation
(2) to exchanging the offspring that individual plant produces, point individual plant investigates the dormant trait of each individual plant
(3) count the phenotype distribution of all offsprings of each exchange individual plant, and no dormancy is designated as H, strong dormancy is designated as L, after
Separation and is designated as S in the type that represents.
The method of above-mentioned SSR marker analysis is as described below：
(1) extract the STb gene of above-mentioned selection individual plant as template, concrete grammar is as follows：
1. take 0.2 gram about of Oryza sativa L. young leaflet tablet, be placed in 2.0ml Eppendorf pipe, in pipe, place a steel ball,
The Eppendorf pipe installing sample is freezed 5min in liquid nitrogen, is placed in pulverizing sample on 2000 type GENO/GRINDER instruments
1min.
2. 660 μ l extracting solution (Tris-Hcl containing 100mM (PH 8.0), 20mM EDTA (PH 8.0), 1.4M are added
The solution of NaCl, 0.2g/ml CTAB), whirlpool device is acutely vortexed and mixes, ice bath 30min.
3. 40 μ l 20%SDS, 65 DEG C of temperature bath 10min, mixing of gently turning upside down every two minutes are added.
4. 100 μ l 5M NaCl are added, gentle mixing.
5. add 100 μ l 10 × CTAB, 65 DEG C of temperature bath 10min, be interrupted mixing of gently turning upside down.
6. add 900 μ l chloroforms, fully mix, 12000rpm is centrifuged 3min.
7. transfer supernatant, to 1.5mL Eppendorf pipe, adds 600 μ l isopropanols, mixes, and 12000rpm is centrifuged
5min.
8. abandon supernatant, precipitate with 70% (volumn concentration) ethanol rinse once, room temperature airing.
9. add 100 μ l 1 × TE (121 grams of Tris are dissolved in 1 liter of water, adjust pH value to 8.0 solution obtaining with hydrochloric acid) molten
Solution DNA.
10. 2 μ l electrophoresis detection DNA mass are taken, and with DU800 spectrophotometric determination concentration (Beckman Instrument
Inc.U.S.A).
(2) DNA of said extracted is diluted to about 20ng/ μ l, enters performing PCR amplification as template；
PCR reaction system (10 μ l)：DNA (20ng/ul) 1ul, forward primer (2pmol/ul) 1ul, downstream primer
(2pmol/ul) 1ul, 10xBuffer (MgCl2Free) 1ul, dNTP (10mM) 0.2ul, MgCl2(25mM) 0.6ul, rTaq
(5u/ul) 0.1ul, ddH2O 5.1ul, common 10ul.
PCR response procedures：94.0 DEG C of degeneration 5min；94.0 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, altogether
Circulation 35 times；72 DEG C of extension 7min；10 DEG C of preservations.PCR reaction is carried out in MJ Research PTC-225 thermal cycler.
Above-mentioned primer development process is as follows：
(1) SSR marker exploitation
The SSR marker of public collection of illustrative plates and Rice Genome Sequence are integrated, is downloaded the BAC/PAC near mutational site
Cloned sequence.With SSRHunter (Li Qiang etc., heredity, 2005,27 (5):808-810) or potential in SSRIT software search clone
SSR sequence (number of repetition >=6)；The sequence of these SSR and its neighbouring 400～500bp is existed by blast program in NCBI
Line is compared with corresponding long-grained nonglutinous rice sequence, if both SSR numbers of repetition are variant, tentatively infers the PCR of this SSR primer
There is polymorphism in product between Xian, round-grained rice；Recycle Primer Premier 5.0 software design SSR primer, and by Shanghai English fine horse
Bioisystech Co., Ltd synthesizes.Paired for the SSR of designed, designed primer equal proportion is mixed, detect its N22 and southern round-grained rice 35 it
Between polymorphism, show polymorphic person be used as finely positioning qSdn-5 molecular marker.Molecular marker for finely positioning is shown in Table
1.
The PCR primer detection of SSR marker：
Amplified production is analyzed with 8% native polyacrylamide gel electrophoresises.With the DNA Ladder of 50bp as contrast ratio
Compared with the molecular size range of amplified production, silver staining develops the color.
(2) InDel marker development
InDel design of primers：N22 and southern partial sector near qSdn-5 position for the round-grained rice 35 are sequenced, and
Compare, find the SNPs existing between the two, use software design InDel labelling based on these SNPs, use simultaneously
The corresponding another primer of Primer Premier 5.0 software design, is shown in Table 1.
The PCR reaction system of InDel labeled analysis：DNA (20ng/ul) 2ul, Primer1 (10pmol/ul) 2ul,
Primer2 (10pmol/ul) 2ul, 10xBuffer (MgCl2Free) 2ul, dNTP (10mM) 0.4ul, MgCl2(25mM)
1.2ul, rTaq (5u/ul) 0.4ul, ddH2O 10ul, cumulative volume 20ul.
Amplified reaction is carried out in PTC-200 (MJ Research Inc.) PCR instrument：94℃3min；94 DEG C of 30sec, 55
DEG C (primer different, adjusted) 45sec, 72 DEG C of 2.5min, 35 circulations；72℃5min.
PCR primer purification reclaims, and carries out by test kit (Beijing Tiangen company) step.PCR primer is digested overnight
Afterwards, with being separated by electrophoresis in the agarose gel of 1-4%, observe under uviol lamp through EB dyeing and take pictures.DCAPS with 8% non-
Degeneration PAGE glue separates, silver staining.
Table 1 is used for the molecular marker of finely positioning
(3) acquisition of dormant gene
According to the site design primer of positioning, sequence is as described below：
primer1：
5'—CACCACTAGGACTCAACGAGAA—3'(SEQ ID NO.4)
primer2：
5'—CTATGACATGATGCAACAAAGC—3'(SEQ ID NO.5)
With primer1 and primer2 as primer, respectively with the cDNA of N22 and southern round-grained rice 35 as template, enter performing PCR amplification and obtain
Obtain genes of interest.This is located at SEQ ID NO.2 upstream 81bp and downstream 220bp to primer, and amplified production contains this gene
All coding regions.
Amplified reaction with KOD enzymatic amplification (purchased from TOYOBO company), in PTC-200 (MJ Research Inc.) PCR instrument
On carry out：94℃2min；98 DEG C of 10sec, 60 DEG C of 30sec, 68 DEG C of 10min, 35 circulations；68℃20min.PCR primer is returned
Receive and be connected to (purchased from TAKARA company) on carrier pMb18T carrier after purification, conversion bacillus coli DH 5 alpha competent cell (purchase
From Tiangen company), select positive colony, be sequenced.
Sequencing results show, the fragment that PCR reaction obtains comprises the nucleotide sequence shown in SEQ ID NO.2, compiles
The protein (see SEQ ID NO.3) of 513 amino acid residue compositions of code.Albumen shown in SEQ ID NO.3 is named as
OsQSOXL1 (N22), the unnamed gene by the albumen shown in coding SEQ ID NO.3 is OsQSOXL1 (N22).
Embodiment 2, the acquisition of transgenic plant and identification
First, restructuring over-express vector and interference carrier build
With the cDNA of N22 as template, enter performing PCR amplification and obtain OsQSOXL1 (N22) gene, PCR primer sequence is as follows：
Primer3 (sequence shown in underscore is Kpn I recombination site)：
5'—TGCACTAGGTACCATGGCTGCGGCGGCGGT—3'(SEQ ID NO.6)
Primer4 (sequence shown in underscore is Spe I recombination site)：
5'—CGTTAACACTAGTTCAGTTCCAGTTCTTTCT—3'(SEQ ID NO.7)
Above-mentioned primer is located at the coding region original position of gene shown in SEQ ID NO.2 and coding region terminator position, expands
Volume increase thing contains the complete coding region of this gene, by PCR primer recovery purifying.UsingHD Cloning
PCR primer is cloned in carrier pCAMBIA1390 (Fig. 3) Kit recombination kit (Takara company).
In-Fusion recombining reaction system (10 μ L)：PCR primer 10-200ng, reclaims through Kpn I and Spe I double digestion
PCAMBIA1390 carrier 50-200ng, 5 × In-Fusion HD Enzyme Premix 2 μ L, Deionized water to
10μL.Pipette tips piping and druming is placed in after 50 DEG C of reaction 15min of mixed system on ice after mixing, and takes 2 μ L reaction system heat shock methods to turn
Change bacillus coli DH 5 alpha competent cell (Tiangen company).Cell will be totally converted be uniformly coated on card containing 100mg/L that is mould
On the LB solid medium of element.37 DEG C of culture 12-16h, picked clones positive colony, it is sequenced.
The structure of interference carrier, equally with the cDNA of N22 as template, enters performing PCR amplification and obtains OsQSOXL1 (N22) gene,
PCR primer sequence is as follows：
Primer5 (sequence shown in underscore is Kpn I recombination site)：
5'—GTTACTTCTGCACTAGGTACCGCCCACTGGTGTCCAGCTT—3'(SEQ ID NO.8)
Primer6 (sequence shown in underscore is Sac I recombination site)：
5'—GACGTAGGGGCGATAGAGCTCCACTTAGCAGAAGCAAATT—3'(SEQ ID NO.9)
Primer7 (sequence shown in underscore is Pst I recombination site)：
5'—TTTGCTTTTGGTTTTCTGCAGCACTTAGCAGAAGCAAATT—3'(SEQ ID NO.10)
Primer8 (sequence shown in underscore is BamH I recombination site)：
5'—TCTTAGAATTCCCGGGGATCCGCCCACTGGTGTCCAGCTT—3'(SEQ ID NO.11)
Above-mentioned primer initiates positioned at the initial 217bp in the coding region of gene shown in SEQ ID NO.2 and coding region
431bp, amplified production contains the partial coding region of this gene, is named as RNAi1,589bp and coding region that coding region initiates
Initial 843bp, amplified production contains the partial coding region of this gene, is named as RNAi2, by PCR primer recovery purifying.Adopt
WithPCR primer is cloned into carrier LH-FAD2- by HD Cloning Kit recombination kit (Takara company)
In 1390RNAi (Fig. 4).
In-Fusion recombining reaction system (10 μ L)：PCR primer 10-200ng of RNAi1, uses Kpn I and Sac for the first time
I double digestion reclaims LH-FAD2-1390RNAi carrier 50-200ng, 5 × In-Fusion HD Enzyme Premix 2 μ L,
Deionized water to 10 μ L, pipette tips piping and druming is placed on ice by after 50 DEG C of reaction 15min of mixed system after mixing, and second
PCR primer 10-200ng of secondary use RNAi2, Pst I and BamH I double digestion reclaim the LH-FAD2- being connected with RNAi1 fragment
1390RNAi carrier 50-200ng, 5 × In-Fusion HD Enzyme Premix 2 μ L, Deionized water to 10 μ
L.Pipette tips piping and druming is placed in after 50 DEG C of reaction 15min of mixed system on ice after mixing, and takes 2 μ L reaction system heat shock method conversions big
Enterobacteria DH5 α competent cell (Tiangen company).It is uniformly coated on being totally converted cell containing 100mg/L kanamycin
On LB solid medium.37 DEG C of culture 12-16h, picked clones positive colony, it is sequenced.
Sequencing result shows, has obtained the recombinant expressed load containing OsQSOXL1 (N22) gene shown in SEQ ID NO.2
Body, the pCAMBIA1390 containing OsQSOXL1 (N22) is named as pCAMBIA1390-OsQSOXL1 (N22), contains
The LH-FAD2-1390RNAi of OsQSOXL1 (N22) is named as LH-FAD2-1390RNAi-OsQSOXL1 (N22).
2nd, the acquisition of recombinational agrobacterium
With electric shocking method by pCAMBIA1390-OsQSOXL1 (N22) and LH-FAD2-1390RNAi-OsQSOXL1 (N22) point
Not Zhuan Hua Agrobacterium EHA105 bacterial strain (purchased from handsome company of the U.S.), obtain recombinant bacterial strain, extract plasmid and enter performing PCR and enzyme action mirror
Fixed.PCR and enzyme action are identified that correct recombinant bacterial strain is respectively designated as EH-pCAMBIA1390-OsQSOXL1 (N22) and EH-
LH-FAD2-1390RNAi-OsQSOXL1(N22).
3rd, the acquisition of transgenic plant
By EH-pCAMBIA1390-OsQSOXL1 (N22) rice transformation south round-grained rice 35, EH-LH-FAD2-1390RNAi-
OsQSOXL1 (N22) rice transformation NIL5, concrete grammar is：
(1) 28 DEG C of culture EH-pCAMBIA1390-OsQSOXL1 (N22) and EH-LH-FAD2-1390RNAi-OsQSOXL1
(N22) 16 hours, collects thalline, and be diluted in the N6 fluid medium containing 100 μm of ol/L (Sigma company, C1416) extremely
Concentration is OD600≈ 0.5, obtains bacterium solution；
(2) by the bacterium solution of the southern round-grained rice 35 of culture to month and NIL5 Mature Embryos of Rice embryo callus and step (1)
Mixed infection 30min, filter paper proceeds in co-cultivation culture medium (N6 solid co-cultivation medium, Sigma company) after blotting bacterium solution,
24 DEG C co-culture 3 days；
(3) wound healing of step (2) is seeded in containing 100mg/L paromomycin (Phyto Technology
Laboratories company) N6 solid screening culture medium on for the first time screen (16 days)；
(4) picking health wound healing proceeds to programmed screening in the N6 solid screening culture medium containing 100mg/L paromomycin,
Every 15 days subcultures are once；
(5) picking health wound healing proceeds to and screens for the third time in the N6 solid screening culture medium containing 50mg/L paromomycin,
Every 15 days subcultures are once；
(6) picking kanamycin-resistant callus tissue proceeds to differentiation on division culture medium；
Obtain the T of seedling differentiation0For positive plant.On the south round-grained rice 35 and NIL5 be negative control.
4th, the identification of transfer-gen plant
1st, PCR Molecular Identification
The T that step 3 is obtained0Extract genomic DNA for positive plant, with genomic DNA as template, utilize
The primer on primer Primer3 and SEQ ID NO.2 near pCAMBIA1390 upper SEQ ID NO.2 insertion point left margin
Primer4 is expanded (Primer3 as primer pair：5'—TGCACTAGGTACCATGGCTGCGGCGGCGGT—3'(SEQ
ID NO.6) and Primer4：5'—CGTTAACACTAGTTCAGTTCCAGTTCTTTCT 3'(SEQ ID NO.7)), amplification
Length 1542bp.Using the primer Primer4 near SEQ ID NO.2 insertion point left margin on LH-FAD2-1390RNAi and
Primer Primer5 on SEQ ID NO.2 is expanded (Primer5 as primer pair：5'—GTTACTTCTGCACTAGGTACCGCCCACTGGTGTCCAGCTT 3'(SEQ ID NO.8) and Primer6：5'—GACGTAGGGGCGATAGAGCTCCACTTAGCAGAAGCAAATT 3'(SEQ ID NO.9)), amplification length 215bp.PCR
Reaction system：DNA (20ng/ul) 2ul, Primer5 (10pmol/ul) 2ul, Primer6 (10pmol/ul) 2ul,
10xBuffer(MgCl2Free) 2ul, dNTP (10mM) 0.4ul, MgCl2(25mM) 1.2ul, rTaq (5u/ul) 0.4ul,
ddH2O 10ul, cumulative volume 20ul.Amplified reaction is carried out in PTC-200 (MJ Research Inc.) PCR instrument：94℃
3min；94 DEG C of 30sec, 55 DEG C of 45sec, 72 DEG C of 1min, 35 circulations；72℃5min.
Reclaim PCR primer with test kit (Beijing Tiangen company) purification.PCR primer is examined with 1% sepharose electrophoresis
Survey.(N22) plant.
2nd, phenotypic evaluation
Respectively by T0In generation, turns EH-pCAMBIA1390-OsQSOXL1 (N22) and EH-LH-FAD2-1390RNAi-
OsQSOXL1 (N22) plant, NIL5, southern round-grained rice 35 and N22 are planted in Agricultural University Of Nanjing's rice test station, and heading is turned for 35 days
Gene plant carries out sowing, carries out the identification of dormancy phenotype.Southern round-grained rice 35 plant germination percentage is about 97%, proceeds to EH-
Separating occurs in the transfer-gen plant germination percentage of pCAMBIA1390-OsQSOXL1 (N22), and the wherein germination percentage of Y2914-2-9 is about
The germination percentage of 39%, Y2916-2-2 is about 50% (Fig. 5).And NIL5 plant germination percentage is about 19%, proceeds to and turn EH-LH-
Separation, the wherein germination percentage of Y2867-1-8 about in the transfer-gen plant germination percentage of FAD2-1390RNAi-OsQSOXL1 (N22)
Germination percentage for 54%, Y2876-1-3 is about 90% (Fig. 6).Illustrate that OsQSOXL1 (N22) can affect the dormancy of seed really
Property.
Claims (10)
1. a kind of rice paddy seed dormancy related gene OsQSOXL1 (N22), its nucleotide sequence is as shown in SEQ ID NO.1.
2. rice paddy seed dormancy related gene OsQSOXL1 (N22) described in claim 1 encodes protein it is characterised in that
Aminoacid sequence is as shown in SEQ ID NO.3.
3. protein according to claim 2 it is characterised in that：The encoding gene of described protein is following 1) or 2) or
3) DNA molecular or 4)：
1) DNA molecular shown in SEQ ID NO.1；
2) DNA molecular shown in SEQ ID NO.2；
3) under strict conditions with 1) or 2) DNA molecular of the DNA sequence hybridization that limits and encoding said proteins；
4) with 1) or 2) or 3) DNA sequence that limits has more than 90% homology, and encode rice paddy seed dormant trait albumen
DNA molecular.
4. the recombinant expression carrier containing gene described in claim 1, expression cassette, transgenic cell line or recombinant bacterium.
5. recombinant expression carrier as claimed in claim 4 it is characterised in that：Described over-express vector is in pCAMBIA1390
The recombiant plasmid that gene described in insertion claim 1 between the Kpn I of carrier and Spe I double enzyme site obtains.
6. the total length of gene and its primer pair of any fragment described in amplification claim 1, preferably Primer1/Primer2,
Primer3/Primer4, Primer5/Primer6 and Primer7/Primer8；Primer1 sequence such as SEQ ID NO.4 institute
Show, Primer2 sequence as shown in SEQ ID NO.5, Primer3 sequence as shown in SEQ ID NO.6, Primer4 sequence such as SEQ
Shown in ID NO.7, Primer5 sequence as shown in SEQ ID NO.8, Primer6 sequence as shown in SEQ ID NO.9, Primer7
, as shown in SEQ ID NO.10, Primer8 sequence is as shown in SEQ ID NO.11 for sequence.
7. gene described in claim 1, protein described in claim 2, recombinant expression carrier described in claim 4, expression cassette,
At least one application in plant breeding in transgenic cell line or recombinant bacterium.
8. a kind of method cultivating rice paddy seed appropriateness dormant trait, is by the no dormancy Oryza sativa L. product of channel genes described in claim 1
In kind, obtain the enhanced transgenic paddy rice of dormant trait；Preferably gene described in claim 1 is passed through weight described in claim 4 or 5
In group expression vector importing no dormancy Oryza sativa L.；Described no dormancy rice varieties be germination percentage close to 100% rice varieties；Described
Stop the transgenic paddy rice that the enhanced transgenic paddy rice of dormant trait is less than 80% for germination percentage.
9. a kind of method cultivating the enhanced transgenic plant of Grain Dormancy, is claim 1 institute in overexpression purpose plant
State the expression of gene, obtain the enhanced transgenic plant of dormant trait；Described purpose plant is to carry gene described in claim 1
Plant.
10. the positioning that rice paddy seed dormancy related gene OsQSOXL1 (N22) described in finely positioning claim 1 uses is drawn
Thing is it is characterised in that be selected from following pair of primers：
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610762831.1A CN106381299B (en) | 2016-08-29 | 2016-08-29 | A kind of rice paddy seed dormant gene OsQSOXL1 and its coding protein and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610762831.1A CN106381299B (en) | 2016-08-29 | 2016-08-29 | A kind of rice paddy seed dormant gene OsQSOXL1 and its coding protein and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106381299A true CN106381299A (en) | 2017-02-08 |
| CN106381299B CN106381299B (en) | 2019-05-14 |
Family
ID=57938242
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610762831.1A Active CN106381299B (en) | 2016-08-29 | 2016-08-29 | A kind of rice paddy seed dormant gene OsQSOXL1 and its coding protein and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106381299B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116286954A (en) * | 2023-03-15 | 2023-06-23 | 南京农业大学 | Construction and application of rice gibberellin decomposition gene OsGA2ox7 mutant |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5339506B2 (en) * | 2008-09-25 | 2013-11-13 | 独立行政法人農業・食品産業技術総合研究機構 | MFT gene involved in wheat seed dormancy and use thereof |
-
2016
- 2016-08-29 CN CN201610762831.1A patent/CN106381299B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5339506B2 (en) * | 2008-09-25 | 2013-11-13 | 独立行政法人農業・食品産業技術総合研究機構 | MFT gene involved in wheat seed dormancy and use thereof |
Non-Patent Citations (3)
| Title |
|---|
| UNIPROTKB: "UniProtKB - B8AWF5", 《UNIPROTKB》 * |
| UNIPROTKB: "UniProtKB - Q6AUC6", 《UNIPROTKB》 * |
| 沈贝贝 等: "水稻品种"N22"强休眠性QTL qSd-1 的遗传解析ion", 《南京农业大学学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116286954A (en) * | 2023-03-15 | 2023-06-23 | 南京农业大学 | Construction and application of rice gibberellin decomposition gene OsGA2ox7 mutant |
| CN116286954B (en) * | 2023-03-15 | 2023-12-01 | 南京农业大学 | Construction and application of rice gibberellin decomposition gene OsGA2ox7 mutant |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106381299B (en) | 2019-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108239647B (en) | Gene and molecular marker for controlling rape plant type and application | |
| CN103554238B (en) | Plant starch synthesis-related protein FLO6 and encoding gene and applications thereof | |
| CN106754967B (en) | Rice grain type gene OsLG1 and encoding protein and application thereof | |
| CN106432447B (en) | A kind of plant amylum synthesis associated protein OsPKp1 and its encoding gene and application | |
| CN108642067A (en) | A kind of relevant gene OsHsp70cp-2 of paddy endosperm silty and its coding protein and application | |
| CN108642065A (en) | A kind of paddy endosperm silty related gene OsSecY2 and its coding protein and application | |
| CN102603878B (en) | Vegetable glutelin transportation storage related protein OsVps9a as well as coding gene and application thereof | |
| CN102617717B (en) | Protein OsGPA3 relevant to sorting of plant glutelin, encoding gene of protein OsGPA3 and applications of protein OsGPA3 and encoding gene | |
| CN107475266A (en) | A kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and application | |
| CN107337720A (en) | A kind of plant glutelin transhipment storage GAP-associated protein GAP OsNHX5 and its encoding gene and application | |
| CN104628839B (en) | A kind of paddy endosperm amyloplast development associated protein and its encoding gene and application | |
| CN108047319B (en) | Rice seed dormancy regulatory gene OsMPK14 and application thereof | |
| CN106589085B (en) | Plant starch synthesis related protein OsFLO8, and coding gene and application thereof | |
| CN106432444A (en) | Protein GPA4 related to plant glutelin transportation and storage and encoding gene and application thereof | |
| CN106381299B (en) | A kind of rice paddy seed dormant gene OsQSOXL1 and its coding protein and application | |
| CN110229825A (en) | The brown Leaf color mutant GBL1 gene of rice ash and its application | |
| CN107446031A (en) | A kind of plant glutelin transhipment storage GAP-associated protein GAP OsVHA E1 and its encoding gene and application | |
| CN108165557A (en) | Application of the wheat TaZCCT2 genes in the flowering of plant time is regulated and controled | |
| CN108676081A (en) | Chinese milk vetch LEAFY genes and its application | |
| CN106244596A (en) | A kind of rice paddy seed dormant gene OsDOG1L3 and application thereof | |
| CN106350525B (en) | A kind of rice grain shape gene DSS and its coding protein and application | |
| CN104650204B (en) | The albumen related to rice ATP transports and Development of Chloroplasts and its encoding gene and application | |
| CN105950598B (en) | Rice dormancy-breaking related protein and coding gene and application thereof | |
| CN106349353B (en) | Plant starch synthesis related protein OsFSE (OsFSE) regulation and control, and coding gene and application thereof | |
| CN110407922A (en) | Rice cold tolerance gene qSCT1 and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |