CN1062311C - Fused gene of IL-2 or its derivative and ANP or its derivative, three kinds of protein product thereof and their application, and vector containing said gene and construction method thereof - Google Patents

Abstract

The utility model relates to a fusion gene of human interleukin 2 (IL-2) or derivatives thereof and human atrial natriuretic peptide (ANP) or derivatives thereof, three kinds of protein products obtained by the fusion gene, a high-level expression recombinant containing the fusion gene, a method for constructing the recombinant and engineering bacteria obtained by carrying inheritance engineering by the recombinant. The utility model also relates to the application of the protein products of the fusion gene in pharmacology.

Description

The fusion gene of human interleukin-12 derivative and SANP1, its protein product and application

The present invention relates to the fusion gene of human interleukin-12 (IL-2) or derivatives thereof and human atrial natriuretic peptide (ANP) or derivatives thereof, the protein that obtains by fusion gene, comprise the recombinant chou that efficiently expresses of this fusion gene and the construction process of this recombinant chou, also relate to the application of protein product in pharmacology of described fusion gene.

Human atrial natriuretic peptide (ANP) is a kind of 28 peptide hormones of people atrium excretory, aminoacid sequence is seen the SEQ ID NO.5 in the accompanying sequence table of this paper, it plays an important role aspect the environment in regulating cardiovascular and stablizing, and it has the effect of powerful sharp sodium, diuresis, vasodilator, inhibition renin-angiotensin.Up to the present, domestic and international research personnel have used genetic engineering means and chemosynthesis means that atrial natriuretic peptide and derivative thereof have been carried out a large amount of research, attempt to use it for treatment women gestational hypertension, eliminate ascites pleural fluid, pulmonary edema, cerebral edema, and study its effect acute renal failure and cardiac insufficiency.Though yet atrial natriuretic peptide has been carried out a large amount of medical research, but there is a key issue to influence its effect, promptly 28 peptide atrial natriuretic peptide transformation period are shorter, have only 2.5 minutes, degradation in vivo speed is fast, thereby the curative effect weak point has influenced its clinical application, for example the U.S. is through the effect of the clinical three phases checking of 500 many cases atrial natriuretic peptide to the treatment acute renal failure, and only 1/4 oliguresis renal failure case is effective.Therefore, seek a kind of efficient, long lasting atrial natriuretic peptide derivative and seem particularly important.For example, China Xi-an No.4 Military Medical Univ. utilization chemical synthesis has been synthesized the 25 peptides atrial natriuretic peptide derivative in (healthy newspaper, on February 8th, 1996), according to announcing that this synthetic peptide is good to women's gestational hypertension curative effect.Some investigators of the U.S. also at the synthetic ANP derivative of a kind of 25 peptides of checking to the effect of acute renal failure, but do not announce the result so far as yet.In addition, for improving the active and stable of atrial natriuretic peptide, also there is investigator's nucleotide sequence to coding ANP from the gene level to carry out modifying with a series of atrial natriuretic peptide derivatives active and stability that are improved, these work (Bioche.Biophys.Res.Commun.1987,143:499; Eur.J.Pharmac.1988 147:49-57) for example comprises (1) will encode amino acid whose sequence deletion of N-terminal 1-6 of ANP, and 22 peptide ANP derivatives of gained can improve active 2-3 doubly; (2) will the encode codon mutation of the 8th phenylalanine (Phe) is the codon of Serine (Ser), and the product that then obtains can improve stability effectively; (3) will the encode codon mutation of the 12nd methionine(Met) (Met) is the codon of Isoleucine (ILe), then can improve active 1-2 again doubly.

Interleukin II (IL-2) is to have an active lymphokine of various biological by what several activated T cells subgroups produced, and it has important effect in immunomodulatory.IL-2 has been widely used in treating aspects such as tumour, immunodeficiency diseases and infectious diseases at present, and has obtained certain curative effect.But, heavy dose of according to reports use IL-2 can cause toxic side effect such as oliguresis acute renal failure, uroschesis, microvascular leakage, pulmonary edema, acute heart failure, and in addition, IL-2 in fact treats the poor effect of malignant tumour, except that melanoma, the efficient of kidney had only 23%.Clinical use IL2 work shows, if IL-2 is injected directly into tumor focus, because of local I L-2 concentration height, signal are strong, can improve the curative effect of IL-2.

Reported in literature (Quirion R.et al PNAS 1986,83:174), atrial natriuretic peptide receptor is enriched in lung (3323 ± 156cpm), kidney (1463 ± 474cpm), the heart (1272 ± 216cpm), liver (1017 ± 162cpm), testis (905 ± 142cpm), aorta (823 ± 73cpm), intestines (505 ± 178cpm), stomach (442 ± 77cpm), therefore, the inventor can treat the function of oliguresis renal failure and heart failure based on ANP and derivative thereof, and IL-2 high local concentrations treatment tumor effect is good, but cause the oliguresis acute renal failure simultaneously, toxic side effect such as acute heart failure, ANP or derivatives thereof and IL-2 are merged in consideration, the theory of utilization targeted therapy, with the ANP or derivatives thereof is " rider " of molecular guide, IL-2 is taken and is concentrated in to lung, kidney, on the internal organs such as liver, to improve the concentration of IL-2, thereby strengthen the immune signal of IL2, so that more effectively activate the Lak cell, the NK cell, production of TNF induced and IFN, thereby improve IL-2 to lung, kidney, the curative effect of liver cancer, utilize the ANP or derivatives thereof to eliminate the above-mentioned toxic side effect of IL-2, and improve the transformation period of ANP.Thus, finished the present invention.

Therefore, first purpose of the present invention is to provide the nucleotide sequence of coding human atrial natriuretic peptide or derivatives thereof and the fusion gene of the nucleotide sequence of coding human interleukin-12 derivative, and this fusion gene inserts the fusion rotein that suitable expression vector can efficiently express atrial natriuretic peptide or derivatives thereof and interleukin II derivative.

Second purpose of the present invention is to provide the fusion rotein of atrial natriuretic peptide or derivatives thereof and interleukin II derivative.

The 3rd purpose of the present invention is to provide a kind of dna sequence dna of the SANP1 of encoding and by the SANP1 of this sequence encoding, described dna sequence dna is the part of above-mentioned fusion gene, and described SANP1 is the product of above-mentioned fusion rotein gained after the endopeptidase zymoplasm cuts off.This atrial natriuretic peptide derivative is better than 28 original peptide ANP aspect active and stable.

The 4th purpose of the present invention is to provide a kind of dna sequence dna of the human interleukin-12 derivative of encoding and by the human interleukin-12 derivative of this sequence encoding, described dna sequence dna is the part of above-mentioned fusion gene, and described IL-2A is the product of above-mentioned fusion rotein gained after the endopeptidase zymoplasm cuts off.

The 5th purpose of the present invention is to provide efficient expression vector that comprises above-mentioned fusion gene and the method that makes up this carrier.

The 6th purpose of the present invention is to provide the engineering bacteria that can produce three kinds of active polypeptide that contains described expression vector, i.e. " bacterium three elements " engineering bacteria.

The 7th purpose of the present invention is above-mentioned fusion rotein and SANP1 and the application of human leukocyte derivative in pharmacy.

According to an aspect of the present invention, the fusion gene of the nucleotide sequence of the nucleotide sequence of coding human atrial natriuretic peptide or derivatives thereof and the human interleukin-12 derivative of encoding is provided, its length is respectively 486 and 504 base pairs, its nucleotide sequence is respectively shown in SEQ ID NO:1 in the sequence table and SEQ ID NO:2, wherein SEQ ID NO:1 is the nucleotide sequence of coding SANP1 sANP1 and the nucleotide sequence of the fusion gene of the nucleotide sequence of coding human interleukin-12 derivative I L-2a, and SEQ ID NO:2 is the nucleotide sequence of coding 28 peptide human atrial natriuretic peptides and the nucleotide sequence of the fusion gene of the nucleotide sequence of coding human interleukin-12 derivative I L-2a.In these two fusion genes, Nucleotide joint by coding zymoplasm recognition sequence (Gly-Val-Arg-Gly-Pro-Arg) between the encoding sequence of human atrial natriuretic peptide or derivatives thereof and the encoding sequence of IL-2A is connected, in SEQ ID NO:1 and 2, this Nucleotide joint sequence is illustrated by underscore.Behind expression vector, can efficiently express out fusion rotein by the described as can be seen two kinds of fusion gene clonings of the embodiment of this paper.

According to a further aspect in the invention, provide the fusion rotein of human atrial natriuretic peptide or derivatives thereof and human interleukin-12 derivative, difference called after DFP1 and DFP3, its aminoacid sequence is respectively shown in the SEQ ID NO:3 and SEQ ID NO:4 of sequence table.Wherein, DFP1 is the fusion rotein of SANP1 sANP1 and human interleukin-12 derivative I L-2a, and DFP3 is the fusion rotein of total length human atrial natriuretic peptide ANP and human interleukin-12 derivative I L-2a.In these two fusion roteins, link to each other by the zymoplasm recognition sequence between human atrial natriuretic peptide ANP or derivatives thereof sANP1 and the human interleukin-12 derivative I L-2a, this recognition sequence illustrates with underscore in SEQ ID NO:3 and 4.

In accordance with a further aspect of the present invention, a kind of fusion rotein DFP1 of the present invention is provided product SANP1 sANP1 and the dna sequence dna thereof after the zymoplasm enzyme is cut, sANP1 contains 22 amino-acid residues, it is that aforementioned known three kinds of possibilities that improve activity and stability are integrated, in cassette mutagenesis and gene, recombinate, make its product lack 6 amino acid of 28 peptide atrial natriuretic peptides (SEQ ID NO:5) N-terminal, and its phenylalanine of the 8th sported Serine, its methionine(Met) of the 12nd is sported Isoleucine, 22 peptide ANP derivatives of gained increase significantly aspect active and stable (as described below).Therefore the present invention has adopted this atrial natriuretic peptide derivative encoding gene through sudden change.

According to a further aspect in the invention, a kind of fusion rotein DFP1 of the present invention or DFP3 are provided product human interleukin-12 derivative I L-2a and the dna sequence dna thereof after the zymoplasm enzyme is cut, IL-2a contains 140 amino-acid residues altogether, wherein remains with the zymoplasm recognition sequence of 6 amino-acid residues at C-terminal.Compare with natural IL-2, the 100th amino acids of IL-2a becomes glycine by L-glutamic acid, and the 125th amino acids becomes Serine by halfcystine.

According to another aspect of the invention, provide efficient expression vector and this construction of carrier that comprises described fusion gene.For improving the efficient of genetic expression, 1-4 the copy forward that will comprise the operon element of the described dna fragmentation that comprises fusion gene inserts general expression vector such as plasmid pLY1, recombinant plasmid imported host such as E.coli DH5 α etc. can efficiently express fusion rotein of the present invention.So the engineering bacteria that makes up has constituted another aspect of the present invention.The coli strain E.coli DH5 α/DFP1 and the E.coli DH5 α/DFP3 that comprise fusion gene DFP1 of the present invention and DFP3 are preserved in Chinese typical culture collection center on September 4th, 1996, and preserving number is respectively CCTCC M 96013 and CCTCC M 96014.These two bacterial strains are respectively to contain the transformant that screening obtains behind the plasmid pAHQ6 (containing the DFP1 gene) of the DFP1 of the two copies of cis or DFP3 gene expression element or pCW122 (containing the DFP3 gene) the transformed into escherichia coli DH5 α.Described Expression element comprises PL promotor, SD ribosome recognition sequence, fusion gene DFP1 or DFP3, T1T2 terminator sequence.The method according to this invention, the Expression element of 1-4 copy can be inserted expression vector, experiment shows that two copy forms have significantly improved the expression level of fusion gene, the insertion of the Expression element of 3-4 copy and the plasmid that produces still improves aspect expression level to some extent, but made expression level up to 45% total protein of cell the fusion gene Expression element insertion expression vector of two copies, met the requirement of production fully.

The invention still further relates to described fusion rotein DFP1 and DFP3 and prevent and resist application in the medicine that carcinoma in situ shifts in preparation, fusion rotein of the present invention may prevent and resist carcinoma in situ and be transferred to lung, kidney, liver or testis etc., and particularly being transferred to lung for carcinoma in situ has better effect.By embodiment as can be seen, it is strong 1 times with the energy force rate IL2 that shifts that fusion rotein DFP1 of the present invention resists the cancer cells diffusion, utilize the diuretic properties of the sANP1 on the DFP1 to eliminate the acute renal failure that IL2 may cause simultaneously, therefore the invention still further relates to the application of described fusion rotein in the medicine of the anti-oliguresis renal failure of preparation.Diuresis and the hypotensive effect of fusion rotein DFP1 of the present invention resulting atrial natriuretic peptide derivative sANP1 after zymoplasm digestion also are better than natural A NP through determination of pharmacological activity.With 28 peptide ANP relatively, the diuretic activity of sANP1 is its 2.9 times, and antihypertensive activity is its 2.7 times, and the step-down time length is its 4.3 times, and the transformation period is its 2 times.Thereby for the application of sANP1 in preparation diuresis and antihypertensive drugs provides possibility.

Therefore, fusion gene of the present invention and fusion rotein are the products that obtains on a kind of brand-new theoretical basis.Described fusion rotein is the difunctional bioactive peptide that has guiding anti-tumor activity and diuresis, hypotensive activity concurrently, its half life, inferred and may be 5-6 minute through experimental result, 2.5 minutes half lifes than natural 28 peptide ANP, will be about 1 times, thereby can bring into play effectiveness better in vivo.And this fusion rotein can through comprising guidance and the ANP receptors bind of ANP or derivatives thereof sANP1, concentrate in lung, liver, kidney etc. and locate, preventing and resisting carcinoma in situ and shift in stronger 1 times aspect the lung than IL2; Secondly this fusion rotein can be eliminated toxic side effect such as oliguresis acute renal failure that IL2 causes, microvascular leakage, pulmonary edema, acute heart failure.Experiment shows, compares with IL-2, and under same dose, the activity of urinating of IL-2 is physiology brinish 83%, and the active physiology brinish 120% that is of urinating of fusion rotein.IL-2 can cause ventricular premature contraction, and electrocardiogram(ECG is normal when using fusion rotein.The diuretic activity of fusion rotein DFP1 is 1.8 times of original 28 peptide natural A NP in addition, and antihypertensive activity is 2.3 times of original ANP, and the time length is 4.3 times of ANP.

Hereinafter with reference to drawings and Examples the present invention is explained in detail, is understood that embodiment just specifically describes the present invention and is not limitation of the present invention.

The 4 kinds of atrial natriuretic peptide derivatives that Fig. 1 illustrates that embodiment 1 obtains and the comparison of 28 peptide atrial natriuretic peptide aminoacid sequences.

Fig. 2 illustrates the structure of the plasmid pAHQ1 that contains atrial natriuretic peptide derivative sANP1 gene.

Fig. 3 illustrates the structure of the plasmid IL-2aINP that contains the IL-2a gene.

Fig. 4 illustrates the structure of the plasmid pAHQ2 that contains sANP1 and IL-2a gene.

Fig. 5 illustrates the structure that contains sANP1 and IL-2a fusion gene DFP1 expression carrier pAHQ3.

Fig. 6 illustrates the structure of the efficient expression vector pAHQ5 that contains fusion gene DFP1.

Fig. 7 illustrates the structure of the carrier pAHQ6 with two copy DFP1 Expression elements.

Fig. 8 is that the gained transformant is schemed through the SDS-PAGE of thermal induction expressed fusion protein DFP1 behind expression vector pAHQ5 and the pAHQ6 transformed into escherichia coli DH5 α, among the figure swimming lane 1 be high density fermentation without inductive DH5 α/pAHQ5, swimming lane 2 is the DH5 α/pAHQ5 of the abduction delivering of high density fermentation, swimming lane 3 and 8 (is followed successively by 66200 from top to bottom for protein molecular weight standard, 43000,31000,20100 and 14400 dalton), swimming lane 4 is without inductive DH5 α/pAHQ5, swimming lane 5 is through inductive DH5 α/pAHQ5, swimming lane 6 is without inductive DH5 α/pAHQ6, swimming lane 7 is through inductive DH5 α/pAHQ6, and arrow is depicted as the position of fusion rotein DFP1 of the present invention (molecular weight about 18600) among the figure.

Fig. 9 A and Fig. 9 B illustrate DFP1 fusion rotein of the present invention and ANP, physiological saline and IL2 at the activity experiment comparative result aspect the diuresis with diagrammatic form, wherein Fig. 9 A is illustrated on the different time point of experiment, the voided volume of the mouse of different experiments group, Fig. 9 B then is illustrated on the different time point of experiment, the total volume of urine of the mouse of different experiments group.

Figure 10 is shown specifically the building process of the fusion gene DFP3 expression carrier that contains ANP and IL-2a.

Figure 11 is expression vector pCW120, pCW121, pCW122, the gained transformant is through thermal induction or without the SDS-PAGE of abduction delivering fusion rotein DFP3 figure behind pCW123 and the pCW124 transformed into escherichia coli DH5 α, M is that protein molecular weight standard (is followed successively by 66200 from top to bottom among the figure, 43000,31000,20100 and 14400 dalton), swimming lane 1 is through 42 ℃ of inductive DH5 α/pCW122, swimming lane 2 is without inductive DH5 α/pCW122, swimming lane 3 is through 42 ℃ of inductive DH5 α/pCW121, swimming lane 4 is without inductive DH5 α/pCW121, swimming lane 5 is through 42 ℃ of inductive DH5 α/pCW120, swimming lane 6 is without inductive DH5 α/pCW120, swimming lane 7 is through 42 ℃ of inductive DH5 α/pCW123, swimming lane 8 is without inductive DH5 α/pCW123, swimming lane 9 is through 42 ℃ of inductive DH5 α/pCW124, and swimming lane 10 is without inductive DH5 α/pCW124.Arrow is depicted as the position of fusion rotein DFP3 of the present invention among the figure.

Figure 12 illustrates DFP3 fusion rotein of the present invention and in contrast standard A NP, physiological saline and standard I L2 at the activity experiment comparative result aspect the diuresis with diagrammatic form.

Figure 13 illustrates ANP that DFP3 fusion rotein of the present invention produces through zymoplasm cutting and in contrast standard A NP, physiological saline at the activity experiment comparative result aspect the diuresis with diagrammatic form.

Figure 14 A and 14B show the diastolic blood vessel activity result of experiment of DFP3 and ANP sample respectively, and the rat artery vascular strip that exsomatizes is adopted in experiment.

In the following embodiments, except as otherwise noted, used various restriction enzymes and other genetically engineered toolenzyme are all available from Promega company; Sephacryl S-200 is a Pharmacia company product; High voltage electrophoresis apparatus Model 3000Xi, low pressure chromatographic system Econo system, supercentrifuge Sorvall RC24, PhastGel scanner Chromscan 3 are Joyee loel product, fermentation system is a New Brunswick Scientific product.DNA digestion and ligation condition are carried out according to the guidance that manufacturer provides.The method for transformation of host cell is as described in the Molecular Cloning-ALaboratory Manual.Employed in addition bacterial strain and initial plasmid are as follows: bacterial strain: the initial plasmid of bacillus coli DH 5 alpha: pBSsk, available from the consonance ply of friendship company of medical university II-13, research department, inventor place makes up the pLY I, the structure of 4 kinds of atrial natriuretic peptide derivative genes such as constructed embodiment 1 sANP1 of research department, inventor place and efficiently expressing

For obtaining the atrial natriuretic peptide derivative of high reactivity and stability, according to the described three kinds of possibilities of this paper background technology part, comprehensively be a sudden change box with it, the reorganization in the careful then sodium plain gene is replaced and is obtained 4 kinds of novel atrial natriuretic peptide derivative genes.The sANP1 gene is one of them.Concrete steps are as follows: the segmental preparation of (1) sudden change box

Synthetic respectively in the following sequence two sections oligonucleotide fragments, all must introduce various mutations in same site the time, two kinds of bases that then add equivalent simultaneously: fragment 1 (32 bases): T5 ' AATTCCATATGGAATGC TCGGTGGTCGTATG 3 ' A fragment 2 (31 bases): the above-mentioned fragment of T5 ' GTCGATACGACCACCGG GCATTCCATATGG 3 ' A is synthesized after ammonia is separated, behind PAGE separation and the Sep-Pak C18 post reversed-phase column purifying, anneal and phosphorylation.(2) by recombination to construct α hANP derivative in the gene

At first, at the middle part of α hANP (former 28 peptide atrial natriuretic peptides) gene one Ava II site is arranged.From recombinant chou pLY1, isolate α hANP Ava II site and be used for reorganization to terminator codon TGA and follow-up 350bp fragment to the Hind III.The pLY1 (see figure 10) is to be framework with pBR322, mainly by the reorganization gene of entering except ampicillin resistance gene and CIts857, also have following structure: P _RP _L-CII (SD)-Ref-α hANP cuts pLY1 with Ava II and Hind III enzyme, collects the fragment of 350bp, is Ava II-Stop-Hind III fragment of α hANP, is equipped with the usefulness with reorganization.

Secondly, be carrier with pBS-Sk (+), cut with EcoR I and Hind III enzyme, collecting the big fragment of 2952bp is the carrier of new recombinant chou.

Then, in 32bp sudden change box fragment: the 350bp fragment: the ratio of 2952bp fragment=20: 5: 1 (mol ratio), three fragments are mixed, add ligase enzyme and damping fluid thereof and spend the night 16 ℃ of connections, transformed competence colibacillus cell JM101 can obtain transformant.

The gained transformant is through the dna sequence analysis of bacterium colony in situ hybridization, plasmid Restriction Enzyme spectrum analysis and positive recombinant, 4 kinds of satisfactory atrial natriuretic peptide derivative genes have been obtained, be called sANP1, sANP2, sANP3, sANP4, the aminoacid sequence of its aminoacid sequence and α hANP more as shown in Figure 1.The fusion of (3) 4 kinds of sANP efficiently expresses

4 kinds of sANP on the former pBS-Sk of being cloned in (+) are shifted respectively clone, constitute: P in the Ref of pLY1 gene downstream _RP _L-CII (SD)-Ref (Glu)-sANP1-T1T2 P _RP _L-CII (SD)-Ref (Glu)-sANP2-T1T2 P _RP _L-CII (SD)-Ref (Glu)-sANP3-T1T2 P _RP _L-CII (SD)-Ref (Glu)-sANP4-T1T2 transformed into escherichia coli DH5 α expresses through temperature control, the PAGE electrophoresis, and scanning detects, and 4 kinds of Expression of Fusion Protein all can reach about 50% total protein of cell.The amplification of embodiment 2 sANP1 genes

With AHQ (sequence is 5 ' GGGGTTCGTGCTCCGCGTTGCTCCGGTGGTCGTATC 3 ') and T7 (available from Promega company) is primer, utilize the clone that plasmid ply II-13 (this laboratory structure of sANP1 gene is arranged, the sANP1 gene that has cassette mutagenesis) is template, with add-on PCR method amplification sANP1 gene, wherein introduced Nucleotide joint (ad) among the primer AHQ corresponding to the zymoplasm recognition sequence, reaction volume is that 50 μ l are (comprising 0.6pmol/ μ l primer AHQ, 1pmol/ μ l T7 primer, 0.91 μ g ply II-13,5 μ l, 10 * damping fluid, 2 μ l dNTP, 3 μ l MgCl2,0.5 μ l Taq archaeal dna polymerase and 12.3 μ l tri-distilled waters), reactions steps be 94 ℃ 10 minutes, add 0.5 μ l TaqDNA polysaccharase and 20 μ l paraffin oils then, carried out 94 ℃ of 3 following circulations after 5 minutes 40 seconds, 53 ℃ 1 minute, 72 ℃ 1.5 minutes, then carried out 94 ℃ of 27 following circulations again 40 seconds, 53 ℃ 30 seconds, 72 ℃ 1 minute, be at last 72 ℃ 5 minutes, be stored to 4 ℃ up to being for further processing.Amplified production is carried out 1% agarose gel electrophoresis, is molecular weight marker with the pBR322/Hinf I, when purpose band 446bp to the appropriate location, reclaim this PCR product with low melting point agarose control piece.The PCR product that so obtains is digested with the BamH I, reclaim the fragment of 92bp, be the ad-sANP1 gene.Embodiment 3 contains the structure of the plasmid pAHQ1 of sANP1 gene

As shown in Figure 2, with Sma I and BamH I double digestion plasmid pBSsk, reclaim the carrier segments of 2960bp with low agarose control piece, the ad-sANP1 gene fragment that obtains among this carrier segments and the embodiment 1 is connected transformed into escherichia coli DH5 α competent cell afterwards.(Molecular Cloning-A Laboratory Manual, 2nd Edition) selects white colony with blue hickie complementary method, is inoculated in 5ml Amp+LB substratum, 37 ℃ of shaken overnight.Prepare plasmid DNA fast in a small amount with alkaline denaturation, and cut evaluation pAHQ1, filter out correct recon DH5 α/pAHQ1 with Hind III and BamH I, Sma I and BamH I enzyme.

Identify the correct a large amount of preparation of recon clone plasmid DNA with alkaline lysis from cutting through enzyme, with PEG precipitator method plasmid DNA purification, quantitatively after, check order according to ordinary method, sequencing result shows that the sequence of ad-sANP1 is correct.The clone of embodiment 4 IL-2a genes

(this laboratory makes up and preserves with IL-2/pBR322, contain the IL-2 gene) be template, primer is 5 ' AGCAGAATTCATATGGCACCTACTTCAAGTTCT 3 ' and 5 ' GGGAGTTGTGTTGAGATGATGC 3 ', go out gene with pcr amplification through the IL-2a of point mutation, reclaim the flush end PCR product fragment of 417bp, in following reaction system, this fragment is inserted in the sequencing vector pBSsk that Sma I enzyme is cut, described reaction system is 1 μ l pBSsk/Sma I, 2 μ l IL-2a pcr amplified fragments, 1 μ l T4 ligase enzyme, 1 μ l 10 * damping fluid and 5 μ l tri-distilled waters will connect mixture 12 ℃ of incubated overnight.To connect liquid transformed into escherichia coli DH5 α competent cell, and screen white colony with the α-Hu Bu method from the LB flat board, alkaline lysis extracts plasmid in a small amount.Cut primary dcreening operation with pVU II enzyme and go out to have 843bp in line and the segmental recon of 2519bp, cut evaluation with EcoR I enzyme again and obtain the recombinant plasmid that described IL-2a PCR fragment is inserted with two kinds of directions identical and different with the lacZ gene, called after IL-2ainp and IL-2a insert respectively ^-, see Fig. 3.IL-2ainp checks order with plasmid, confirms that it contains correct IL-2a gene.The difference of the polypeptide chain of natural IL2 and this IL-2a coded by said gene is: 100 Glu is sported Gly, and the 125th Cys is sported Ser, and the latter's C-terminal is connected to the zymoplasm recognition sequence of Gly-Val-Arg-Gly-Pro-Arg.Embodiment 5 contains the structure of the plasmid pAHQ2 of sANP1 and IL-2a fusion gene

As shown in Figure 4, cut the plasmid IL-2ainp that embodiment 4 obtains, reclaim the 408bp dna fragmentation that wherein contains the IL-2a gene with Sma I and EcoR I enzyme.Equally, the carrier pAHQ1 that contains the sANP1 gene that embodiment 3 is obtained cuts with Sma I and EcoR I enzyme, reclaims the carrier segments of 3034bp.Two kinds of fragments that obtain are connected, connect mixture transformed into escherichia coli DH5 α, prepare plasmid in a small amount, confirm to have obtained recombinant plasmid, this plasmid called after pAHQ2 through digestion with restriction enzyme.

Thus, realized IL-2a-adapter-sANP1 gene Fusion, described fusion gene called after DFP1 gene by the structure of pAHQ2.Embodiment 6 contains the structure of sANP1 and IL-2a fusion gene DFP1 expression carrier pAHQ3

As shown in Figure 5,, reclaim the fragment of the 494bp that contains IL-2a-sANP1, prepare target gene fragment thus with the plasmid pAHQ2 that Nde I and BamH I double digestion embodiment 5 obtain.Similarly,, reclaim the big fragment of 4887bp, prepare carrier segments, for following connection with Nde I and BamH I double digestion plasmid pLY I.

Adopt aforesaid condition of contact, IL-2a-sANP1 fragment and pLY I/Nde I+BamH I of 494bp is connected the recombinant vectors called after PAHQ3 that obtains.The structure of embodiment 7 efficient expression vector pAHQ5

As shown in Figure 6, for improving the expression level of fusion gene DFP1, adopt the following structure high-expression plasmid of subclone technology.Cut the carrier pAHQ3 of embodiment 6 with Nde I enzyme, reclaim fragment, in the presence of dNTP, mend flat Nde I breach with the Klenow enzyme.Then, use ethanol sedimentation DNA, connect into cyclic DNA again, the plasmid called after pAHQ5 that obtains thus.Mend for guaranteeing flat efficient, connect before the mixture transformed into escherichia coli again with Nde I enzyme and cut plasmid after the connection.By EcoRV and Sma I double digestion primary dcreening operation, identify that with Nde I and BamH I double digestion the Nde I restriction enzyme site of recombinant plasmid disappears again, the result conforms to design.

Handle by this subclone, increased the distance between SD sequence and the initiator codon, promptly increased by two couples of Nucleotide TA-AT between SD sequence and the ATG codon, thereby improved the protein expression level from the gene expression regulation aspect.Embodiment 8 has the structure of the plasmid pAHQ6 of two copy DFP1 Expression elements

As shown in Figure 7, plasmid pAHQ5 with EcoRV complete degestion embodiment 6 obtains is divided into two parts with reactant after enzyme is cut, and a copy of it is heated to 70 ℃ of 10 minutes deactivation EcoRV, ethanol sedimentation reclaims linearizing pAHQ5, uses CIP (Roll Phosphoric acid esterase) dephosphorylation to prevent that this plasmid is from connecting again.Another part cut with the SSPI enzyme, reclaims the fragment of the 2144bp that wherein contains DFP1 fusion gene and flanking sequence thereof.Then, the above-mentioned linear pAHQ5 dephosphorylation fragment for preparing is connected with this 2144bp fragment, obtains having the recombinant plasmid of two copy DFP1 Expression elements, called after pAHQ6.Cut this plasmid pAHQ6 with BamH I enzyme, if be the two copy of cis Expression element, then restriction enzyme mapping should show 2144bp and two fragments of 5383bp, if and trans two copy Expression element, then restriction enzyme mapping shows 2706bp and two fragments of 4821bp, and the result shows that having to the two copy of cis Expression element clones.With described recombinant expression vector transformed into escherichia coli DH5 α, the screening transformant, the bacillus coli DH 5 alpha/DFP1 that contains this plasmid is preserved in Chinese typical culture collection center on September 4th, 1996, and preserving number is CCTCC M 96016.The thermal induction of embodiment 9 DFP1 genes is expressed and SDS-PAGE detects

Expression vector pAHQ3, pAHQ5 that embodiment 6,7 and 8 is obtained and pAHQ6 transformed into escherichia coli DH5 α screen and obtain transformant respectively, respectively called after DH5 α/pAHQ3, DH5 α/pAHQ5 and DH5 α/pAHQ6.Three kinds of transformants are inoculated in respectively in the 5ml LB/Amp+ substratum and in 32 ℃ of shaking culture spend the night.Again transfer in 5 ml LB/Amp+ substratum with 2% inoculum size again and in 32 ℃ of shaking culture 3-4 hours, being warming up to 42 ℃ then cultivated 4-5 hour, centrifugal collection thalline, add SDA-PAGE load sample damping fluid in 95 ℃ of insulations 30 minutes, subsequently with 8000 rev/mins centrifugal 10 minutes, collect the usefulness of supernatant power backup swimming.Similarly, with not in contrast by three kinds of transformants of intensification inducing culture.

(example is seen Molecular Cloning A Laboratory Manual to SDS-PAGE according to ordinary method, 2nd Edition, Cold Spring Harbor Laboratory) carries out, dye with Xylene Brilliant Cyanine G R-250, the decolouring back uses Chromscan3 PhastGel scanner in the 626nm length scanning, the calculation expression protein content.The results are shown in Figure 8.Calculate through scanner scanning, the DFP1 expression amount of DH5 α/pAHQ3 is about 20% total protein of cell (not shown); The DFP1 expression amount of DH5 α/pAHQ5 is about 30%, the adjustable proteic expression of distance between prompting utilization subclone technological adjustment SD and the initiator codon, and this kind handled expressing quantity and improved 10%; And the DFP1 expression amounts with DH5 α/pAHQ6 of two copy Expression elements reach 39% of total protein of cell, and it is about 10% to improve expression amount again than DH5 α/pAHQ5, shows that multiple copied Expression element carrier construction method of the present invention produces a desired effect.The separation and the purifying of embodiment 10 DFP1 fusion roteins

Adopt New Brunswick Scientific high density fermentation system that transformant DH5 α/pAHQ5 is carried out high density fermentation, get 60 gram thalline, handle purifying DFP1 fusion rotein through following steps.The fragmentation of A cell and the dissolving of inclusion body (1) washing thalline and broken wall

Amount with the 10ml/g thalline adds 3%Triton X-100 and N,O-Diacetylmuramidase (1mg/ml), through Tris-HCl (pH7.0) dissolving, stirs evenly a few hours.The centrifugal thalline of 6000rpm 15 minutes adds lysate (50mMTris-HCl, pH8.5,2mM EDTA, 100mM NaCl, 0.5%Triton X-100) in bacterial precipitation., ultrasonic disruption cell to liquid does not have the thickness sense.Then 10000rpm is centrifugal 30 minutes, and supernatant discarded adds nuclease and corresponding damping fluid in precipitation, in 37 ℃ of insulations 1 hour, in 10000rpm centrifugal 30 minutes again, obtains the inclusion body precipitation.(2) washing of inclusion body

At first use 5%Triton X-100 agitator treating inclusion body 2 hours, in 10000rpm centrifugal 30 minutes, supernatant discarded.Use 50mM Tris-HCl then, the 2M Guanidinium hydrochloride, 10mM EDTA, 100mM NaCl washes secondary, washes secondary with the scavenging solution identical with above-mentioned scavenging solution except that the 4M Guanidinium hydrochloride again, till being precipitated to it and being scattered in the scavenging solution fully with ultrasonication during washing.(3) dissolving of inclusion body

Clean inclusion body 10mM Tris-HCl pH8.8,100mM NaCl, 2mM EDTA, 10mMDTT and 7M guanidine hydrochloride dissolution completely through above-mentioned steps.B Sephacryl S-200 chromatogram purification inclusion body protein

Column volume is 1.6cm * 100cm, and moving phase is the 6M Guanidinium hydrochloride, and 10mM Tris-HCl collects each eluting peak respectively, with peak, SDS-PAGE testing goal protein D FP1 place.The C protein renaturation

Dilute in advance with 6M Gdn and to make protein concn below 0.5mg/ml, use diluent (0.2M Tris-HCl pH8.8 again, 5mM EDTA, 4mM GSH+GSSG (molecular ratio is 9: 1), sucrose 1%) dilution makes the Gdn final concentration at 1M-1.5M, stirring at room renaturation 48 hours, Guanidinium hydrochloride is removed in dialysis, and protein is carried out quantitatively.D ultrafiltration and concentration protein

Using the molecular weight that dams after the renaturation is ultra-filtration membrane (the Milipore company product) protein concentrate of 10000D, operates in the ice bath and carries out.Embodiment 11 usefulness zymoplasms cutting DFP1 is to obtain sANP1

In zymoplasm: the ratio of protein=1: 20 is mixed zymoplasm with the DFP1 that embodiment 10 purifying obtain, buffer system is 20mM Tris-HCl pH7.0,10mM CaCl2, and 1% glycerine is cut in 28 ℃ of enzymes and to be spent the night.With the molecular weight that dams is ultra-filtration membrane (the Milipore company product) ultrafiltration of 5000D, filtered solution is sANP1 (2316D), upper strata liquid then is IL-2a (15519D), be the concentrated sANP1 of ultra-filtration membrane of 1000D again with the molecular weight that dams, after using radioimmunoassay method sANP1 concentration (500ng/ml) then and measuring IL-2a concentration with ELISA, conversion DFP1 concentration, DFP1 concentration is 125 μ g/ml as a result, the DFP1 output of amounting to every liter of fermented liquid is 252mg/L.What the physiologically active of embodiment 12 DFP1 and sANP1 was measured A DFP1 prevents and resists cancer metastasis and diffusion experiment

Lewis lung cancer portable knurl strain (basis institute of the Chinese Academy of Medical Sciences preserves the pathologic, physiologic chamber) is adopted in experiment, with 3.6 * 10 ⁶The amount of/0.2ml cell is given C57 mouse (basis institute of the Chinese Academy of Medical Sciences preserves the pathologic, physiologic chamber) back armpit subcutaneous vaccination, pneumoretroperitoneum medication in 72 hours, experiment is divided into three groups, every group of 15 mouse, these three groups is respectively positive controls (IL2), experimental group (DFP1) and negative control group (physiological saline, NS), be abdominal injection.The amount of per injection is, IL2 is 30,000 units, and DFP1 is equivalent to 30,000 units in IL2, the injection of physiological saline equal-volume.Limited because of dose, after continuous medication every day 10 times is adopted in experiment, the administration next day of changing into, administration is 14 times altogether, experimental observation 23 days, observation index comprises that knurl weight, knurl volume, lung shift, the surperficial tubercle number of lung.When death appears in the NS group, adopt the method for craning one to put to death and dissect animal, observations.Table 1 illustrates experimental result.

Heavy single tubercle gross tumor volume in the mid-term remarks cm of table 1 group lung rate of transform knurl ²Big NS 9,/10 10.33 ± 1.82 61 2.94 ± 0.87 tubercle notes not of uniform size of IL2 7,/12 9.0 ± 1.35 64 1.71 ± 0.98 tubercle DFP1 7,/11 9.9 ± 1.35 32 1.87 ± 0.62 tubercle not of uniform size: mouse lid not included in is stabbed internal organ because of abdominal injection and is caused that abdominal cavity hemorrhage is dead midway.

About the lung rate of transform, very few because of the radix of statistics, be difficult to determine the difference of IL2 and DFP1.

Found out that by above-mentioned table 1 interesting is single tubercle number, the DFP1 group is half of IL2 group, though the tubercle of DFP1 group is bigger.This perhaps can regard DFP1 as, and to resist cancer cells diffusion strong 1 times with the energy force rate IL2 that shifts, perhaps can 32 that the DFP1 group occurs be interpreted as than major tubercle, primary stage of inoculation shifts and comes from primary tumor under lung's DFP1 concentration situation on the low side, and to the middle and later periods, because of the DFP1 of lung concentration improves gradually and makes the IL2 on the DFP1 rest on lung for a long time to the combination of its acceptor because of sANP1, improved concentration, strengthened signal, the activate immunity phylactic power defensive power is effective, thereby prevents and resisted the transfer and the diffusion of cancer cells effectively.And the IL2 group, though the situation that lung's IL2 concentration increases progressively is identical with the DFP1 group, but IL2 is along with metabolic process is left lung soon, so that the concentration of the IL2 of lung be not enough to prevent and resist cancer cells just, in, in the late period whole process to the transfer and the diffusion of lung, also therefore occurred quantity not of uniform size many one times single tubercle.

In addition, experiment is this time also observed DFP1 group mouse diuresis and is become thin, and this phenomenon can be interpreted as the diuretic properties of the sANP1 on the DFP1, has eliminated the acute renal failure that IL2 may cause, becoming thin then is that tumour causes.On the contrary, observe IL2 group mouse oliguresis, increase fatly, this phenomenon can be interpreted as IL2 and cause the oliguresis acute renal failure, uroschesis, thereby increased body weight.The experimental result of relatively urinating of following IL2 and ANP, NS has been supported above-mentioned view.The diuretic activity experiment of B DFP1

Laboratory animal is adopted Wistar rat (Chinese Academy of Medical Sciences's medicine provides), weighs, and fasting in advance, prohibits water and adapts to the metabolic cage environment 1 hour, irritates with 1% salt solution (the 5ml/100g body weight makes the outer liquid increase of zooblast, with Simulated Water, sodium retention state).Begin administration after 10 minutes, carry out 4 groups of experiments altogether, be respectively DFP1 group, ANP group, physiological saline group and IL2 group, administering mode adopts abdominal injection 5 μ g/kg body weight, and concentration is 0.5 μ g/ml, and IL2 is by 35 μ g/kg body weight administrations.Irritated stomach in back 4 hours once more in feedwater, replenish 1% salt solution 2.5ml/100g, urine amount and the total volume of urine of 1,2,3,4,5,6,7 hours rats of record.Fig. 9 A shows on the different time point of experiment voided volume of the rat of different experiments group and tatol emiction quantity respectively with Fig. 9 B.

By Fig. 9 A and 9B as can be seen, always urinating of DFP1 heavily is 76ml, and ANP then be 70.25ml, and the former has arranged nearly 6ml than the latter more, and this is that the activity of the sANP1 among the DFP1 improves and total effect of transformation period prolongation.In addition, the voided volume of NS is 62.9ml, and IL2 only is 52.31ml, has lacked 10.59ml than physiological saline.The voided volume of IL2 only is a physiology brinish 83%.This results suggest IL2 has caused the oliguresis acute renal failure.In addition, adopt following formula to calculate the diuretic activity ratio:

For example calculate according to above-mentioned formula, the diuretic activity of DFP1 is (76-62.9)/(70.25-62.9)=1.8 with the ratio of the diuretic activity of ANP, the diuretic activity that is DFP1 is 1.8 times of ANP, the diuretic activity that calculates original sANP1 equally should be 2.9 times of ANP, it seems that the sANP1 in DFP1 goes to eliminate the caused oliguresis effect of IL2 among the DFP1 with about 1/3 diuretic activity.In the experiment, the voided volume of IL2 group only is 83% of a physiological saline group.It should be noted that 25 μ g IL2 (being approximately 2.5 ten thousand IL2/kg of unit) can cause the oliguresis acute renal failure, and in the experiment of DFP1, once having used wherein, IL2 is that 35 μ g/kg (being approximately 3.5 ten thousand units) not only do not see the oliguresis reaction, see diuresis (urinary volume increase) phenomenon (at this moment the sANP1 consumption among the DFP1 is 5 μ g/kg) on the contrary, prompting sANP1 has extremely strong diuretic activity.It is calculated that the voided volume of DFP1 is a physiology brinish 120%.The hypotensive effect experiment of C DFP1

Male Wistar rat is adopted in experiment, body weight is 291 ± 7g, amount injection Sodiumpentobarbital with 50mg/kg, to lead instrument (RM-6000 more, Japanese photoelectricity company product) measures arterial pressure and electrocardiogram(ECG, the disposable injection femoral vein of working sample, for ease of observing the hypotensive time length, variation and the electrocardio of taking the horizontal intubation way of anesthetized rat to measure blood pressure change.The sample that uses is respectively ANP, DFP1, IL2, and experimental result is as shown in table 2.

Table 2 DFP1 is to the impact of rat artery pressure and heart rate, (secondary experimental result) mean arterial pressure step-down step-down continues after the initial administration of heart rate μ g/kg after the active initial administration of time of difference %, (mmHg), (mmHg) multiple, (heartbeat/minute), (heartbeat/minute) ANP 10 97.5 91 6.5 6.6 17 316 300DFP1=135 120 15 11 2.3 30 400 42,9sA,NP1 10+IL2 70,IL2 70 135 127.5 7.5 5.5 1 30 333 300

As shown in table 2, the DFP1 that is equivalent to sANP1 in DFP1 and is 10 μ g/kg is after administration, make the mean blood pressure of rat reduce 15mmHg, and 10 μ g/kgANP of contrast only reduce 6.5mmHg, and the former is 30 minutes the time length, the latter only is 7 minutes, show that thus DFP1 is better than ANP (28 peptide) aspect step-down, it is calculated that, the antihypertensive activity of DFP1 is 2.3 times of ANP, and the time length is 4.3 times (seeing Table 2) of ANP.In addition, the electrocardiogram(ECG of following the tracks of in the blood pressure experimentation is presented at 70,000 units/when kg IL2 experimentizes, observe accidental ventricular premature contraction 3 times, and do not observe the not normal phenomenon of electrocardio when DFP1 tests.Embodiment 13 contains the structure of DFP3 fusion gene recombinant vectors

Referring to Figure 10, adopt method similar to Example 2, with the pHMseq plasmid that contains the ANP gene is template, with 5 ' GGGGTTCGTGGTCCGCGTTCTCTTCGTCGTTC 3 ' and pUC/M13 Reverse Primer (available from Promega company) respectively as the upstream and downstream primer, go out the Ref-Adaptor_of_Thrombin-ANP fragment by pcr amplification, after cutting with BamH I enzyme, be inserted between the Sma I and BamH I cloning site of pBSsk carrier, cut evaluation through blue hickie screening and enzyme, the recombinant plasmid called after pCW1 that obtains, construction step sees Figure 10 for details.The pCW1 plasmid is carried out dna sequencing, confirm the exactness of its nucleotide sequence.Then, cut pCW1 with BamH I and EcoR I enzyme, separation and purification obtains the 120bp fragment, and this fragment contains the Ref-Adaptor_of_Thrombin-ANP gene; Simultaneously, the pLY1 plasmid is cut back to close the 5373bp fragment with BamH I and EcoR I enzyme, described two fragments are connected, be built into the recombinant plasmid pCW111 of temperature-induced expression Ref-Adaptor_of_Thrombin fusion rotein with the T4 dna ligase.

Subsequently, with IL-2/pBR322 is template, with 5 ' AGCAGAATTCATATGGCACCTACTTCAAGTTCT 3 ' and 5 ' GGGAGTTAGTGTTGAGATGATGC 3 ' is primer, the nucleotide sequence that has change in the designed downstream primer, make that the Cys (125) of IL-2 becomes Ser in the PCR product, last C end has increased Pro (the Nucleotide password is CCC), goes out the IL-2 product of sudden change through pcr amplification.The PCR product cloning of this 417bp is gone into the Sma I site of pBSsk, the recombinant plasmid called after pCW2+ that obtains.Cut evaluation through blue hickie screening and enzyme, confirm the exactness of its nucleotide sequence then through dna sequencing.With Nde I and Sma I double digestion pCW2+, separation and purification obtains the 405bp fragment, and this fragment contains the IL-2 gene of constructed sudden change; In addition with Nde I and Sma I double digestion plasmid pCW111 and recovery 4994bp fragment wherein; Described two fragments are connected with the T4 dna ligase, and being built into temperature-induced expression IL-2a-Adaptor_of_Thrombin-ANP is the recombinant plasmid pCW120 of DFP3 fusion rotein.

After testing, recombinant plasmid pCW120 DFP3 Expression of Fusion Protein amount in e. coli host bacteria has only more than 20% of total protein of cell, therefore, for improving the expression level of goal gene, this plasmid is cut and linearizing with Nde I enzyme, mend flat terminal through the Klenow enzyme, use the cyclisation of T4 dna ligase again, the carrier called after pCW121 that makes up like this, like this, by between SD sequence and DFP3 promotor, having increased by 2 bases, make the level of its expressed fusion protein bring up to and account for 39% of total cell protein.

Be further to improve expression level, adopt the method for repeated cloning Expression element of the present invention, made up the recombinant plasmid that contains 2,3,4 copy Expression elements respectively, called after pCW122 successively, pCW123, pCW124.Concrete grammar is to cut pCW121 with EcoRV and SspI enzyme, reclaim 2256bp fragment (containing PL promotor, SD ribosome recognition sequence, fusion gene DFP3, T1T2 terminator sequence on it) wherein, this fragment is inserted the EcoRV site of pCW121 plasmid, obtain pCW122, with described recombinant expression vector transformed into escherichia coli DH5 α, the screening transformant, bacillus coli DH 5 alpha/the DFP3 that contains this plasmid is preserved in Chinese typical culture collection center on September 4th, 1996, and preserving number is CCTCCM 96017.Adopt and use the same method, make up and obtain recombinant plasmid pCW123 and pCW124.The thermal induction of embodiment 14 DFP3 genes is expressed and SDS-PAGE detects

Adopt embodiment 9 described methods, with the recombinant vectors pCW120 that embodiment 13 obtains, pCW121, pCW122, pCW123, pCW124 be transformed into escherichia coli DH5 α respectively, the screening transformant, transformant is expressed by temperature adjusting, and expression level is by SDS-PAGE, and Xylene Brilliant Cyanine G (R250) dyeing or silver dye, DFP3 accounts for 39% of total protein of cell respectively through laser intensity scanning analysis fusion rotein, 50%, 55%, 61%.See Figure 11.The purifying of embodiment 15 DFP3 fusion roteins

Utilization is as identical step as described in the embodiment 10, adopt New Brunswick Scientific high density fermentation system that transformant DH5 α/pCW122 is carried out high density fermentation, get thalline and carry out the fragmentation of cell and the dissolving of inclusion body successively, Sephacryl S-200 bag spectrum purifying inclusion body protein, protein renaturation, steps such as ultrafiltration and concentration protein obtain the fusion rotein DFP3 of purifying.Subsequently, as described in embodiment 11,, produce atrial natriuretic peptide 28 peptide ANP and have the interleukin-derivative I L-2a of zymoplasm recognition sequence with zymoplasm specificity cleavage of fusion proteins DFP3.With FPLC purifying target protein ANP, DFP3, carry out following biological activity assay.The biological activity determination of embodiment 16 DFP3 and ANP

With reference to the step of embodiment 12, the DFP3 fusion rotein that embodiment 15 purifying are obtained and carry out following biological activity assay through the product A NP of zymoplasm cutting.The diuretic activity experiment of A DFP3

Laboratory animal is adopted the Wistar rat, weighs, and fasting in advance, prohibits water and adapts to the metabolic cage environment 1 hour, irritates with 1% salt solution (the 5ml/100g body weight increases the outer liquid of zooblast, with Simulated Water, sodium retention state).Begin administration after 10 minutes, carry out 4 groups of experiments altogether, be respectively DFP1 group, standard A NP control group, physiological saline group and standard I L2 control group, administering mode adopts abdominal injection 5 μ g/kg body weight, and concentration is 0.5 μ g/ml, and IL2 is by 35 μ g/kg body weight administrations.Irritated stomach in back 4 hours once more in feedwater, replenish 1% salt solution 2.5ml/100g, record 1,2,3,4,5,6,7,8, urine amount and the total volume of urine of 9 hours rats.Figure 12 shows on the different time point of experiment, the tatol emiction quantity of the rat of different experiments group.As seen from Figure 12, DFP3 of the present invention has the equal significantly diuretic properties with standard A NP, and standard I L2 in contrast then obviously has the side effect that causes oliguresis.From 7 hours result, the voided volume of IL2 was a physiology brinish 85.7%, and the voided volume of DFP3 is a physiology brinish 113%.B is cut the diuretic activity experiment of the ANP that obtains through the zymoplasm enzyme by DFP3

Laboratory animal is adopted the Wistar rat, weighs, and fasting in advance, prohibits water and adapts to the metabolic cage environment 1 hour, irritates with 1% salt solution (the 5ml/100g body weight increases the outer liquid of zooblast, with Simulated Water, sodium retention state).Begin administration after 10 minutes, carry out 3 groups of experiments altogether, be respectively sample ANP group, standard A NP control group, physiological saline group, administering mode adopts abdominal injection 5 μ g/kg body weight, and concentration is 0.5 μ g/ ml.Record 1,2,3,4, urine amount and the total volume of urine of 5,6 hours rats.Figure 13 shows on the different time point of experiment, the voided volume of the rat of different experiments group.As seen from Figure 13, of the present inventionly cut the ANP that purifying obtains by the DFP3 enzyme and have equal significantly diuretic properties with standard A NP.The diastolic blood vessel activity experiment of C DFP3 and ANP

Earlier to go potassium suprarenin to make that (preparation method sees " pharmacological experimental methodology " the 2nd edition to isolated rat arteries bar; The People's Health Publisher) shrinks; Add quantitative medicine to be measured; Lead the contraction and the diastole of Physiological Experiment registering instrument (Sichuan instrucment and meter plant product; Model XWT-204) record vascular strip with two.Testing the vasodilator effect of DFP3 and ANP therefrom respectively; Is contrast with physiological saline and standard A NP (available from Sigma company) simultaneously; and Figure 14 A and 14B show the diastolic blood vessel activity of DFP3 and ANP sample respectively.As shown in the figure, DFP3 of the present invention and ANP sample have the equal significantly vasodilator effect with standard A NP.SEQ ID NO.1：：486bp：：：cDNA：：1-402bp2IL-2a 403-420bp 421-486bpsANP1：SEQ ID NO：1GCACCTACTT CAAGTTCTAC AAAGAAAACA CAGCTACAAC TGGAGCATTT ACTGCTGGAT 60TTACAGATGA TTTTGAATGG AATTAATAAT TACAAGAATC CCAAACTCAC CAGGATGCTC 120ACATTTAAGT TTTACATGCC CAAGAAGGCC ACAGAACTGA AACATCTTCA GTGTCTAGAA 180GAAGAACTCA AACCTCTGGA GGAAGTGCTA AATTTAGCTC AAAGCAAAAA CTTTCACTTA 240AGACCCAGGG ACTTAATCAG CAATATCAAC GTAATACTTC TGGAACTAAA GGGATCTGGA 300ACAACATTCA TGTGTGAATA TGCTGATGAG ACAGCAACCA TTGTAGAATT TCTGAACAGA 360TGGATTACCT TTTCTCAAAG CATCATCTCA ACACTAACTC CCGGGGTTCG TGGTCCGCGT 420TGCTCCGGTG GTCGTATCGA CCGTATCGGG GCTCAGTCTG GTCTTGGTTG CAACTCTTTC 480CGTTAC 486SEQ ID NO.2：：504bp：：：cDNA：：1-402bp2IL-2a 403-420bp 421-504bpANP：SEQ ID NO：2GCACCTACTT CAAGTTCTAC AAAGAAAACA CAGCTACAAC TGGAGCATTT ACTGCTGGAT 60TTACAGATGA TTTTGAATGG AATTAATAAT TACAAGAATC CCAAACTCAC CAGGATGCTC 120ACATTTAAGT TTTACATGCC CAAGAAGGCC ACAGAACTGA AACATCTTCA GTGTCTAGAA 180GAAGAACTCA AACCTCTGGA GGAAGTGCTA AATTTAGCTC AAAGCAAAAA CTTTCACTTA 240AGACCCAGGG ACTTAATCAG CAATATCAAC GTAATAGTTC TGGAACTAAA GGGATCTGGA 300ACAACATTCA TGTGTGAATA TGCTGATGAG ACAGCAACCA TTGTAGAATT TCTGAACAGA 360TGGATTACCT TTTCTCAAAG CATCATCTCA ACACTAACTC CCGGGGTTCG TGGTCCGCGT 420TCTCTTCGTC GTTCTTCTTG CTTCGGTGGT CGTATGGACC GTATCGGGGC TCAGTCTGGT 480CTTGGTTGCA ACTCTTTCCG TTAC 504SEQ ID NO.3：：162：：：：：1-1342IL-2a 135-140 141-162sANP1：SEQ ID NO.3Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His 5 10 15Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys 20 25 30Asn Pro Lys Leu Thr Arg Met Leu Thr Phe Lys Phe Tyr Met Pro Lys 35 40 45Lys Ala Thr Glu Leu Lys His Leu Gln Cys Leu Glu Glu Glu Leu Lys 50 55 60Pro Leu Glu Glu Val Leu Asn Leu Ala Gln Ser Lys Asn Phe His Leu 65 70 75 80Arg Pro Arg Asp Leu Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu 85 90 95Lys Gly Ser Gly Thr Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala 100 105 110Thr Ile Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Ser Gln Ser Ile 115 120 125Ile Ser Thr Leu Thr Pro Gly Val Arg Gly Pro Arg Cys Ser Gly Gly 130 135 140Arg Ile Asp Arg Ile Gly Ala Gln Ser Gly Leu Gly Cys Asn Ser Phe145 150 155 160Arg TyrSEQ ID NO.4：：168：：：：：1-1342IL-2a 135-140 141-168ANP：SEQ ID NO.4Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His 5 10 15Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys 20 25 30Asn Pro Lys Leu Thr Arg Met Leu Thr Phe Lys Phe Tyr Met Pro Lys 35 40 45Lys Ala Thr Glu Leu Lys His Leu Gln Cys Leu Glu Glu Glu Leu Lys 50 55 60Pro Leu Glu Glu Val Leu Asn Leu Ala Gln Ser Lys Asn Phe His Leu 65 70 75 80Arg Pro Arg Asp Leu Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu 85 90 95Lys Gly Ser Gly Thr Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala 100 105 110Thr Ile Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Ser Gln Ser Ile 115 120 125Ile Ser Thr Leu Thr Pro Gly Val Arg Gly Pro Arg Ser Leu Arg Arg 130 135 140Ser Ser Cys Phe Gly Gly Arg Met Asp Arg Ile Gly Ala Gln Ser Gly145 150 155 160Leu Gly Cys Asn Ser Phe Arg Tyr 165SEQ ID NO.5：：28：：：：：ANP：SEQ ID NO.5Ser Leu Arg Arg Ser Ser Cys Phe Gly Gly Arg Met Asp Arg Ile Gly1 5 10 15Ala Gln Ser Gly Leu Gly Cys Asn Ser Phe Arg Tyr 20 25

Claims (16)

1, fusion gene, it comprise from 5 '-3 ' be followed successively by the nucleotide sequence of coding human interleukin-12 derivative I L-2a, corresponding to the Nucleotide joint of endopeptidase recognition sequence and the nucleotide sequence of coding SANP1 sANP1, wherein said human interleukin-12 derivative I L-2a has the sequence of the 1-420 position Nucleotide of SEQ IDNO:1, and described SANP1 sANP1 has the sequence of the 421-486 position Nucleotide of SEQ IDNO:1.

2, fusion gene as claimed in claim 1, wherein said endopeptidase recognition sequence are zymoplasm recognition sequence Gly-Val-Arg-Gly-Pro-Arg.

3, fusion gene as claimed in claim 1, it is characterized in that from 5 '-3 ' be followed successively by the nucleotide sequence of coding human interleukin-12 derivative I L-2a, corresponding to the Nucleotide joint of zymoplasm recognition sequence and the nucleotide sequence of coding SANP1 sANP1, its nucleotides sequence is classified SEQ ID NO:1 as.

4, the fusion rotein of encoding by the fusion gene of claim 1.

5, fusion rotein as claimed in claim 4 is held to C end from N to be followed successively by human interleukin-12 derivative I L-2a and SANP1 sANP1, and the aminoacid sequence of described fusion rotein is SEQ IDNO:3.

6, as claim 4 or 5 described fusion roteins, wherein said human interleukin-12 derivative I L-2a is that product and its C end that Serine obtains is connected with zymoplasm recognition sequence Gly-Val-Arg-Gly-Pro-Arg for the natural human interleukin II is sported glycine, the 125th amino acids from N end the 100th amino acids by L-glutamic acid by cysteine mutation.

7, fusion rotein as claimed in claim 4, wherein said SANP1 sANP1 holds 1-6 amino acids Ser-Leu-Arg-Arg-Ser-Ser for excision natural human atrial natriuretic peptide N and the 8th amino acids is sported Serine, the 12nd amino acids is sported 22 peptide prods that Isoleucine obtains by methionine(Met) by phenylalanine.

8, the product SANP1 sANP1 that obtains after endopeptidase cutting of the fusion rotein of claim 4 is characterized in that it is 22 peptide prods, and has the sequence of 141-162 amino acids of the fusion rotein aminoacid sequence of SEQ ID NO:3.

9, the efficient expression vector that comprises each described fusion gene of claim 1-3.

10, expression vector as claimed in claim 9, it is eucaryon or prokaryotic expression carrier.

11, use the genetically engineered host of expression vector of claim 10.

12, host as claimed in claim 11, it is eukaryote or prokaryotic organism.

13, host as claimed in claim 12, it is bacillus coli DH 5 alpha/DFP1, and this bacterial strain is preserved in Chinese typical culture collection center on September 4th, 1996, and preserving number is CCTCC M96013.

14, prevent and resist application in the medicine that carcinoma in situ shifts as claim 4 or 5 described fusion roteins in preparation.

15, application as claimed in claim 14, wherein said carcinoma in situ are shifted and are comprised and be transferred to lung, kidney, liver or testis.

16, the application in the medicine of antitumor anti-simultaneously oliguresis renal failure of preparation and anti-heart failure as claim 4 or 5 described fusion roteins.

Images