CN106191069B - A kind of aptamer sequence and its application identified and combine human TfR - Google Patents
A kind of aptamer sequence and its application identified and combine human TfR Download PDFInfo
- Publication number
- CN106191069B CN106191069B CN201610555387.6A CN201610555387A CN106191069B CN 106191069 B CN106191069 B CN 106191069B CN 201610555387 A CN201610555387 A CN 201610555387A CN 106191069 B CN106191069 B CN 106191069B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- cell
- tfr
- sequence
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70582—CD71
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of identification and the aptamer sequences and its application of combination human TfR.Aptamer and its derivative of the invention can be applied in the kit of identification TfR height expression tumour or preparation detection TfR height expression tumour, molecular probe, targeting medium, and in the application for the nucleic acid probe for designing and preparing detection TfR.Aptamer of the invention have many advantages, such as affinity more higher than prior art and specificity, non-immunogenicity, can chemical synthesis, molecular weight it is small, it is stables, be easy to preservation and label.
Description
Technical field
The invention belongs to biochemical analysis technical fields, and in particular to a kind of nucleic acid identified and combine human TfR
Aptamer sequence and its application.
Background technique
TfR (transferrin receptor (TfR), be called CD71) is that one kind is widely present in animal
Transmembrane glycoprotein in cell, it is a kind of II type homodimer glycoprotein (180kDa), by extracellular region, transmembrane region and intracellular
Area's three parts composition, major function are that the transdermal delivery and endocytosis for mediating ferro element by acting on transferrins absorb.
Ferro element participates in multiple lifes such as transmitting of electronics in synthesis, cell Proliferation, immunological regulation and the intracellular respiratory chain of intracellular DNA
Reason process.Demand of the height of the expression quantity of TfR with cell to ferro element is closely related.TfR exists
Expressed on normal cell it is very low, be metabolized cell vigorous and that need a large amount of ferro elements and tissue such as to divide vigorous epithelium substrate thin
The all high expression TfR such as born of the same parents, blood-brain barrier.The study found that most of tumour cells for example colon cancer, gastric cancer, liver cancer,
All height expression TfRs such as cervical carcinoma, breast cancer, hematological system tumor and nasopharyngeal carcinoma；Malignant tumour prognosis is poor
It is related with Expression of Transferrin Receptor raising；Therefore, the detection of TfR facilitates the identification and early diagnosis of tumour.
Since TfR is in the transmembrane transport approach transfer efficiency height that tumor cell surface height is expressed and it is mediated, targeting
It is good, therefore it is widely studied and applies in the targeting diagnosis of tumour and treatment.Meanwhile the transferrins of cell surface by
The extracellular region of body can serine protease hydrolysis be discharged into serum, this soluble transferrin receptor (sTfR) exists
Usually exist in the form of compound from different transferrins in serum；The increase that sTfR can be caused to synthesize when asiderosis is surveyed
Determine the diagnosis that sTfR can clinically be used for hypoferric anemia as specific detection index.Therefore detection TfR pair
It is of great significance in the diagnosis of disease.The method that predominantly detects of TfR is enzyme-linked immunization absorption method at present, but
Its complex steps, time-consuming, big, the Yi Fasheng cross reaction of expensive, antibody activity batch wise differences etc.；Therefore a kind of letter is constructed
Just, economic, intuitive and special human TfR detection method has application prospect in terms of clinical diagnosis and treatment.
Aptamer (aptamer) is one section of single strain oligonucleotide by 10~150 base compositions, it high can be combined
Power, highly selective identification a certain kind or certain a kind of ligand molecular are referred to as " the chemically synthesized antibody of energy " (chemical
antibody).Aptamer can be DNA, RNA, peptide nucleic acid or other nucleic acid by chemical modification；Since nucleic acid can be by model
The intermolecular interactions such as De Huali, hydrogen bond, electrostatic interaction and hydrophobic effect form different three-dimensional structures, as hair fastener, false knot,
The structures such as tetra- serobila of G-, therefore aptamer can be realized the combination with target substance high-affinity, high specific.Screening
It is called index concentration Fas lignand system evolution (Systematic with the technology of the aptamer of efficient, the single-minded combination of target substance
Evolution of Ligands by EXponential enrichment, SELEX) technology.The core that SELEX technology is screened
The target substance of sour aptamer is in extensive range, including inorganic metal ion, small organic molecule, large biological molecule and virus, thin
Bacterium, cell and histotomy etc. have reported hundreds of aptamers so far.
The aptamer and monoclonal antibody for the complicated target such as living cells and tissue can be filtered out using SELEX technology
With similar identification function, but compared with monoclonal antibody, have the advantages that
(1) it screens in vitro, without immune animal or cell；
(2) hypotoxicity or immunogenicity, good water solubility can large dosage of venae subcutaneae injection or lesion injection；
(3) a large amount of chemical synthesis preparations can be carried out, differences between batches are small；
(4) it is easy to structure of modification, modification, label or immobilization, increases stability in serum；
(5) stability is good, easy to maintain and transport；
(6) molecular weight is small, generally in 4-50KD.
Based on above-mentioned advantage, aptamer is as novel bionical recognition element, in disease diagnosis and therapy, drug sieve
The various fields such as choosing, molecular recognition and analysis detection are widely used.
Summary of the invention
It is an object of the present invention to provide a kind of aptamers.
Aptamer provided by the invention is following A) or B):
A) single strand dna shown in sequence 1；
B) remove A) shown in nucleotide sequence to rise from 5 ' the 1st nucleotide in end include 5 ' holding first nucleotide residue
1-20 nucleotide, and remove the A) shown in nucleotide sequence to rise from 3 ' the 1st nucleotide in end include 3 ' holding first core
10-20 nucleotide of thuja acid residue, the aptamer of the nucleotide residue composition of reservation.
In above-mentioned aptamer, aptamer shown in B is following 1) -5) in it is any:
1) single strand dna shown in sequence 2；
2) single strand dna shown in sequence 6；
3) single strand dna shown in sequence 5；
4) single strand dna shown in sequence 4；
5) single strand dna shown in sequence 3.
It is a further object to provide the derivatives of above-mentioned aptamer.
The derivative of above-mentioned aptamer provided by the invention is any in following (1)-(6):
(1) above-mentioned aptamer is deleted to or increased one or several nucleotide, obtains that there is phase with the aptamer
The derivative of the aptamer of congenerous；
(2) above-mentioned aptamer progress nucleotide is replaced or modification, obtains that there is identical function with the aptamer
Aptamer derivative；
(3) it transform the skeleton of above-mentioned aptamer as phosphorothioate ester skeleton, obtains that there is phase with the aptamer
The derivative of the aptamer of congenerous；
(4) RNA molecule encoded by above-mentioned aptamer obtains suitable with aptamer nucleic acid with the same function
The derivative of body；
(5) peptide nucleic acid encoded by above-mentioned aptamer obtains suitable with aptamer nucleic acid with the same function
The derivative of body；
(6) one end of above-mentioned aptamer or centre are connected into signaling molecule and/or bioactive molecule and/or functional group,
Obtain the derivative with aptamer aptamer with the same function.
It is described to be modified to phosphorylation, methylation, amination, sulfhydrylation or isotopologue in said derivative；The function
Group is fluorophor, biotin group, radioactive substance, therapeutic substance, digoxin, nano luminescent material or enzyme label.
In said derivative, the derivative of the aptamer is that 5 ' end labels of the aptamer shown in sequence 2 are glimmering
The derivative of the aptamer obtained after light element group or cyanine dye group or biotin group.
It is a still further object of the present invention to provide a kind of aptamer probes.
Aptamer probe provided by the invention is that above-mentioned aptamer or said derivative are supported on polyethylene glycol to repair
On the graphene oxide of decorations, aptamer probe is obtained.
In above-mentioned aptamer probe, the aptamer or the derivative and polyethyleneglycol modified graphene oxide
Proportion be 1nmol:150mg.
In above-mentioned aptamer probe, the probe is prepared as follows: the aptamer that fluorophor is marked
Derivative, polyethyleneglycol modified graphene oxide and buffer mix, and are incubated for, obtain aptamer probe.
It is the nucleic acid aptamer derivative of fluorophor label, described polyethyleneglycol modified in above-mentioned aptamer probe
Graphene oxide and buffer proportion be 1nmol:150mg:1L.
In above-mentioned aptamer probe, the nucleic acid aptamer derivative of the fluorophor label is the core shown in sequence 2
The derivative of the aptamer obtained behind 5 ' ends mark fluorescent element group (6-FAM) of sour aptamer.
In above-mentioned aptamer probe, the solvent of the buffer is water, and solute and its concentration in buffer are
10mM Tris-HCl, 150mM NaCl, 5mM KCl and 2mM MgCl2。
In above-mentioned aptamer probe, in the polyethyleneglycol modified graphene oxide, polyethylene glycol is in graphite oxide
The grafting amount on alkene surface is 51%.
In above-mentioned aptamer probe, the polyethyleneglycol modified graphene oxide specific will be the preparation method is as follows: will
Graphene oxide ultrasonic disperse in dimethylformamide, obtains dispersion liquid；By ultrasound 10min in polyethylene glycol and dispersion liquid,
A certain amount of DCC/DMAP (DCC and DMAP the mass ratio of the material be 5:1) is added as catalyst, after ultrasonic 30min, at 60 DEG C
12h is reacted, dispersion liquid is dialysed 1 week in bag filter, removes free PEG and catalyst, after freeze-dried, obtains poly- second
The graphene oxide of glycol modification.
Final object of the present invention is to provide the derivative or above-mentioned core of above-mentioned aptamer or above-mentioned aptamer
The new application of sour aptamer probe.
The present invention provides the derivatives or above-mentioned aptamer probe of above-mentioned aptamer or above-mentioned aptamer such as
Under application at least one of (B1)-(B10):
(B1) identify or assist in identifying TfR；
(B2) combination or secondary combined TfR；
(B3) detect or assist whether to contain TfR in detection sample to be tested；
(B4) preparation detection or auxiliary detection sample to be tested in whether the product containing TfR；
(B5) detect or assist TfR content in detection sample to be tested；
(B6) preparation detection or auxiliary detect the product of TfR content in sample to be tested；
(B7) detect or assist the tumour or tumour cell of detection expression TfR；
(B8) product of the tumour or tumour cell of preparation detection or auxiliary detection expression TfR；
(B9) identify or assist in identifying tumour or tumour cell；The tumour is breast cancer and/or prostate cancer；
(B10) combination or secondary combined tumour or tumour cell.
In above-mentioned application, the sample to be tested is cell；The cell is specially that the human colon cancer cell of resistance to taxol, people are resistance to
Taxol lung carcinoma cell, human colon cancer cell, human cervical carcinoma cell, breast cancer cell or liver cancer cells.
In above-mentioned application, the tumour or tumour cell of the expression TfR are that Expression of Transferrin Receptor is high
Tumour or tumour cell.
In above-mentioned application, the product is kit or probe or targeting substance.
Compared with the prior art, the advantages of the present invention are as follows: the present invention has high parent by the aptamer that screening obtains
And power；Non-immunogenicity；Can iii vitro chemical synthesis, molecular weight is small, different parts can be modified and be replaced, and sequence
Stablize, is easy to save；Convenient for label (secondary antibody for not needing label) etc..Using aptamer detection transferrins of the invention by
When body, operation is more simple, rapid, and the synthesis cost of aptamer of the present invention is at low cost compared with Antibody preparation, and the period is short, weight
Existing property is good.
By detailed description below and the appended claims by other feature and embodiment more clearly of the invention.
Detailed description of the invention
Fig. 1 is the enrichment process for increasing aptamer in embodiment 1 with number of screening round.Peak-shaped curve indicates the knot of resistance to taxol
The cell fluorescence distribution situation of colon-cancer cell HCT-8T；Blanc cell as control, the colon cancer cell of resistance to taxol HCT-8T with
The nucleic acid library of fluorescein (FAM) label, the combination situation of start library, the 1st wheel, the 3rd wheel, the 6th wheel, the 9th wheel and 11th round.
Fig. 2 is 2 amplifying nucleic acid aptamer 2 of embodiment, aptamer 3, aptamer 4 to the colon cancer cell of resistance to Japanese yew HCT-8T's
Binding curve.
Fig. 3 is that Transferrin Receptor Antibody (anti-CD71) and aptamer 2 contaminate more plants of tumour cells altogether in embodiment 4
Flow cytometry experiments result.
Fig. 4 is Transferrin Receptor Antibody in embodiment 5 after siRNA interference HeLa cell expression TfR
(anti-CD71) and aptamer 2 is to the Flow cytometry experiments result of HeLa cell dyeing.
Fig. 5 is that 6 amplifying nucleic acid aptamer 2 of embodiment and control sequence are sliced fluorescent staining to prostate cancer cancerous tissue.
Fig. 6 is that 6 amplifying nucleic acid aptamer 2 of embodiment contaminates hyperplasia of prostate normal galactophore tissue and breast tumor tissue sections fluorescence
Color.
Fig. 7 is linear relationship of the 7 amplifying nucleic acid aptamer probe of embodiment to the fluorescence response of various concentration TfR.
Fig. 8 is the specificity that 7 amplifying nucleic acid aptamer probe of embodiment responds TfR.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Nucleic acid sequence in following embodiments is synthesized by Shanghai Sheng Gong bioengineering joint-stock company.
Human Placental Ferritin Receptor antibody (anti-CD71 (3B8 2A1)) in following embodiments is the production of ANTA CRUZ company
Product, catalog number sc-32272.
Antibody morphism in following embodiments compares (normal mouse IgG1) be ANTA CRUZ company product, produce
Product catalog number (Cat.No.) is sc-3877.
The secondary antibody (rabbit anti-mouse IgG-PE) of phycoerythrin modification in following embodiments is ANTA CRUZ
The product of company, catalog number sc-358926.
Human transferrin in following embodiments is the product of Sigma-Aldrich company, catalog number T-4132.
Recombination human TfR in following embodiments is the product of Sigma-Aldrich company, catalog number
For SRP6299.
Combination buffer (pH=7.4) in following embodiments: NaCl containing 137mM, 5mM MgCl2、2.7mM KCl、
2mM KH2PO4、10mM Na2HPO4, 25mM glucose, 1 μ g/ml BSA, 0.1 μ g/ml herring sperm dna and 0.01% (v/v) are spat
Temperature -80.
Washing buffer (pH=8.0) in following embodiments: NaCl containing 137mM, 5mM MgCl2、2.7mM KCl、
2mM KH2PO4、10mM Na2HPO4With 25mM glucose.
Probe buffer (pH7.4) in following embodiments: Tris-HCl containing 10mM, 150mM NaCl, 5mM KCl and
2mM MgCl2, other is water.
Dicyclohexylcarbodiimide (DCC) in following embodiments is the product in Bellingwell company, catalog number:
36650；4-dimethylaminopyridine (DMAP) is the product in Bellingwell company, catalog number: 117147.
The screening and preparation of embodiment 1, aptamer
One, the culture of the colon cancer cell of resistance to taxol and responsive type colon cancer cell
1, the culture for the colon cancer cell of resistance to taxol
The colon cancer cell of resistance to taxol (HCT-8T) (being purchased from Jiangsu Kai Ji biotechnology joint-stock company (Nanjing)) addition
RPMI 1640 (containing 10% fetal calf serum, 1% blueness/streptomysin) culture of 0.1 μ g/mL taxol, is inoculated into before use and is not added with
A generation is cultivated in the RPMI 1640 (containing 10% fetal calf serum, 1% blueness/streptomysin) of taxol.
2, the culture of responsive type colon cancer cell
Responsive type colon cancer cell (HCT-8) (being purchased from Jiangsu Kai Ji biotechnology joint-stock company (Nanjing)) uses RPMI1640
(containing 10% fetal calf serum, 1% blueness/streptomysin) culture.
Above-mentioned all cells in the incubator carry out routine culture (37 DEG C, 5%CO2), passage in every two days is primary.
Two, the design of random nucleic acid library
Designing following both ends includes 20 fixed nucleotides, the intermediate random library including 30 nucleotide: 5'-
AAGGAGCAGCGTGGAGGATA-N30-TTAGGGTGTGTCGTCGTGGT-3'；Wherein, N30Represent 30 A, T, C or G with
Machine nucleotide sequence.
Three, the screening of aptamer
1, library pre-processes
18nmol random nucleic acid library (synthesizing in step 2) is dissolved in combination buffer, 95 DEG C of denaturation 5min are cold on ice
But 10min, room temperature renaturation place 30min, obtain the pretreated library ssDNA.
2, counter-selection
Before 2-11 wheel is incubated for the colon cancer cell of resistance to taxol HCT-8T, a ware responsive type colon cancer cell HCT- is taken
8, the pretreated library ssDNA (as screening pressure increases and reducing amount of DNA) is added in cell, 4 DEG C of oscillation incubation 1h (with
Number of screening round increases and gradually increases incubation time).
3, positive sieve
Counter-selection process is obtained into supernatant and the ware colon cancer cell of a resistance to taxol HCT-8T at 4 DEG C one section of oscillation incubation
Between (with number of screening round increase and gradually decrease incubation time).After cleaning cell several times with combination buffer again, cell scraper is used
Knife scrapes off cell, adds 200 μ L water in 95 DEG C of heating 5min, elution of bound is on the colon cancer cell of resistance to taxol HCT-8T
ssDNA.Then the ssDNA eluted is subjected to PCR amplification.The primer of PCR amplification are as follows:
5'-FAM-AAGGAGCAGCGTGGAGGATA-3'；
5'-Biotin-ACCACGACGACACACCCTAA-3'。
PCR amplification program: 94 DEG C of 3min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 10 circulations；72 DEG C, 5min.
With single stranded DNA (ssDNA) sequence of Streptavidin agar sugar ball isolated FAM label from PCR product.It will
Obtained ssDNA NAP-5 pillar (General Electric's Medical Group, Sweden) desalination, vacuum drying, the screening for next round.
In order to improve the affinity and specificity of aptamer, it is stepped up washing times in screening process, reduces just
Sieve cell HCT-8T and the cell quantity for increasing counter-selection cell HCT-8, to increase the pressure of screening.After 11 wheel screenings, with sieve
Selecting product is that template passes through primer (5'-ACGCTCGGATGCCACTACAG-3' and 5'-GTCACCAGCACGTCCATGAG-3')
PCR amplification is carried out, 11th round PCR product is sequenced.The aptamer 1 of final choice is as follows:
5'-AAGGAGCAGCGTGGAGGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCCTTA
GGGTGTGTCGTCGTGGT-3'(sequence 1).
Aptamer is with the enrichment process of number of screening round as shown in Figure 1, in conjunction with taxol colon cancer cell HCT-8T
Nucleotides sequence has just obtained obvious enrichment when being listed in the 1st wheel, and after gradually pressurizeing, binding sequence is taken turns in the 3rd wheel and the 6th into one
Step is enriched with, and binding capacity slightly reduces when screening 11th round, this may be excessive related with screening pressure.
4, the optimization of aptamer
The aptamer that step 3 obtains is longer, after structural analysis, designs and synthesizes a series of through truncated nucleic acid sequence
Column, are modified by fluorescent dye, then investigate the binding ability of they and the colon cancer cell of resistance to taxol HCT-8T, select combination
For the strongest sequence of ability for further applying, the sequence length after optimization only has 35-59 nucleotide.
Finally obtained truncation aptamer sequence is as follows:
Aptamer 2:
5 '-AGGAGCAGCGTGGAGGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCCTTAG GGTGTG-3 ' (sequences
Column 2)；Aptamer 2 is that aptamer 1 is cut off 1 nucleotide from 5 ' ends, cuts off 10 nucleotide from 3 ' ends, and protect
Hold the constant obtained nucleotide sequence of other sequences of aptamer 1.
Aptamer 3:
5 '-AGGAGCAGCGTGGAGGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCC-3 ' (sequence 3)；Nucleic acid is suitable
Body 3 is that aptamer 1 is cut off 1 nucleotide from 5 ' ends, cuts off 20 nucleotide from 3 ' ends, and keep aptamer 1
The constant obtained nucleotide sequence of other sequences.
Aptamer 4:
5’-GTGGAGGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCCTTAGGGTGTG-3’
(sequence 4)；Aptamer 4 is that aptamer 1 is cut off 10 nucleotide from 5 ' ends, cuts off 10 from 3 ' ends
Nucleotide, and keep the constant obtained nucleotide sequence of other sequences of aptamer 1.
Aptamer 5:
5 '-GTGGAGGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCC-3 ' (sequence 5)；Aptamer 5 is by core
Sour aptamer 1 cuts off 10 nucleotide from 5 ' ends, cuts off 20 nucleotide from 3 ' ends, and keep other sequences of aptamer 1
Arrange constant obtained nucleotide sequence.
Aptamer 6:
5 '-GGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCC-3 ' (sequence 6)；Aptamer 6 is to fit nucleic acid
Body 1 cuts off 15 nucleotide from 5 ' ends, cuts off 20 nucleotide from 3 ' ends, and keep the other sequences of aptamer 1 not
The nucleotide sequence become.
Known to the optimum results (whether there is or not results), aptamer 6 and cell combination affinity is most strong, fluorescence intensity highest；
Followed by aptamer 5 is then aptamer 2, aptamer 4 and aptamer from arranging from high to low successively in conjunction with effect
3。
The binding ability of embodiment 2, aptamer and the colon cancer cell of resistance to taxol HCT-8T
Aptamer 2, aptamer 3, aptamer 4, aptamer 5 and the aptamer 6 that embodiment 1 is obtained respectively
In 5 ' plain (FAM) molecules of end mark fluorescent, FAM labeling nucleic acid aptamer 2, FAM labeling nucleic acid aptamer 3, FAM label core are respectively obtained
Sour aptamer 4, FAM labeling nucleic acid aptamer 5 and FAM labeling nucleic acid aptamer 6 (Shanghai Sangon Biotech Company's synthesis).It is dissolved with combination buffer
Each single stranded DNA (FAM marker DNA sequence), after UV absorption calibration concentration, 95 DEG C of heating 5min place 10min on ice,
It is placed at room temperature for 30min.DNA after denaturation-repeatability is diluted to 1nmol/L, 2nmol/L, 5nmol/L with combination buffer,
(molecular probe is molten for the DNA solution of 10nmol/L, 20nmol/L, 50nmol/L, 100nmol/L and 200nmol/L concentration gradient
Liquid).The colon cancer cell of resistance to taxol for taking a ware logarithmic growth phase is put down after being digested to monodisperse cell suspension with 0.2%EDTA
Several pieces are divided into, after being incubated for 30min on ice with above-mentioned molecular probe solution respectively, are washed twice with washing buffer, are used
The fluorescence intensity of the FACSCalibur flow cytometer measurement cell surface of BD company.With cell surface average fluorescent strength and
The mapping of aptamer concentration, the equilibrium dissociation constant of aptamer is calculated using formula Y=BmaxX (Kd+X).
Aptamer 2, aptamer 3, aptamer 4, aptamer 5 and aptamer 6 are thin to resistance to taxol colon cancer
The binding curve of born of the same parents HCT-8T is as shown in Figure 2.In Fig. 2, abscissa is Single stranded DNA concentration (nmol/L), and ordinate is that button is gone carefully
Average fluorescent strength after born of the same parents' autofluorescence value.The equilibrium dissociation constant of above-mentioned aptamer 2-6 is as shown in table 1.The result shows that
Aptamer 2, aptamer 3, aptamer 4, aptamer 5 and aptamer 6 equilibrium dissociation constant in nanomole grade,
Affinity is higher.
The equilibrium dissociation constant of table 1, aptamer 2-6
| Title | In conjunction with dissociation constant (nmol/L) |
| Aptamer 2 | 6.48±1.12 |
| Aptamer 3 | 19.5±3.17 |
| Aptamer 4 | 5.42±1.04 |
| Aptamer 5 | 6.76±1.67 |
| Aptamer 6 | 5.40±0.721 |
Embodiment 3,2 specific recognition of aptamer and the Mass Spectrometric Identification for combining TfR
One, the preparation of 2 derivative of the Jurkat E6-1 cell of isotope labelling and aptamer
1, the preparation of the Jurkat E6-1 cell of isotope labelling
Jurkat E6-1 cell (Academy of Medical Sciences Institute of Basic Medical Sciences (Beijing)) use of heavy isotope labelling contains
Heavy isotope labelling lysine ([13C6,15N2]-L-lysine) and heavy isotope labelling arginine ([13C6]-L- essence
Propylhomoserin) RPMI 1640 culture medium culture；The Jurkat E6-1 cell of light-duty isotope labelling, which uses, contains light-duty isotope
Label lysine ([12C6,14N2]-L-lysine) and light-duty isotope labelling arginine ([12C6]-L-arginine) PMI
1640 culture medium (Thermo company, culture medium article No.: 89982).Cell 6-7 is cultivated for rear spare.
2, the preparation of 2 derivative of aptamer
(1) aptamer 2 of biotin labeling
The aptamer 2 of biotin labeling is to hold couple biotin groups to obtain the 5 ' of aptamer 2, slow with combining
Fliud flushing dissolves the aptamer 2 of biotin labeling, after UV absorption calibration concentration (100nM), 95 DEG C of heating 5min, on ice
5min is placed, 15min is placed at room temperature for.
(2) the control nucleic acid sequence L45 (L45-Bio) of biotin labeling
The control nucleic acid sequence L45 (L45-Bio) of biotin labeling is 5 ' the end coupling biologies in control nucleic acid sequence L45
What plain group obtained, L45-Bio is dissolved with combination buffer, after UV absorption calibration concentration (100nM), 95 DEG C of heating
5min places 5min on ice, is placed at room temperature for 15min.The nucleotide sequence of control nucleic acid sequence L45: TTTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN。
Two, the Mass Spectrometric Identification of 2 specific recognition of aptamer and combination TfR
1, the extraction of 2 target proteins of aptamer
(1) 2 × 10 are taken respectively8The Jurkat E6-1 cell of the heavy isotope labelling of a exponential phase of growth and light-duty same
Position element label Jurkat E6-1 cell, PBS washing after, respectively with the aptamer of biotin labeling 2 (100nM) and biology
The control nucleic acid sequence L45 (100nM) of element label is incubated for 30 minutes.
(2) PBS is washed 2 times, and the cell pyrolysis liquid of 1mL is added, and is incubated for 1 hour.
(3) 2000rpm centrifugation removal precipitating collects supernatant, and (GE is public for the agarose microbeads of addition Streptavidin modification
Department, article No.: 17-5113-01), it is incubated for 1 hour, extracts target proteins.
(4) agarose microbeads that the Streptavidin modification after above-mentioned steps (3) are incubated for is washed with PBS, are washed 5 times, point
Do not obtain the albumen of heavy isotope labelling, the control nucleic acid sequence L45 that the aptamer 2 of biotin labeling extracts extract it is light
The albumen and control nucleic acid for the light-duty isotope labelling that the albumen of type isotope labelling, the aptamer 2 of biotin labeling extract
The albumen for the heavy isotope labelling that sequence L45 is extracted.
2, forward and reverse is tested
(1) positive experiment: by the albumen for the heavy isotope labelling that the aptamer 2 of biotin labeling extracts with compare core
The albumen mixing for the light-duty isotope labelling that acid sequence L45 is extracted, the heavy type for obtaining the extraction of aptamer 2 of biotin labeling are same
The mixed system for the light-duty isotope labelling that the albumen and control nucleic acid sequence L45 of position element label extract.
(2) reversed experiment: by the albumen for the light-duty isotope labelling that the aptamer 2 of biotin labeling extracts with compare core
The albumen mixing for the heavy isotope labelling that acid sequence L45 is extracted obtains the light-duty same of the extraction of aptamer 2 of biotin labeling
The mixed system for the heavy isotope labelling that the albumen and control nucleic acid sequence L45 of position element label extract.
3, the enzymatic hydrolysis of albumen and LC-MS identification
(1) DTT is restored: the albumen of heavy isotope labelling that extracts respectively to the aptamer of biotin labeling 2 and right
It is extracted according to the mixed system of the nucleic acid sequence L45 light-duty isotope labelling extracted, the aptamer 2 of biotin labeling light-duty same
200 μ L 20mM are added in the mixed system for the heavy isotope labelling that the albumen and control nucleic acid sequence L45 of position element label extract
Dithiothreitol (DTT) (DTT), 56 DEG C of reaction 45min.
(2) IAA is alkylated: the product of step (1) being centrifuged, supernatant (removal DTT) is abandoned, 200 μ is separately added into precipitating
L 55mM iodoacetamide (IAA) is protected from light 30min at 37 DEG C.
(3) product of step (2) is centrifuged, abandons supernatant (removal IAA), 5 μ g mass spectrum trypsase is added into precipitating
(Promega company, catalog number: V5111), 37 DEG C of digestions are stayed overnight, the polypeptide after obtaining digestion.
(4) polypeptide after digestion is added 100ul water, utilizes Ziptip C after vacuum concentration18Microtrabeculae desalination.Mass spectrum
Before analysis, -20 DEG C of refrigerators are placed.
(5) LTQ-Orbitrap Velos mass spectrograph (Thermo Fisher Scientific, San Jose, CA) is utilized
The product of step (4) is analyzed and identified, original mass spectrometric data is obtained.
(6) data search is analyzed
The original mass spectrometric data that step (5) obtain is existed using MaxQuant search engine (version number: 1.3.0.5)
IPI albumen database (version number: is retrieved in 3.68).Some parameters of database search are as follows: immobilization is modified to half
Alkylation modification on cystine, the acetylation modification of the variable oxidative modification and protein N terminal being modified on methionine.Permit
Perhaps 2 leakage enzyme sites, the fault-tolerant amount of parent ion are 20ppm, and MS/MS fragment ion masses error is 0.5Da.Candidate for identification
Albumen has the unique peptide identification of 2 or more than two to go out, and posteriority standard error (PEP) is less than 10-5.Candidate albumen need to be
Forward direction tests and reversely is accredited simultaneously in experiment.
The result shows that: SILAC (stable isotope labeling technology) experimental identification goes out 24 albumen, aptamer 2 and random
Control nucleic acid sequence L45 extracts only TfR albumen of the protein abundance ratio greater than 2, the abundance of remaining 23 albumen
Ratio is both less than 2.Illustrate the identification that aptamer 2 can be specific and combines TfR albumen.
Embodiment 4, aptamer 2 and Transferrin Receptor Antibody (anti-CD71) contaminate cell strain altogether
One, the preparation of 2 derivative of the pretreatment of cell strain and aptamer
1, the pretreatment of cell strain
Cell origin: people's acute T-cell leukemia cell (Jurkat E6-1, catalog number:
3111C0001CCC000075), human cervical carcinoma cell (HeLa, catalog number: 3111C0001CCC000011), people's liver ascites
Adenocarcinoma cell (SK-HEP-1, catalog number: 3111C0002000000060) and hormone dependence human breast cancer cell
(MCF-7, catalog number: 3111C0001CCC000013), above-mentioned cell is purchased from Academy of Medical Sciences Institute of Basic Medical Sciences
(Beijing).The Human colorectal cancer cells of resistance to taxol (HCT-8T, catalog number: KG332) and people's lung carcinoma cell of resistance to taxol
(A549T, catalog number: KG124) is purchased from Jiangsu Kai Ji biotechnology joint-stock company (Nanjing).
Take one ware of each cell of following growth logarithmic phase: people's lung carcinoma cell of resistance to taxol (A549T), people's colon of resistance to taxol
Cancer cell (HCT-8T), human breast cancer cell (MCF-7), people's liver ascitis adenocarcinoma cell (SK-HEP-1), are digested with 0.2%EDTA
It after monodisperse cell suspension, is washed 2 times with washing buffer, is divided into several pieces, every part of cell number is 5 × 104It is a；Suspend life
Long human leukemia cell (Jurkat E6-1) is washed 2 times after directly dispelling with washing buffer, is equally divided into several pieces, often
Part cell number is 5 × 104It is a.
2, the preparation of 2 derivative of aptamer
(1) aptamer 2 of cyanine dye (Cy5) label
The aptamer 2 of cyanine dye (Cy5) label is 5 ' end coupling cyanine dye (Cy5) groups in aptamer 2
It obtains, with the aptamer 2 of combination buffer dissolution cyanine dye (Cy5) label, demarcates concentration (20 μ according to UV absorption
M after), 95 DEG C of heat denatured 5min place 10min on ice, are placed at room temperature for 30min.
(2) control sequence of cyanine dye (Cy5) label
The control sequence of cyanine dye (Cy5) label is to be coupled cyanine dye (Cy5) groups at 5 ' ends of control sequence to obtain
It arrives, with the control sequence of combination buffer dissolution cyanine dye (Cy5) label, demarcates concentration (20 μM) according to UV absorption
Afterwards, 95 DEG C of heat denatured 5min, place 10min on ice, are placed at room temperature for 30min.The nucleotide sequence of control sequence: AGAGCAG
CGTGGAGGATAGTTGGGGTTTGGCAAGTATTGTGTGCGCTGTTC。
Two, the specific detection of aptamer 2
To compare aptamer 2 and monoclonal antibody to the specificly-response ability of cell surface TfR, incite somebody to action
One pretreated 6 plant of cell of above-mentioned steps is handled as follows respectively, and three repetitions are arranged in each processing:
1:6 plants of every plant of cells of processing take 5 × 10 respectively4A cell is scattered in combination buffer, and Hua Jingran is then added
Expect aptamer 2 (final concentration of 200nmol/L) and Transferrin Receptor Antibody (anti-CD71, dilution times of (Cy5) label
Number 1:20).
2:6 plants of every plant of cells of processing take 5 × 10 respectively4A cell is scattered in combination buffer, and Hua Jingran is then added
Expect the control sequence (final concentration of 200nmol/L) and Isotype control (IgG of (Cy5) label1, it is diluted to concentration and transferrins
Receptor antibody concentration is consistent).
Respectively the mixed liquor that processing 1 and processing 2 obtain is incubated for 30min on ice, is washed twice with washing buffer, then
The secondary antibody of phycoerythrin modification is added, is incubated for 30min on ice, with BD company after washing twice with washing buffer
FACSCalibur flow cytometer collects the fluorescence intensity data of second channel and fourth lane, the fluorescence as cell surface
Intensity.
Flow cytomery result is as shown in Figure 3.In flow cytometry dot plots, abscissa indicates flow cytometer the
The fluorescence intensity for the dye molecule Cy5 that the fluorescence intensity of four-way, i.e. nucleic acid molecules are modified；Ordinate indicates flow cytometer
The fluorescence intensity for the phycoerythrin that the fluorescence intensity of second channel, i.e. antibody (anti-CD71) or Isotype control are combined.According to
Control sequence is strong to the fluorescence for impinging upon second channel in the fluorescence intensity and antibody morphism of fourth lane in each plant of cell processing 2
Degree sets cross quadrant door, is in processing 2 95% cell in the following area Q4.
According to as a result, the cross quadrant goalkeeper's coordinates regional being arranged in scatter plot is divided into four regions:
The upper left corner, that is, second channel fluorescence intensity is big and fourth lane fluorescence intensity is small, i.e. antibody positive, aptamer yin
Property, it is denoted as the area Q1；
Fourth lane fluorescence intensity is big when the upper right corner, that is, second channel fluorescence intensity Datong District, i.e. antibody positive, aptamer
The positive is denoted as the area Q2；
The lower right corner, that is, second channel fluorescence intensity is small and fourth lane fluorescence intensity is big, i.e., negative antibody, aptamer are positive
Property, it is denoted as the area Q3；
The lower left corner, that is, second channel fluorescence intensity is small while fourth lane fluorescence intensity is small, i.e. negative antibody, aptamer
Feminine gender is denoted as the area Q4.
Using cell, rear fluorescence intensity is more than the fluorescence intensity of processing 2 as the cell hundred of threshold value in conjunction with aptamer or antibody
Score as measure aptamer or antibody and cell combination ability it is strong and weak (-: < 15%；﹢: 15-30%；﹢ ﹢: 30-65%；﹢ ﹢
﹢: 65-85%；﹢ ﹢ ﹢ ﹢: > 85%).As seen from Figure 3, people's colon cancer cell of resistance to taxol (HCT-8T), breast cancer cell
(MCF-7), liver cancer cells (SK-HEP-1) and human leukemia cell (Jurkat 6E-1) carry out the cell sample of processing 1 anti-
The cell number in the area Q2 of the body positive and the aptamer positive is all larger than 80%；Human cervical carcinoma cell (HeLa) carries out the thin of processing 1
Cell number of born of the same parents' sample in antibody positive and the area Q2 of the aptamer positive is greater than 50%.And people's lung carcinoma cell of resistance to taxol
(A549T) cell sample for carrying out processing 1 has 80% or more cell to be in the area Q4 of negative antibody and aptamer feminine gender, says
The expression quantity of bright A549T cell membrane surface TfR is lower.
It is same that the above results illustrate that aptamer 2 and monoclonal antibody have the TfR of cell membrane surface
Responsiveness, the two cellular response high for Expression of Transferrin Receptor is all higher, the cell low to Expression of Transferrin Receptor
Without response.And compared with antibody, aptamer synthesis cost of the invention is lower, and the period is short；Turn iron carrying out cell surface
When the detection of protein receptor, more simple, rapid, favorable reproducibility is operated.
Embodiment 5, aptamer and Transferrin Receptor Antibody detection siRNA interfere HeLa cell TfR
Expression
One, the preparation of the HeLa cell after 2 derivative of aptamer and siRNA are interfered
1, the preparation of 2 derivative of aptamer
(1) aptamer 2 of fluorescein (6-FAM) label
The aptamer 2 of fluorescein (6-FAM) label is 5 ' end coupling fluorescein (6-FAM) groups in aptamer 2
It obtains, with the aptamer 2 of combination buffer dissolution fluorescein (6-FAM) label, demarcates concentration (20 μ according to UV absorption
M after), 95 DEG C of heat denatured 5min place 10min on ice, are placed at room temperature for 30min.
(2) control sequence of fluorescein (6-FAM) label
The control sequence of fluorescein (6-FAM) label is to be coupled fluorescein (6-FAM) groups at 5 ' ends of control sequence to obtain
It arrives, with the control sequence of combination buffer dissolution fluorescein (6-FAM) label, demarcates concentration (20 μM) according to UV absorption
Afterwards, 95 DEG C of heat denatured 5min, place 10min on ice, are placed at room temperature for 30min.The nucleotide sequence of control sequence: AGAGCAG
CGTGGAGGATAGTTGGGGTTTGGCAAGTATTGTGTGCGCTGTTC。
2, the preparation of the HeLa cell after siRNA interference
(1) preparation of transfection reagent
SiRNA (TfR3, the positive-sense strand: 5'-GCUGGUCAGUUCGUGAUUATT-3' of TfR；Antisense strand:
5'-UAAUCACGAACUGACCAGCTT-3') and siRNA negative control sequence (NC) synthesis is in the raw work bioengineering stock in Shanghai
Part company.According to the method that lipofectamine box manufacturer provides using lipofectamine as siRNA sequence
The carrier of column and siRNA negative control sequence, TfR3 sequence and NC sequence are configured to 20 μM of mother liquor with the dissolution of DEPC water, point
The transfection reagent of the transfection reagent containing siRNA sequence (TfR3) that can be used for transfecting and control RNA sequence (NC) is not obtained.Rouge
Plasmids kit (RNAiMAX transfection reagent) it is Thermo Fisher Scientific company
Product.
(2) acquisition of the HeLa cell after siRNA interference
HeLa cell equably cover plant in 6 orifice plates, in every hole 2mL culture medium (DMEM culture medium, Gibco) containing about 1 ×
105A cell, following to handle after growth overnight:
The transfection reagent that 250ul contains control RNA sequence (NC) is added in processing one, 2ml fresh culture；
The transfection reagent that 250ul contains siRNA sequence (TfR3) is added in processing two, 2ml fresh culture.
Every kind of processing mode repeats three holes, and the cell in six orifice plates continues to cultivate 48h in incubator, respectively obtain
The HeLa cell after HeLa cell and control RNA interference after siRNA interference.Then by cell 0.2%EDTA in six orifice plates
It after being digested to monodisperse cell suspension, is washed 2 times with washing buffer, cell is scattered in combination buffer, the cell in every hole
It is divided into four parts.
Two, the expression detection of the TfR of the HeLa cell after siRNA interference
Four parts of cell suspensions in the every hole of six orifice plates are handled as follows respectively after the processing of above-mentioned steps one:
The control sequence (final concentration of 200nmol/L) of fluorescein (6-FAM) label is added in processing one, cell suspension；
The aptamer 2 (final concentration of 200nmol/L) of fluorescein (6-FAM) label is added in processing two, cell suspension；
Isotype control (IgG is added in processing three, cell suspension1, it is diluted to concentration and Transferrin Receptor Antibody concentration one
It causes)；
Transferrin Receptor Antibody (anti-CD71, extension rate 1:20) in processing four, cell suspension.
The mixed liquor of processing one and processing two is incubated for 30min on ice, is washed twice with washing buffer；Cell washing
Buffer is resuspended, and the FACSCalibur flow cytometer of BD company collects first passage fluorescence intensity data, as cell surface
Fluorescence intensity.The mixed liquor of processing three and processing four is incubated for 30min on ice, is washed twice, is added with washing buffer
The secondary antibody of phycoerythrin modification, is incubated for 30min on ice, is washed twice with washing buffer；Cell after washing is slow with washing
Fliud flushing is resuspended, and the FACSCalibur flow cytometer of BD company collects the fluorescence intensity data of second channel, as cell surface
Fluorescence intensity.
Flow cytometry experiments result is shown in Fig. 4.From fig. 4, it can be seen that knot of the aptamer 2 to siRNA interference HeLa cell
Resultant is reduced；Transferrin Receptor Antibody (anti-CD71) also reduces the binding capacity of siRNA interference HeLa cell；Above-mentioned knot
It is same that fruit illustrates that aptamer 2 and Transferrin Receptor Antibody have the expression quantity of the TfR of cell membrane surface
Responsiveness can substitute Transferrin Receptor Antibody use.And compared with antibody, aptamer synthesis cost of the invention is more
Low, the period is short；When carrying out the detection of cell surface TfR, more simple, rapid, favorable reproducibility is operated.
Embodiment 6, aptamer 2 and breast cancer and prostate cancer tissue are sliced fluorescent staining
With the aptamer 2 of fluorescein (6-FAM) label to patient with breast cancer and patients with prostate cancer tissue section strain,
Carry out the detection and diagnosis of TfR.
One, the preparation of 2 derivative of aptamer and the pretreatment of patient with breast cancer and patients with prostate cancer histotomy
1, the preparation of 2 derivative of aptamer
(1) aptamer 2 of fluorescein (6-FAM) label
The aptamer 2 of fluorescein (6-FAM) label is 5 ' end coupling fluorescein (6-FAM) groups in aptamer 2
It obtains, with the aptamer 2 of combination buffer dissolution fluorescein (6-FAM) label, demarcates concentration (20 μ according to UV absorption
M after), 95 DEG C of heat denatured 5min place 10min on ice, are placed at room temperature for 30min.
(2) control sequence of fluorescein (6-FAM) label
The control sequence of fluorescein (6-FAM) label is to be coupled fluorescein (6-FAM) groups at 5 ' ends of control sequence to obtain
It arrives, with the control sequence of combination buffer dissolution fluorescein (6-FAM) label, demarcates concentration (20 μM) according to UV absorption
Afterwards, 95 DEG C of heat denatured 5min, place 10min on ice, are placed at room temperature for 30min.The nucleotide sequence of control sequence: AGAGCAG
CGTGGAGGATAGTTGGGGTTTGGCAAGTATTGTGTGCGCTGTTC。
2, the pretreatment of patient with breast cancer's histotomy
(Zhongshan University's third affiliated hospital is derived from, all patients are through facing with patients with prostate cancer tumor tissues respectively
Bed diagnosis determines that patient knows)；The proliferation of mammary gland (benign lesion) patient tissue and patients with breast cancer tissue (malignant change,
HER2 is positive) (deriving from hospital, Chinese People's Liberation Army General Hospital, all patients determine that patient knows through clinical diagnosis) be
Experimental material carries out the processing of following steps:
(1) histotomy dewaxing aquation
1) bake piece: histotomy is in 60 DEG C of oven for baking 20min；
2) it is placed in 15min in the first cylinder dimethylbenzene at once, is then placed in 15min in the second cylinder dimethylbenzene；
3) 10min in dehydrated alcohol, 95% ethyl alcohol 5min, 70% ethyl alcohol 5min are sequentially placed；
4) tap water rinses 5min (in slow flowing water basin), distilled water rinse one time, obtains the tissue of dewaxing aquation
Slice.
(2) it is sliced stain antigen reparation
Utilize microwave thermal repairing method repair antigen, the specific steps are as follows: take appropriate TE buffer (EDTA 0.292g and
Tris-base 6.05g is dissolved in 1000mL distilled water, pH=8.0), the histotomy for the aquation that dewaxes is put into and fills reparation liquid
It in the container of (TE buffer), sets and is heated to boiling in micro-wave oven, stop heating, decline fluid temperature in container, be maintained at
Between 95 DEG C~98 DEG C and continue 15min.Container is taken out, cooled to room temperature is taken out and is sliced, and after distilled water flushing, then uses
Washing buffer is impregnated, 5min × 3 time (guarantee to impregnate for the first time is the washing buffer newly matched), the tissue after being repaired
Slice.
Two, aptamer is incubated for staining procedure
1, by the combination of histotomy elder generation and the herring sperm dna containing 20%FBS and 1mg/ml after the reparation in the 2 of step 1
Buffer solution is incubated at room temperature 60min；
2, it is then incubated with the combination buffer solution room temperature of the aptamer 2 of 200 μ L fluoresceins containing 250nM (6-FAM) label
60min is educated, control sequence colouring method is identical, and blank does not dye；
3, it is washed three times with washing buffer；
4, dry, anti-cancellation mountant mounting is observed using laser confocal scanning microscope.
The microscopy results of patients with prostate cancer tumor tissues such as Fig. 5 shows, as can be seen from Figure 5, aptamer 2 can be with
Prostate cancer tissue slice combines, and control sequence can hardly be sliced with prostate cancer tissue and be combined.Illustrate that aptamer 2 is right
Prostate cancer has good recognition detection ability.
The breast tissue of hyperplasia of prostate and microscopy results such as Fig. 6 of patients with breast cancer tissue (malignant change)
Show, from Fig. 6, it can be seen that, the breast tissue of hyperplasia of prostate cannot be combined substantially with aptamer 2, and patients with breast cancer tissue
(malignant change) then has stronger combination with aptamer 2.Illustrate that aptamer 2 suffers from the breast tissue and breast cancer of hyperplasia of prostate
Person's tumor tissues (malignant change) have good recognition detection ability, can distinguish the proliferation of mammary gland (benign lesion) and tumor group
Knit (malignant change).
The above results show that aptamer of the invention can identify the histotomy of tumour well.
The aptamer probe of embodiment 7, aptamer 2 and graphene building detection TfR
One, the design principle and preparation of aptamer probe
1, the design principle of aptamer probe
Probe principle: the aptamer 2 and polyethyleneglycol modified graphene oxide (PEG-GO) of fluorophor modification are mixed
After conjunction, since the presence of non-covalent bonding action enables nucleic acid molecules to be supported on polyethyleneglycol modified surface of graphene oxide
And cause the fluorophor modified on the nucleic acid molecules being supported that fluorescent quenching effect occurs.When adding transferrins in system
When receptor, with the aptamer 2 being supported specific binding, which occurs, for TfR makes aptamer 2 dissociate from graphene
Out, so that modified fluorophor be made to restore fluorescence.By detecting restored fluorescence intensity, transferrins can be quantified
The content of receptor, to achieve the purpose that detect TfR.
2, the preparation of aptamer probe
(1) preparation of polyethyleneglycol modified graphene oxide
Graphene oxide (is purchased from Chinese medicines group chemical reagent Beijing Co., Ltd, produced in dimethylformamide (DMF)
Product catalog number (Cat.No.): ZAGA04645) in ultrasonic disperse, obtain the dispersion liquid of 1mg/mL, by 200mg polyethylene glycol (PEG2000) (purchase
From in Bellingwell company, catalog number: B22181) and 50mL dispersion liquid ultrasound 10min in round-bottomed flask, it adds certain
The DCC/DMAP (DCC and DMAP the mass ratio of the material be 5:1) of amount is used as catalyst, in 60 DEG C of reaction 12h, general after ultrasonic 30min
Dispersion liquid is dialysed 1 week in bag filter, removes free PEG and catalyst, after freeze-dried, is obtained polyethyleneglycol modified
Graphene oxide.Through structural characterization and thermogravimetic analysis (TGA) show PEG2000 surface of graphene oxide grafting amount be 51%.
(2) aptamer pre-processes
The aptamer 2 of fluorescein (6-FAM) label is 5 ' end coupling fluorescein (6-FAM) groups in aptamer 2
It obtains, with the aptamer 2 of combination buffer dissolution fluorescein (6-FAM) label, demarcates concentration (20 μ according to UV absorption
M after), 95 DEG C of heat denatured 5min place 10min on ice, are placed at room temperature for 30min.
(3) preparation of aptamer probe
Aptamer 2, polyethyleneglycol modified graphene oxide and the probe buffer that fluorescein (6-FAM) is marked
(pH7.4) (aptamer 2, polyethyleneglycol modified graphene oxide and the probe buffer of fluorescein (6-FAM) label is mixed
(pH7.4) proportion is 1nmol:150mg:1L), nucleic acid probe system is obtained, is incubated for 1h at room temperature, 4 DEG C after stable system
It saves.Final concentration of 150ug/mL of the polyethyleneglycol modified graphene oxide in nucleic acid probe system, fluorescein (6-FAM)
Final concentration of 100nM of the aptamer 2 of label in nucleic acid probe system).
Two, response of the nucleic acid probe to various concentration TfR
It is separately added into the TfR of various concentration into the nucleic acid probe system that step 1 is built, makes in system
TfR is final concentration of: 0.2ug/mL, 0.5ug/mL, 1ug/mL, 2ug/mL, 5ug/mL, 10ug/mL, at room temperature
It is incubated for 30min, then records fluorescence with luminoscope FL4600fluorescence spectrometer (Hitachi, Japan)
Spectrum, excitation wavelength 480nm, launch wavelength 500-600nm take the fluorescent value at maximum emission wavelength 530nm for response fluorescence
Value.
Aptamer probe is shown in Fig. 7 to the response results of various concentration TfR, and nucleic acid probe is to transferrins
Receptor has good response, and fluorescence signal increases as TfR concentration increases.In 0.2ug/mL-5ug/mL range
Interior, aptamer probe has good linear relationship to the concentration of TfR.
Three, the specificity of aptamer probe
People's recombinant transferrin receptor (TfR) is separately added into the nucleic acid probe system that step 1 is built (to be purchased from
Sigma-Aldrich company, catalog number SRP6299), human serum albumins (HSA) (purchased from be purchased from Shanghai source leaf
Biotech firm, catalog number S24985), bovine serum albumin(BSA) (BSA) (be purchased from Shanghai Yuan Ye biotech firm, product mesh
Record number is S12012), lysozyme (Lys) (be purchased from Shanghai Yuan Ye biotech firm, catalog number MHB6267), α-gruel egg
White enzyme (chy) (being purchased from Chinese medicines group chemical reagent Beijing Co., Ltd, catalog number ZD605453) and fibrin ferment
(Thr) (Chinese medicines group chemical reagent Beijing Co., Ltd, catalog number zd701139 are purchased from), make it in system
Concentration is people's recombinant transferrin receptor (TfR) 2ug/ml respectively, human serum albumins (HSA), bovine serum albumin(BSA) (BSA),
Lysozyme (Lys) and Chymetin (chy) are 100ug/ml, fibrin ferment (Thr) 18.7ug/ml；It is incubated at room temperature
Then 30min records fluorescence light with luminoscope FL4600 fluorescence spectrometer (Hitachi, Japan)
Spectrum, excitation wavelength 480nm, launch wavelength 500-600nm take the fluorescent value at maximum emission wavelength 530nm for response fluorescent value.
Aptamer probe is to different types of protein response results such as Fig. 8, and as can be seen from Figure 8, aptamer is visited
There is good response for TfR, and other protein is responded weaker；Illustrate that aptamer of the invention is visited
Needle set has good specificity.
Claims (10)
1. a kind of aptamer, it is characterised in that: the aptamer is following 1) -5) in it is any:
1) single strand dna shown in sequence 2；
2) single strand dna shown in sequence 6；
3) single strand dna shown in sequence 5；
4) single strand dna shown in sequence 4；
5) single strand dna shown in sequence 3.
2. a kind of derivative of aptamer is 5 ' the end mark fluorescent element groups or Hua Jing of the aptamer shown in sequence 2
The derivative of the aptamer obtained after dye groups or biotin group.
3. a kind of aptamer probe, to bear aptamer described in claim 1 or derivative as claimed in claim 2
It is loaded on polyethyleneglycol modified graphene oxide, obtains aptamer probe.
4. according to aptamer probe according to claim 3, it is characterised in that: the aptamer or the derivative
Proportion with polyethyleneglycol modified graphene oxide is 1 nmol: 150 mg.
5. aptamer probe according to claim 3 or 4, it is characterised in that: the probe is prepared as follows:
The nucleic acid aptamer derivative of fluorophor label, polyethyleneglycol modified graphene oxide and buffer are mixed, is incubated for, obtains
Aptamer probe.
6. in the derivative or claim 3-5 of aptamer described in claim 1 or aptamer as claimed in claim 2
Application of any aptamer probe at least one of following (B1)-(B5):
(B1) identify or assist in identifying TfR；
(B2) combination or secondary combined TfR；
(B3) preparation detection or auxiliary detection sample to be tested in whether the product containing TfR；
(B4) preparation detection or auxiliary detect the product of TfR content in sample to be tested；
(B5) product of the tumour or tumour cell of preparation detection or auxiliary detection expression TfR.
7. application according to claim 6, it is characterised in that: the sample to be tested is cell.
8. application according to claim 7, it is characterised in that: the cell is people's lung carcinoma cell of resistance to taxol, people's colon
Cancer cell, human cervical carcinoma cell, breast cancer cell or liver cancer cells.
9. application according to claim 8, it is characterised in that: the human colon cancer cell is that the human colon carcinoma of resistance to taxol is thin
Born of the same parents.
10. according to any application of claim 6-9, it is characterised in that: the product is kit or probe or targeting
Substance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610555387.6A CN106191069B (en) | 2016-07-14 | 2016-07-14 | A kind of aptamer sequence and its application identified and combine human TfR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610555387.6A CN106191069B (en) | 2016-07-14 | 2016-07-14 | A kind of aptamer sequence and its application identified and combine human TfR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106191069A CN106191069A (en) | 2016-12-07 |
| CN106191069B true CN106191069B (en) | 2019-03-01 |
Family
ID=57475719
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610555387.6A Active CN106191069B (en) | 2016-07-14 | 2016-07-14 | A kind of aptamer sequence and its application identified and combine human TfR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106191069B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108305912B (en) * | 2017-01-11 | 2024-03-26 | 中国科学院上海微系统与信息技术研究所 | Graphene bionic optical detector with wavelength selectivity and preparation method thereof |
| CN109913462B (en) * | 2017-12-12 | 2022-09-13 | 中国科学院化学研究所 | Application research of aptamer recognition and combination with CD171 and related functions thereof |
| CN109554369B (en) * | 2018-02-02 | 2021-11-02 | 中国科学院化学研究所 | Use of aptamers for recognition and binding of alkaline phosphatase heterodimers |
| CN109355294B (en) * | 2018-11-16 | 2022-06-28 | 温州医科大学附属第一医院 | Nucleic acid aptamer for specifically recognizing Vimentin and application thereof |
| CN110283826A (en) * | 2019-07-03 | 2019-09-27 | 福州大学 | A kind of bispecific aptamer, derivative, preparation method and applications |
| JP2023532032A (en) * | 2020-06-29 | 2023-07-26 | アプタマー サイエンシズ インコーポレイテッド | Blood-brain barrier penetrating aptamer and its use |
| CN114574497B (en) * | 2022-04-01 | 2022-08-30 | 浙江省肿瘤医院 | Aptamer for identifying extracellular vesicles of patient with drug resistance to ovarian cancer and application of aptamer |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013163303A2 (en) * | 2012-04-25 | 2013-10-31 | Albert Einstein College Of Medicine Of Yeshiva University | Transferrin receptor aptamers and aptamer-targeted delivery |
| CN104498500A (en) * | 2014-12-01 | 2015-04-08 | 中国科学院化学研究所 | Aptamer for recognizing adriamycin-resistant breast cancer cells as well as screening method and application of aptamer |
| CN105044322A (en) * | 2015-06-24 | 2015-11-11 | 中国科学院化学研究所 | Application of aptamer in recognition of L selectin and combination with L selectin |
| CN105327362A (en) * | 2015-11-17 | 2016-02-17 | 上海纳米技术及应用国家工程研究中心有限公司 | Method for preparing graphene targeting drug carrier modified by amphiphilic polymer brush |
-
2016
- 2016-07-14 CN CN201610555387.6A patent/CN106191069B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013163303A2 (en) * | 2012-04-25 | 2013-10-31 | Albert Einstein College Of Medicine Of Yeshiva University | Transferrin receptor aptamers and aptamer-targeted delivery |
| CN104498500A (en) * | 2014-12-01 | 2015-04-08 | 中国科学院化学研究所 | Aptamer for recognizing adriamycin-resistant breast cancer cells as well as screening method and application of aptamer |
| CN105044322A (en) * | 2015-06-24 | 2015-11-11 | 中国科学院化学研究所 | Application of aptamer in recognition of L selectin and combination with L selectin |
| CN105327362A (en) * | 2015-11-17 | 2016-02-17 | 上海纳米技术及应用国家工程研究中心有限公司 | Method for preparing graphene targeting drug carrier modified by amphiphilic polymer brush |
Non-Patent Citations (3)
| Title |
|---|
| A New Transferrin Receptor Aptamer Inhibits New World Hemorrhagic Fever Mammarenavirus Entry;Keith E Maier等;《Molecular Therapy-Nucleic Acids》;20160524;第5卷;第1-15页 * |
| Aptamer-based endocytosis of a lysosomal enzyme;Chi-hong B. Chen等;《PNAS》;20081014;第105卷(第41期);第15908–15913页 * |
| Two Interconvertible Folds Modulate the Activity of a DNA Aptamer Against Transferrin Receptor;David Porciani等;《Molecular Therapy—Nucleic Acids》;20140128;第3卷;第1-13页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106191069A (en) | 2016-12-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106191069B (en) | A kind of aptamer sequence and its application identified and combine human TfR | |
| CN103642810B (en) | Application in a kind of aptamer and screening method, the before detection strain of row adenocarcinoma cell | |
| CN108866061A (en) | A kind of aptamer identifying liver cancer cells and its screening technique and purposes | |
| CN103205431B (en) | Nucleic acid aptamer and derivatives thereof, screening method of nucleic acid aptamer, application of nucleic acid aptamer and derivatives in detecting human biliary duct carcinoma cell line | |
| JP5603933B2 (en) | Nucleic acid aptamer capable of specifically binding to pancreatic cancer cells or tissues and use thereof | |
| CN107254513A (en) | It is used for the composition and method for detecting chromosome aberration using new hybridization buffer | |
| CN104498500B (en) | A kind of aptamer for identifying adriamycin-resistant breast cancer cell and its screening technique and application | |
| CN104988154B (en) | Application of the aptamer in identifying and combining integrin alpha 4 | |
| KR20140114714A (en) | Method for Dectecting of Target Molecules Using PNA Aptamers | |
| CN109913462A (en) | A kind of aptamer identifies and combines the application study of CD171 and its correlation function | |
| CN108929873A (en) | It is a kind of specifically bind metastatic gastric carcinoma cell aptamer and its application | |
| CN108866062A (en) | The DNA aptamers and its screening technique of a kind of specific recognition liver-cancer stem cell and application | |
| CN105385691A (en) | Nucleic acid adapter used for detecting human high-metastasis colon cancer cell strain LoVo and detection kit | |
| CN107794268A (en) | Detect the aptamer of people's PDL1 albumen and its prepare the application in detecting preparation | |
| CN105044322B (en) | Aptamer application in identifying and combine L selection element | |
| CN103463619B (en) | BMP 4 is in the application suppressing in cancer | |
| Li et al. | Designing DNA cage-based immuno-fluorescence strategy for rapid diagnosis of clinical cervical cancer tissues | |
| Chen et al. | A washing-free and easy-to-operate fluorescent biosensor for highly efficient detection of breast cancer-derived exosomes | |
| CN109517824A (en) | It is a kind of identify target proteins CD71 method and aptamer application | |
| CN104651368A (en) | Core sequence of nucleic acid aptamer BC15 and analogue and application thereof | |
| CN108998503A (en) | Oligo probe and preparation method and application thereof | |
| CN116376917A (en) | Application of aptamer SWL-3G, SWL-3bG in preparation of medicines for treating bladder cancer | |
| CN110408620B (en) | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof | |
| CN109554369B (en) | Use of aptamers for recognition and binding of alkaline phosphatase heterodimers | |
| CN112159813B (en) | Nucleic acid aptamer specifically binding to ovarian serous adenocarcinoma cells and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |