CN105044322A - Application of aptamer in recognition of L selectin and combination with L selectin - Google Patents
Application of aptamer in recognition of L selectin and combination with L selectin Download PDFInfo
- Publication number
- CN105044322A CN105044322A CN201510354158.3A CN201510354158A CN105044322A CN 105044322 A CN105044322 A CN 105044322A CN 201510354158 A CN201510354158 A CN 201510354158A CN 105044322 A CN105044322 A CN 105044322A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- cell
- human
- sequence
- derivant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of an aptamer in recognition of L selectin and combination with L selectin. The condition that the aptamer Sgc-3b can specifically recognize L selectin and can be specifically combined with L selectin is discovered for the first time, and an L selectin detecting method is established by utilizing the combination of specificities of the aptamer Sgc-3b and L selectin. Experiments prove that the aptamer Sgc-3b has the characteristics of being high in affinity, strong in specificity, free of immunogenicity and toxicity, and the like, and the L selectin detecting method established based on the aptamer Sgc-3b can be used for detection of L selectin expression and diagnosis of related diseases.
Description
Technical field
The invention belongs to biotechnology and technical field of clinical medicine, be specifically related to aptamer and identifying and selecting the application in element in conjunction with L.
Background technology
Aptamer (aptamer) be a class can with the nucleotide sequence of the interactional single stranded DNA of target substance specificity, RNA, peptide nucleic acid or chemical modification, be usually made up of 15-80 nucleotide.Aptamer can form specific three-dimensional structure and be combined with target molecules high-affinity, as structures such as hair fastener, false knot, G-tetra-serobilas, combination is realized by Van der Waals force, hydrogen bond, electrostatic interaction and the interphase interaction of hydrophobic effect equimolecular with high specificity.Due to aptamer have that affinity is high, specificity good, non-immunogenicity, easily synthesis, transformation and modification, biological chemistry good stability, characteristic such as energy reversible denaturation and renaturation etc., so be referred to as " chemical antibody ".
Aptamer can be used in the field such as diagnosis and detection, drug target location, new drug development and transport related drugs molecule of some diseases, and at present, the aptamer being used for the treatment of the disease such as cancer, acquired immune deficiency syndrome (AIDS) also continues to bring out.Such as, the aptamer (trade name Macugen) of the target VEGF developed by Eyetch/Pfizer has obtained the approval of FDA for 2004, is successfully used to treat age relevant macular degeneration.What in recent years propose utilizes cell-SELEX technology screening specific nucleic acid aptamers, and then finds the application prospect that the method for tumor markers has had.But only have the successful example of only a few at present, bottleneck problem wherein is just the purifying/qualification of the aptamer target molecule be positioned on cell membrane.
L selects element also known as CD62L, leukocyte-endothelial adhesion molecule-1 (LECAM-1), lymph node homing receptor and MEL-14.L selects plain after birth outskirt N to hold 1 C type lectin-like domain, 1 EGF spline structure territory and 2 CCP domains.L selects element to be expressed in some differential period of hematopoietic cell, comprises most of B cell and non-sensitized T cell and most of monocyte, neutrophil leucocyte and eosinophilic granulocyte.After PMA, cell factor or chemoattractant stimulate lymphocyte and neutrophil leucocyte, the enzymolysis due to proteinase makes L select element to rapidly disappear, and makes the soluble type L having high level in blood plasma select element.L selects element to be a kind of important immune-regulating factor in body, the stretching, extension of cell and movement, the intracellular signaling of cell and activation can be participated in, multiple physiology, the pathologic processes such as inflammatory reaction, immune response, thrombosis, metastases, wound healing, selecting sL in the content of element and serum, blood plasma or other body fluid to select the concentration of element can judge the degree of disease and analyze mechanism by measuring cell surface L, may be a potential practical index for the generation of some inflammatories of monitoring or immunity disease, development and result for the treatment of.
Summary of the invention
An object of the present invention is to provide the novelty teabag of aptamer or derivatives thereof.
The invention provides aptamer or derivatives thereof identifying and combining or aid identification select the application in element in conjunction with L;
Or aptamer or derivatives thereof identifies in preparation and combines or aid identification application in the product plain in conjunction with L selection;
Described aptamer is the single strand dna shown in sequence 1.
Present invention also offers aptamer or derivatives thereof detecting or in auxiliary detection testing sample, whether containing the application in L selection element;
Or aptamer or derivatives thereof is in the application detected or in auxiliary detection testing sample in L selection cellulose content;
Or aptamer or derivatives thereof detects in preparation or whether contains the application in the product of L selection element in auxiliary detection testing sample;
Or aptamer or derivatives thereof L in preparation detection or auxiliary detection testing sample selects the application in the product of cellulose content;
Described aptamer is the single strand dna shown in sequence 1.
Present invention also offers aptamer or derivatives thereof and detect the application in the material selecting the antibody of element to be combined with anti-L;
Or aptamer or derivatives thereof detects the application in the product of the material selecting the antibody of element to be combined with anti-L in preparation;
Described aptamer is the single strand dna shown in sequence 1.
Present invention also offers aptamer or derivatives thereof diagnose in preparation and/or treat the application in the product of inflammatory disease or immunity disease;
Described aptamer is the single strand dna shown in sequence 1.
In above-mentioned application, described derivant is the derivant of the arbitrary described aptamer in following (1)-(6):
(1) aptamer shown in sequence 1 deleted or increase one or several nucleotide, obtaining the derivant of the aptamer with described aptamer with identical function;
(2) aptamer shown in sequence 1 is carried out nucleotide replacement or modification, obtain the derivant of the aptamer with described aptamer with identical function;
(3) transform the skeleton of the aptamer shown in sequence 1 as phosphorothioate ester skeleton, obtain the derivant of the aptamer with described aptamer with identical function;
(4) RNA molecule of being encoded by the aptamer shown in sequence 1, obtains the aptamer derivant with described aptamer with identical function;
(5) peptide nucleic acid of being encoded by the aptamer shown in sequence 1, obtains the derivant of the aptamer with described aptamer with identical function;
(6) one end of the aptamer shown in sequence 1 or centre are connected signaling molecule and/or bioactive molecule and/or functional group, obtain the derivant of the aptamer with described aptamer with identical function;
Functional group in described (6) is biotin group or fluorophor.
In above-mentioned application, the derivant of described aptamer is hold mark fluorescent group or biotin group at the 5 ' end or 3 ' of above-mentioned aptamer.
In above-mentioned application, the derivant of described aptamer is 5 ' end mark fluorescent group or the biotin group at above-mentioned aptamer.
In above-mentioned application, described testing sample is cell, described cell is specially rat alveolar epithelial cells RAEC, human embryonic lung's fibrocyte MRC-5, people's alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, Proliferation of Human Ovarian Cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, human t-cell leukemia's cell JurkatE6-1, people's ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, Human Prostate Cancer Cells PC-3, human T cells lymthoma Hut-78, human colon cancer cell LoVo, acute lymphoblastic leukemia cell Molt-4, human T lymphoma cell Sup-T1 or human B cell lymphoma cell Mo2058.
Another object of the present invention is to provide a kind of product.
The active component of product provided by the invention is the aptamer or derivatives thereof shown in sequence 1; The purposes of described product is following 1)-5) at least one:
1) identify and combine or aid identification and in conjunction with L select element;
2) to detect or material that auxiliary detection and anti-L select plain antibody to be combined;
3) detect or auxiliary detection testing sample in L select element content;
4) detect or whether select element containing L in auxiliary detection testing sample;
5) diagnose and/or treat inflammatory disease or immunity disease.
In the said goods, described derivant is the derivant of the arbitrary described aptamer in following (1)-(6):
(1) aptamer shown in sequence 1 deleted or increase one or several nucleotide, obtaining the derivant of the aptamer with described aptamer with identical function;
(2) aptamer shown in sequence 1 is carried out nucleotide replacement or modification, obtain the derivant of the aptamer with described aptamer with identical function;
(3) transform the skeleton of the aptamer shown in sequence 1 as phosphorothioate ester skeleton, obtain the derivant of the aptamer with described aptamer with identical function;
(4) RNA molecule of being encoded by the aptamer shown in sequence 1, obtains the aptamer derivant with described aptamer with identical function;
(5) peptide nucleic acid of being encoded by the aptamer shown in sequence 1, obtains the derivant of the aptamer with described aptamer with identical function;
(6) one end of the aptamer shown in sequence 1 or centre are connected signaling molecule and/or bioactive molecule and/or functional group, obtain the derivant of the aptamer with described aptamer with identical function;
Described functional group is biotin group or fluorophor.
In the said goods, the derivant of described aptamer is hold mark fluorescent group or biotin group at the 5 ' end or 3 ' of above-mentioned aptamer.
In the said goods, the derivant of described aptamer is 5 ' end mark fluorescent group or the biotin group at above-mentioned aptamer.
In the said goods, described testing sample is cell, described cell is specially rat alveolar epithelial cells RAEC, human embryonic lung's fibrocyte MRC-5, people's alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, Proliferation of Human Ovarian Cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, human t-cell leukemia's cell JurkatE6-1, people's ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, Human Prostate Cancer Cells PC-3, human T cells lymthoma Hut-78, human colon cancer cell LoVo, acute lymphoblastic leukemia cell Molt-4, human T lymphoma cell Sup-T1 or human B cell lymphoma cell Mo2058.
Late Cambrian aptamer Sgc-3b of the present invention can specific recognition select element in conjunction with L, and utilizes aptamer Sgc-3b and L to select the specific binding effect of element to establish to detect L and select plain method.Prove by experiment: aptamer Sgc-3b of the present invention has the features such as affinity is high, high specificity, non-immunogenicity and nontoxicity, the detection L based on aptamer Sgc-3b foundation selects the method for element to can be used for L and selects the detection of element expression and the diagnosis of relevant disease.
Accompanying drawing explanation
Fig. 1 is ESI-MS and the MS/MS collection of illustrative plates of the plain representational polypeptide of L selection that Sgc-3b-Bio extracts.Figure 1A is heavy isotope-labeled [M+2H]
2+ion ESI-MS spectrogram; Figure 1B is light-duty isotope-labeled [M+2H]
2+ion ESI-MS spectrogram.Fig. 1 C is heavy isotope-labeled [M+2H]
2+ion MS/MS spectrogram; Fig. 1 D is light-duty isotope-labeled [M+2H]
2+ion MS/MS spectrogram.Wherein, half Guang amino acid residue is partially alkylated or alkylated; K* represents heavy isotope-labeled lysine.
Fig. 2 is the flow cytomery result of the JurkatE6-1 cell that Sgc-3b-FAM or anti-CD62L-PE dyes altogether.Wherein, L45-FAM is fluorescein-labeled random series; IgG-PE is control antibodies.
Fig. 3 be variable concentrations Sgc-3b-FAM with 0.625 μ g/mLanti-CD62L-PE antibody competition in conjunction with cells were tested by flow cytometry result.
Fig. 4 is 5 μ g/mLanti-CD62L-PE antibody and 100nMSgc-3b-FAM competitive binding cells were tested by flow cytometry result.
Fig. 5 is the flow cytomery result utilizing the siRNA of CD62L antibody or aptamer Sgc-3b to disturb the JurkatE6-1 cell after CD62L protein expression.
Embodiment
The experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
JurkatE6-1 cell derived is in ATCC, and catalog number is TIB-152
tM.
Binding buffer liquid (pH=7.4) is made up of solvent and solute, and solvent is water, and solute and concentration in a solvent thereof are: 137mMNaCl, 2.7mMKCl, 2mMKH
2pO
4, 10mMNa
2hPO
4, 5mMMgCl
2, 1mMCaCl
2.
Cell pyrolysis liquid is the binding buffer liquid containing 2% (volume fraction) TritonX-100,0.5% (volume fraction) SDS, 5mMEDTA, 0.1mMPMSF and 2 μ g/mL protease inhibitor cocktails (pepstatin, leupeptin and aprotinin).
Embodiment 1, aptamer Sgc-3b specific recognition and in conjunction with L select element qualification
One, the preparation of aptamer Sgc-3b and derivant thereof
1, the synthesis of aptamer Sgc-3b
By DNA synthesizer nucleic acid aptamers Sgc-3b, the nucleotide sequence of aptamer Sgc-3b is as follows: 5 '-CTTATTCAATTCCCGTGGGAAGGCTATAGAGGGGCCAGTCTATGAATAAG-3 ' (sequence 1), need to mark different molecules on aptamer Sgc-3b according to test, obtain the derivant of aptamer Sgc-3b.Wherein, following embodiment 1 have selected biotin labeling aptamer Sgc-3b; Fluorescein (FAM) labeling nucleic acid aptamers Sgc-3b is have selected in other embodiments.
2, DNA deprotection: after cold ammoniacal liquor deprotection, is then dissolved in DNA in the middle of TEAA solution;
3, DNA purifying: by PAGE or high performance liquid chromatograph purifying;
4, DNA is dry: dry by centrifugal concentrating;
5, mensuration concentration is dissolved for subsequent use.
Two, aptamer Sgc-3b specific recognition and in conjunction with L select element qualification
1, the isotope labeling of JurkatE6-1 cell
Heavy isotope-labeled JurkatE6-1 cell: to the nutrient culture media not containing lysine and arginic RPMI1640 add respectively heavy isotope-labeled lysine ([
13c
6,
15n
2]-1B) and the isotope-labeled arginine of heavy type ([
13c
6]-L-arginine), make heavy isotope-labeled lysine and the isotope-labeled arginine of heavy type concentration in the medium be respectively 0.274mM and 0.575mM.Cultured cell 6-7 is for rear for subsequent use.
Light-duty isotope-labeled JurkatE6-1 cell: to the nutrient culture media not containing lysine and arginic RPMI1640 add respectively light-duty isotope-labeled lysine ([
12c
6,
14n
2]-1B) and light-duty isotope-labeled arginine ([
12c
6]-L-arginine), make light-duty isotope-labeled lysine and light-duty isotope-labeled arginine concentration in the medium be respectively 0.274mM and 0.575mM.Cultured cell 6-7 is for rear for subsequent use.
2, the preparation of biotin labeled aptamer Sgc-3b and biotin labeled contrast nucleotide sequence L45
(1) biotin labeled Sgc-3b (Sgc-3b-Bio)
Biotin labeled aptamer Sgc-3b (Sgc-3b-Bio) is obtain at 5 ' the end couple biotin group of aptamer Sgc-3b, Sgc-3b-Bio is dissolved with binding buffer liquid, after demarcating concentration (100nM) according to uv absorption, 95 DEG C of heating 5min, place 5min on ice, room temperature places 15min.
(2) biotin labeled contrast nucleotide sequence L45 (L45-Bio)
Biotin labeled contrast nucleotide sequence L45 (L45-Bio) is obtain at 5 ' the end couple biotin group of contrast nucleotide sequence L45, L45-Bio is dissolved with binding buffer liquid, after demarcating concentration (100nM) according to uv absorption, 95 DEG C of heating 5min, place 5min on ice, room temperature places 15min.The nucleotide sequence of contrast nucleotide sequence L45: TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN.
3, the extraction of aptamer Sgc-3b target proteins
(1) 2 × 10 are got respectively
8the heavy type isotope-labeled JurkatE6-1 cell of individual exponential phase and light-duty isotope-labeled JurkatE6-1 cell, after PBS washing, Sgc-3b (Sgc-3b-Bio) biotin labeled with 100nM and the biotin labeled nucleotide sequence L45 (L45-Bio) that contrasts hatch 30 minutes respectively, then add formaldehyde and fix 10 minutes.
(2) PBS washs 2 times, adds the cell pyrolysis liquid of 1mL, hatches 1 hour.
(3) 2000rpm centrifugal segregation precipitation, collects supernatant, adds the agarose microbeads (GE company, article No.: 17-5113-01) that Streptavidin is modified, hatches 1 hour, extracts target proteins.
(4) with PBS wash above-mentioned steps (3) hatch after Streptavidin modify agarose microbeads, wash 5 times, obtain the isotope-labeled albumen of heavy type of biotin labeled aptamer Sgc-3b extraction, the light-duty isotope-labeled albumen contrasting nucleotide sequence L45 extraction, the light-duty isotope-labeled albumen of biotin labeled aptamer Sgc-3b extraction and the isotope-labeled albumen of heavy type of contrast nucleotide sequence L45 extraction respectively.
4, forward and oppositely testing
(1) forward experiment: the isotope-labeled albumen of heavy type that biotin labeled aptamer Sgc-3b is extracted with contrast the light-duty isotope-labeled albumen that nucleotide sequence L45 extracts and mix, obtain the isotope-labeled albumen of heavy type of biotin labeled aptamer Sgc-3b extraction and contrast the light-duty isotope-labeled mixed system of nucleotide sequence L45 extraction.
(2) oppositely test: the light-duty isotope-labeled albumen that biotin labeled aptamer Sgc-3b is extracted with contrast the heavy type isotope-labeled albumen that nucleotide sequence L45 extracts and mix, obtain the light-duty isotope-labeled albumen of biotin labeled aptamer Sgc-3b extraction and contrast the isotope-labeled mixed system of heavy type of nucleotide sequence L45 extraction.
5, the enzymolysis of albumen and LC-MS qualification
(1) DTT reduction: add 200 μ L20mM dithiothreitol (DTT)s (DTT), 56 DEG C of reaction 45min in the light-duty isotope-labeled albumen that the light-duty isotope-labeled mixed system that the isotope-labeled albumen of heavy type extracted respectively to biotin labeled aptamer Sgc-3b and contrast nucleotide sequence L45 extract, biotin labeled aptamer Sgc-3b extract and the isotope-labeled mixed system of heavy type that contrast nucleotide sequence L45 extracts.
(2) IAA alkylation: by centrifugal for the product of step (1), abandons supernatant (removing DTT), in precipitation, adds 200 μ L55mM iodoacetamides (IAA) respectively, at 37 DEG C of lucifuge reaction 30min.
(3) by centrifugal for the product of step (2), abandon supernatant (removing IAA), in precipitation, add 5 μ g mass spectrum trypsase (Promega company, catalog number: V5111), 37 DEG C of enzymes cut through night, obtain enzyme cut after polypeptide.
(4) enzyme cut after polypeptide after Vacuum Concentration, add 100ul water, utilize ZiptipC
18microtrabeculae desalination.Before mass spectrophotometry, place-20 DEG C of refrigerators.
(5) utilize the product of LTQ-OrbitrapVelos mass spectrometer (ThermoFisherScientific, SanJose, CA) to step (4) to carry out Analysis and Identification, obtain original mass spectrometric data.
(6) data search analysis
Utilize original mass spectrometric data that step (5) obtains by MaxQuant search engine (version number: 1.3.0.5) in IPI albumen database (version number: retrieve 3.68).Some parameters of database search are as follows: immobilization is modified to alkylation on halfcystine and modifies, the variable acetylation modification being modified to oxidative modification on methionine and protein N terminal.Allow 2 leakages to cut site, the fault-tolerant amount of parent ion is 20ppm, MS/MS fragment ion masses error is 0.5Da.For the albumen of qualification candidate, have 2 or go out more than the peptide identification of the uniqueness of 2, and posteriority standard error (PEP) is less than 10-5.Candidate albumen need forward experiment and oppositely in experiment simultaneously identified go out.
The protein of table 1, the bind nucleic acid aptamers Sgc-3b utilizing SILAC to identify or contrast nucleotide sequence L45
[a]pEP represents posterior probability error;
[b]represent mean value and the standard deviation of twice forward experiment and twice reverse experiment ratio.
Result is as shown in table 1: SILAC (cold labeling technology) experimental identification goes out 18 albumen, aptamer Sgc-3b and random controls nucleotide sequence L45 extract the L that only has that protein abundance ratio is greater than 2 and select element, and all the other abundance ratios comprising 17 albumen of 7 Endogenous Biotin albumen are all less than 2.Illustrate aptamer Sgc-3b can specific identification and in conjunction with L select element.L selects the mass spectral results of element as shown in Figure 1: in forward experiment, heavy isotope-labeled L select element identified go out (m/z1036.5 is [M+2H]
2+the single isotopic peak of ion), Fig. 1 C is its MS/MS spectrogram; In reverse experiment, only have light-duty isotope-labeled L select element identified go out (m/z1032.5 is [M+2H]
2+the single isotopic peak of ion), Fig. 1 D is its MS/MS spectrogram.
Embodiment 2, flow cytometer showed method detect the binding ability that aptamer Sgc-3b and L selects element
One, the preparation of aptamer solution and the process of cell line
1, the preparation of fluorescein-labeled aptamer Sgc-3b solution (Sgc-3b-FAM) (100nM)
Fluorescein-labeled aptamer Sgc-3b obtains in 5 ' the end coupling fluorescein base group of aptamer Sgc-3b, Sgc-3b-FAM is dissolved with binding buffer liquid, after demarcating concentration (100nM) according to uv absorption, 95 DEG C of heating 5min, place 5min on ice, room temperature places 15min.
2, the anti-L of PE mark selects the preparation of plain antibody-solutions (anti-CD62L-PE)
The anti-L of PE mark selects plain antibody to be the product of eBioscience company, and each test adds 0.125 μ g, and concentration is 1.25 μ g/mL.
3, the preparation of fluorescein-labeled contrast nucleotide sequence solution (L45-FAM) (100nM)
Fluorescein-labeled contrast nucleotide sequence L45 (L45-FAM) is obtain in 5 ' the end coupling fluorescein base group of contrast nucleotide sequence L45, L45-FAM is dissolved with binding buffer liquid, after demarcating concentration (100nM) according to uv absorption, 95 DEG C of heating 5min, place 5min on ice, room temperature places 15min.The nucleotide sequence of contrast nucleotide sequence L45: TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN.
4, the preparation of fluorescein-labeled contrast aptamer solution (Sgc-4e-FAM) (100nM)
Fluorescein-labeled Sgc-4e (Sgc-4e-FAM) obtains in 5 ' the end coupling fluorescein base group of aptamer Sgc-4e, Sgc-4e-FAM is dissolved with binding buffer liquid, after demarcating concentration (100nM) according to uv absorption, 95 DEG C of heating 5min, place 5min on ice, room temperature places 15min.The nucleotide sequence of aptamer Sgc-4e: 5 '-TCACTTATTCAATTCGAGTGCGGATGCAAACGCCAGACAGGGGGACAGGAGATAAG TGA-3 '.
5, the preparation of mouse IgG1K Isotype control immunoglobulin solution (lgG-PE) of PE mark
The mouse IgG1K Isotype control immunoglobulin (Ig) of PE mark is the product of eBioscience company, and each test adds 0.125 μ g, and concentration is 1.25 μ g/mL.
6, the cultivation of human leukemia cell JurkatE6-1
By human leukemia cell JurkatE6-1 containing 10%FBS, 1% penicillin and streptomysin RPMI1640 nutrient culture media in, 37 DEG C, cultivate in cell culture incubator under the condition of the carbon dioxide of 5%; Get the human leukemia cell JurkatE6-1 of exponential phase, directly dispel the washing of rear lavation buffer solution, be equally divided into some parts, every part of cell number is 5 × 10
4individual.
Two, flow cytometer showed method detects the binding ability that aptamer Sgc-3b and L selects element
1, above-mentioned JurkatE6-1 cell is carried out following four groups respectively to process:
First group: in the 100 μ L binding buffer liquid containing lgG-PE (1.25 μ g/mL) and L45-FAM (100nM), hatch JurkatE6-1 cell;
Second group: in the 100 μ L binding buffer liquid containing anti-CD62L-PE (1.25 μ g/mL) and L45-FAM (100nM), hatch JurkatE6-1 cell;
3rd group: in the 100 μ L binding buffer liquid containing lgG-PE (1.25 μ g/mL) and Sgc-3b-FAM (100nM), hatch JurkatE6-1 cell;
4th group: in the 100 μ L binding buffer liquid containing anti-CD62L-PE (1.25 μ g/mL) and Sgc-3b-FAM (100nM), hatch JurkatE6-1 cell.
2, flow cytometer is analyzed
Respectively the cell after above-mentioned four groups of process is analyzed with flow cytometer.Above-mentioned Setup Experiments three of often organizing independently repeats experiment.
The testing result of flow cytometer is as shown in Figure 2: first group is control antibodies (lgG-PE) and contrast nucleotide sequence (L45-FAM) and the situation of Cell binding; Second group is deposit in case in contrast nucleotide sequence (L45-FAM), and anti-L selects the situation of plain antibody (anti-CD62L-PE) and Cell binding; 3rd group for deposit in case in control antibodies (lgG-PE), the situation of aptamer Sgc-3b-FAM and Cell binding; The 4th group of situation being anti-L and selecting with Cell binding in plain antibody anti-CD62L-PE and the simultaneous situation of aptamer Sgc-3b-FAM.Illustrate that aptamer Sgc-3b can select element to combine with L by above-mentioned four groups of results, aptamer Sgc-3b can substitute anti-L and select plain antibody to use.
Three, flow cytometer showed method detects the competition that the aptamer Sgc-3b of variable concentrations and anti-L selects plain antibody
1, above-mentioned JurkatE6-1 cell is carried out following three groups respectively to process:
First group: in the 100 μ L binding buffer liquid containing anti-CD62L-PE (1.25 μ g/mL) and L45-FAM (100nM), hatch JurkatE6-1 cell;
Second group: in the 100 μ L binding buffer liquid containing anti-CD62L-PE (1.25 μ g/mL) and Sgc-3b-FAM (100nM), hatch JurkatE6-1 cell;
3rd group: in the 100 μ L binding buffer liquid containing anti-CD62L-PE (1.25 μ g/mL) and Sgc-3b-FAM (1000nM), hatch JurkatE6-1 cell.
2, flow cytometer is analyzed
Respectively the cell after above-mentioned three groups of process is analyzed with flow cytometer.Above-mentioned Setup Experiments three of often organizing independently repeats experiment.
The testing result of flow cytometer is as shown in Figure 3: first group for random exist according to nucleotide sequence (L45-FAM) time, anti-L selects plain antibody (anti-CD62L-PE) and Cell binding situation; Second group is under the aptamer Sgc-3b-FAM existent condition of same concentrations, and anti-L selects plain antibody (anti-CD62L-PE) and Cell binding situation, its FL2 fluorescence intensity comparatively first group obviously to left dislocation; 3rd group is the concentration of aptamer Sgc-3b-FAM when being 1000nM, anti-L select plain antibody (anti-CD62L-PE) completely not with Cell binding.This illustrates that aptamer Sgc-3b can compete the combination of anti-CD62L-PE antibody and cell, and random controls nucleotide sequence L-45 is without impact.
Four, flow cytometer showed method detects the competition that anti-L selects plain antibody and aptamer Sgc-3b
1, above-mentioned JurkatE6-1 cell is carried out following two groups respectively to process:
First group: in containing the 100 μ L Cell binding liquid of Sgc-3b-FAM (100nM), hatch JurkatE6-1 cell;
Second group: in the 100 μ L Cell binding liquid containing anti-CD62L-PE (5 μ g/mL) and Sgc-3b-FAM (100nM), hatch JurkatE6-1 cell.
2, flow cytometer is analyzed
Respectively the cell after above-mentioned two groups of process is analyzed with flow cytometer.Above-mentioned Setup Experiments three of often organizing independently repeats experiment.
The testing result of flow cytometer is as shown in Figure 4: when in binding buffer liquid only containing aptamer Sgc-3b-FAM time, FL1 channel fluorescence is stronger; And the anti-L adding 5 μ g/mL is when selecting plain antibody, its FL1 channel fluorescence is to left dislocation; This illustrates that antibody anti-CD62L can compete the combination of aptamer Sgc-3b and cell.
Above description of test aptamer Sgc-3b and L selects the binding site of element may consistent with antibody anti-CD62L-PE, or its combination interferes with each other, and aptamer Sgc-3b can substitute antibody anti-CD62L-PE and use.
Five, flow cytometer showed method detects the change in fluorescence after reducing the expression of L selection element
1, the L utilizing siRNA technology to reduce JurkatE6-1 cell selects element (NP_000646 submits day to: on April 28th, 2015) in the expression of cell surface, obtains L and selects element to express the JurkatE6-1 cell reduced.
It is that concrete steps are as follows with the preparation of siRNA kit that L selects element to express the JurkatE6-1 cell reduced:
SELLsiRNA for reducing L select element expression, without target random siRNA sequence in contrast, GEDharmacon company of the Jun Shi U.S. synthesize product.
The concrete steps of siRNA electrotransfection are as follows: the JurkatE6-1 cell about 2 × 10 in selection index growth period
5individual cell, adds SELLsiRNA and the contrast siRNA of 80pmol respectively, utilizes
cellLine
kitV kit and the X-001 program (Amaxa, Lonza) provided complete electrotransfection, obtain L and select element to express the JurkatE6-1 cell reduced.
The cell of above-mentioned process cultured cell in 37 DEG C of carbon dioxide cell incubators containing 5% was used flow cytomery after 72 hours.
2, the JurkatE6-1 cell (SiSELL) being selected by above-mentioned L element expression to reduce and JurkatE6-1 cell (SiControl, compared with control cells) carry out following six groups respectively and process:
First group: in containing the 100 μ L binding buffer liquid of anti-CD62L-PE (1.25 μ g/mL), hatch the JurkatE6-1 cell that L selects element expression reduction;
Second group: in containing the 100 μ L binding buffer liquid of anti-CD62L-PE (1.25 μ g/mL), hatch JurkatE6-1 cell.
3rd group: in containing the 100 μ L binding buffer liquid of Sgc-3b-FAM (100nM), hatch the JurkatE6-1 cell that L selects element expression reduction;
4th group: in containing the 100 μ L binding buffer liquid of Sgc-3b-FAM (100nM), hatch JurkatE6-1 cell;
5th group: in containing the 100 μ L binding buffer liquid of Sgc-4e-FAM (100nM), hatch the JurkatE6-1 cell that L selects element expression reduction;
6th group: in containing the 100 μ L binding buffer liquid of Sgc-4e-FAM (100nM), hatch JurkatE6-1 cell.
3, flow cytometer is analyzed
Respectively the cell after above-mentioned six groups of process is analyzed with flow cytometer.Above-mentioned Setup Experiments three of often organizing independently repeats experiment.
Result is as shown in Figure 5: as can be seen from the figure, the fluorescence intensity of cell culture fluid containing anti-CD62L-PE or Sgc-3b-FAM after siRNA cell fluorescence intensity before treatment is all greater than process, and positive control aptamer Sgc-4e-FAM before and after the siRNA process without significant change.Illustrate that Jurkat6E-6 cell is after siRNA process, its L selects the expression of element to reduce, consistent with TPPA result by Sgc-3b-FAM measurement result.
Embodiment 3, aptamer Sgc-3b select the application in plain expression at the L measuring dissimilar cell
One, the preparation of fluorescein-labeled aptamer Sgc-3b solution (Sgc-3b-FAM)
Dissolve Sgc-3b-FAM with binding buffer liquid, after demarcating concentration (100nM) according to uv absorption, 95 DEG C of heating 5min, place 5min on ice, room temperature places 15min.
Two, the pre-service of cell line
Get each ware of cell line of following 16 kinds of growth logarithmic phases respectively: growth rat alveolar epithelial cells (RAEC), human embryonic lung's fibrocyte (MRC-5), people's alveolar epithelial cells (A549), human cervical carcinoma cell (Hela), human liver cancer cell (Huh-7), human bladder cancer cell (T24), human liver cell cancer cell (SK-Hep-1), human breast cancer cell (MCF-7), resistance human breast cancer cell (MCF-7R), Proliferation of Human Ovarian Cell (SKOV-3), human breast cancer cell (MDA-MB-231), human epithelial cancer cells (A431), people's ileocecum adenocarcinoma cell (HCT-8), human embryonic kidney cell (HEK-293), Human Prostate Cancer Cells (PC-3) and human colon cancer cell (LoVo), after being digested to single dispersing cell suspension with 0.2%EDTA, 2 times are washed with lavation buffer solution, be divided into some parts, every part of cell number is 5 × 10
4individual, respectively the human leukemia cell (JurkatE6-1) of suspension growth, human leukemia cell (K562), human T cells lymthoma (Hut-78), acute lymphoblastic leukemia cell (Molt-4), human T lymphoma cell (Sup-T1), human B cell lymphoma cell (Mo2058) are directly dispelled rear lavation buffer solution and wash 2 times, be equally divided into some parts, every part of cell number is 5 × 10
4individual.
The fluorescein-labeled aptamer Sgc-3b (Sgc-3b-FAM) of three, the step one of embodiment 2 being prepared, fluorescein-labeled contrast nucleotide sequence L-45 (L45-FAM), control antibodies (lgG-PE) and anti-L select plain antibody (purchased from eBioscience company, catalog number: 12-0629) mix with the clone of 22 kinds of separate sources respectively, obtain mixed liquor respectively, mixed liquor is hatched 30min on ice, with lavation buffer solution washing twice, after crossing 400 eye mesh screens, flow cytometer detects.
The fluorescence intensity data of first passage is collected, as the fluorescence intensity of cell surface with the FACSCalibur flow cytometer of BD company.The instrument of each sample records fluorescence intensity deduction cell autofluorescence, obtains the fluorescence intensity that each sample is combined in the aptamer of cell surface.Set a threshold value, percentage of cells is had and is greater than the cell fluorescence intensity value of the contrast nucleotide sequence L-45 process of 95% lower than this threshold value.What cell fluorescence intensity value was greater than this threshold value is considered as aptamer and cell energy specific binding.After being combined using cell with aptamer, fluorescence intensity exceedes the percentage of cells of this threshold value as weighing aptamer and Cell binding ability power.Wherein, nothing: the percentage of cells that the fluorescence intensity after cell to be measured is combined with aptamer exceedes this threshold value is less than 15%; Medium: the percentage of cells that the fluorescence intensity after cell to be measured is combined with aptamer exceedes this threshold value is 15-60%; Strong: the percentage of cells that the fluorescence intensity after cell to be measured is combined with aptamer exceedes this threshold value is greater than 60%.
Result is as shown in table 2: aptamer Sgc-3b measurement result and anti-L select plain TPPA result completely the same.Illustrate that aptamer Sgc-3b can substitute anti-L and select plain TPPA L to select element.
Table 2, anti-L select plain antibody and aptamer Sgc-3b to measure dissimilar cell L and select plain expression
Claims (10)
1. aptamer or derivatives thereof is identifying and is combining or aid identification select the application in element in conjunction with L;
Or aptamer or derivatives thereof identifies in preparation and combines or aid identification application in the product plain in conjunction with L selection;
Described aptamer is the single strand dna shown in sequence 1.
2. aptamer or derivatives thereof is detecting or whether is containing the application in L selection element in auxiliary detection testing sample;
Or aptamer or derivatives thereof detects in preparation or whether contains the application in the product of L selection element in auxiliary detection testing sample;
Described aptamer is the single strand dna shown in sequence 1.
3. aptamer or derivatives thereof is in the application detected or in auxiliary detection testing sample in L selection cellulose content;
Or aptamer or derivatives thereof L in preparation detection or auxiliary detection testing sample selects the application in the product of cellulose content;
Described aptamer is the single strand dna shown in sequence 1.
4. aptamer or derivatives thereof is detecting the application in the material selecting the antibody of element to be combined with anti-L;
Or aptamer or derivatives thereof detects the application in the product of the material selecting the antibody of element to be combined with anti-L in preparation;
Described aptamer is the single strand dna shown in sequence 1.
5. aptamer or derivatives thereof is diagnosed in preparation and/or is treated the application in the product of inflammatory disease or immunity disease;
Described aptamer is the single strand dna shown in sequence 1.
6. according to described application arbitrary in claim 1-5, it is characterized in that: described derivant is the derivant of the arbitrary described aptamer in following (1)-(6):
(1) aptamer shown in sequence 1 deleted or increase one or several nucleotide, obtaining the derivant of the aptamer with described aptamer with identical function;
(2) aptamer shown in sequence 1 is carried out nucleotide replacement or modification, obtain the derivant of the aptamer with described aptamer with identical function;
(3) transform the skeleton of the aptamer shown in sequence 1 as phosphorothioate ester skeleton, obtain the derivant of the aptamer with described aptamer with identical function;
(4) RNA molecule of being encoded by the aptamer shown in sequence 1, obtains the aptamer derivant with described aptamer with identical function;
(5) peptide nucleic acid of being encoded by the aptamer shown in sequence 1, obtains the derivant of the aptamer with described aptamer with identical function;
(6) one end of the aptamer shown in sequence 1 or centre are connected signaling molecule and/or bioactive molecule and/or functional group, obtain the derivant of the aptamer with described aptamer with identical function;
Functional group in described (6) is biotin group or fluorophor.
7., according to described application arbitrary in claim 1-6, it is characterized in that: described testing sample is cell, described cell is specially rat alveolar epithelial cells RAEC, human embryonic lung's fibrocyte MRC-5, people's alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, Proliferation of Human Ovarian Cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, human t-cell leukemia's cell JurkatE6-1, people's ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, Human Prostate Cancer Cells PC-3, human T cells lymthoma Hut-78, human colon cancer cell LoVo, acute lymphoblastic leukemia cell Molt-4, human T lymphoma cell Sup-T1 or human B cell lymphoma cell Mo2058.
8. a product, its active component is the aptamer or derivatives thereof shown in sequence 1; The purposes of described product is following 1)-5) at least one:
1) identify and combine or aid identification and in conjunction with L select element;
2) to detect or material that auxiliary detection and anti-L select plain antibody to be combined;
3) detect or auxiliary detection testing sample in L select element content;
4) detect or whether select element containing L in auxiliary detection testing sample;
5) diagnose and/or treat inflammatory disease or immunity disease.
9. product according to claim 8, is characterized in that: described derivant is the derivant of the arbitrary described aptamer in following (1)-(6):
(1) aptamer shown in sequence 1 deleted or increase one or several nucleotide, obtaining the derivant of the aptamer with described aptamer with identical function;
(2) aptamer shown in sequence 1 is carried out nucleotide replacement or modification, obtain the derivant of the aptamer with described aptamer with identical function;
(3) transform the skeleton of the aptamer shown in sequence 1 as phosphorothioate ester skeleton, obtain the derivant of the aptamer with described aptamer with identical function;
(4) RNA molecule of being encoded by the aptamer shown in sequence 1, obtains the aptamer derivant with described aptamer with identical function;
(5) peptide nucleic acid of being encoded by the aptamer shown in sequence 1, obtains the derivant of the aptamer with described aptamer with identical function;
(6) one end of the aptamer shown in sequence 1 or centre are connected signaling molecule and/or bioactive molecule and/or functional group, obtain the derivant of the aptamer with described aptamer with identical function;
Described functional group is biotin group or fluorophor.
10. product according to claim 8 or claim 9, is characterized in that: described testing sample is cell, described cell is specially rat alveolar epithelial cells RAEC, human embryonic lung's fibrocyte MRC-5, people's alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, Proliferation of Human Ovarian Cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, human t-cell leukemia's cell JurkatE6-1, people's ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, Human Prostate Cancer Cells PC-3, human T cells lymthoma Hut-78, human colon cancer cell LoVo, acute lymphoblastic leukemia cell Molt-4, human T lymphoma cell Sup-T1 or human B cell lymphoma cell Mo2058.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354158.3A CN105044322B (en) | 2015-06-24 | 2015-06-24 | Aptamer application in identifying and combine L selection element |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354158.3A CN105044322B (en) | 2015-06-24 | 2015-06-24 | Aptamer application in identifying and combine L selection element |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105044322A true CN105044322A (en) | 2015-11-11 |
| CN105044322B CN105044322B (en) | 2016-09-07 |
Family
ID=54451029
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510354158.3A Active CN105044322B (en) | 2015-06-24 | 2015-06-24 | Aptamer application in identifying and combine L selection element |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105044322B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624166A (en) * | 2016-01-31 | 2016-06-01 | 湖南大学 | Nucleic acid aptamer for detecting human bladder transitional cell carcinoma cells and application of nucleic acid aptamer to preparation of detection preparations |
| CN106191069A (en) * | 2016-07-14 | 2016-12-07 | 中国科学院化学研究所 | A kind of aptamer sequence identifying and combine human TfR and application thereof |
| CN106520773A (en) * | 2016-11-30 | 2017-03-22 | 吴冬 | The aptamer WYZ 3 of ovarian mucinous cancerous cell 3AO and its screening technique and application |
| CN106591314A (en) * | 2016-11-30 | 2017-04-26 | 吴冬 | Nucleic acid aptamer WYZ-4 of ovarian mucinous cancer cells 3AO and screening method and application thereof |
| CN107085110A (en) * | 2017-05-31 | 2017-08-22 | 江西乐成生物医疗有限公司 | One kind is used for thyroid cancer external diagnosis reagent case and its detection method |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002077262A2 (en) * | 2001-03-22 | 2002-10-03 | Somalogic, Inc. | Method and apparatus for the automated generation of nucleic acid ligands |
| US20040043923A1 (en) * | 1990-06-11 | 2004-03-04 | Gilead Sciences, Inc. | High affinity nucleic acid ligands to lectins |
| CN101538613A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Molecular probe related to disease and method for producing the same |
| CN101537189A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Aptamer and new use of derivative thereof |
| CN102251036A (en) * | 2011-07-07 | 2011-11-23 | 中国人民解放军总医院 | Method for simultaneously detecting 17 genes |
-
2015
- 2015-06-24 CN CN201510354158.3A patent/CN105044322B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040043923A1 (en) * | 1990-06-11 | 2004-03-04 | Gilead Sciences, Inc. | High affinity nucleic acid ligands to lectins |
| WO2002077262A2 (en) * | 2001-03-22 | 2002-10-03 | Somalogic, Inc. | Method and apparatus for the automated generation of nucleic acid ligands |
| CN101538613A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Molecular probe related to disease and method for producing the same |
| CN101537189A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Aptamer and new use of derivative thereof |
| CN102251036A (en) * | 2011-07-07 | 2011-11-23 | 中国人民解放军总医院 | Method for simultaneously detecting 17 genes |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624166A (en) * | 2016-01-31 | 2016-06-01 | 湖南大学 | Nucleic acid aptamer for detecting human bladder transitional cell carcinoma cells and application of nucleic acid aptamer to preparation of detection preparations |
| CN105624166B (en) * | 2016-01-31 | 2018-05-04 | 湖南大学 | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared |
| CN106191069A (en) * | 2016-07-14 | 2016-12-07 | 中国科学院化学研究所 | A kind of aptamer sequence identifying and combine human TfR and application thereof |
| CN106191069B (en) * | 2016-07-14 | 2019-03-01 | 中国科学院化学研究所 | A kind of aptamer sequence and its application identified and combine human TfR |
| CN106520773A (en) * | 2016-11-30 | 2017-03-22 | 吴冬 | The aptamer WYZ 3 of ovarian mucinous cancerous cell 3AO and its screening technique and application |
| CN106591314A (en) * | 2016-11-30 | 2017-04-26 | 吴冬 | Nucleic acid aptamer WYZ-4 of ovarian mucinous cancer cells 3AO and screening method and application thereof |
| CN106520773B (en) * | 2016-11-30 | 2019-01-25 | 吴冬 | The aptamer WYZ-3 and its screening technique of ovarian mucinous cancer cell 3AO and application |
| CN106591314B (en) * | 2016-11-30 | 2019-02-12 | 吴冬 | The aptamer WYZ-4 and its screening technique of ovarian mucinous cancer cell 3AO and application |
| CN107085110A (en) * | 2017-05-31 | 2017-08-22 | 江西乐成生物医疗有限公司 | One kind is used for thyroid cancer external diagnosis reagent case and its detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105044322B (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Darmostuk et al. | Current approaches in SELEX: An update to aptamer selection technology | |
| CN105044322A (en) | Application of aptamer in recognition of L selectin and combination with L selectin | |
| Liu et al. | An aptamer-based probe for molecular subtyping of breast cancer | |
| Xu et al. | MicroRNAs in extracellular vesicles: sorting mechanisms, diagnostic value, isolation, and detection technology | |
| CN104988154B (en) | Application of the aptamer in identifying and combining integrin alpha 4 | |
| Bing et al. | Cell‐SELEX, an effective way to the discovery of biomarkers and unexpected molecular events | |
| CN106191069B (en) | A kind of aptamer sequence and its application identified and combine human TfR | |
| CN104293794B (en) | Nucleic acid aptamers specifically combined with beta-amyloid precursor protein lyase 1 and application of aptamers | |
| AU2775402A (en) | Nucleic acid ligands to complex targets | |
| CN103387990A (en) | Aptamer EpCAM (epithelial cell adhesion molecule) B of EpCAM and preparation method thereof | |
| CN108866061A (en) | A kind of aptamer identifying liver cancer cells and its screening technique and purposes | |
| CN109337909A (en) | It is a kind of detect liver cancer drug-resistant cell strain aptamer and its application | |
| CN101538570A (en) | Aptamer for typing different subtypes of non-small cell lung cancer and method for screening the same | |
| CN108866062A (en) | The DNA aptamers and its screening technique of a kind of specific recognition liver-cancer stem cell and application | |
| CN104561008A (en) | Homocysteine aptamer HCy1 and preparation method thereof | |
| WO2019149115A1 (en) | Use of nucleic acid aptamer in alkaline phosphatase heterodimer recognition and binding or in tumor detection | |
| CN105755005A (en) | Aptamer for osteosarcoma detection and kit for osteosarcoma detection | |
| CN112501173A (en) | GPC1DNA aptamer and application thereof | |
| CN109576274A (en) | A kind of Endoglin aptamer and application based on CRISPR/Cas9 | |
| CN104480114B (en) | The method of high performance liquid chromatography screening aptamer and aptamer and application | |
| CN103911379B (en) | Nucleic acid aptamer, derivatives, screening method and application thereof | |
| JP2023100770A (en) | Manufacturing device and manufacturing method for exosome liquid biopsy sample | |
| CN109402127A (en) | One group of high affinity nucleic acid aptamers and its application specifically bound with Connective Tissue Growth Factor | |
| CN109576272A (en) | A kind of DKK-1 aptamer and its application | |
| CN104561010B (en) | Homocysteine aptamer HCy5 and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |