CN108866062A - The DNA aptamers and its screening technique of a kind of specific recognition liver-cancer stem cell and application - Google Patents

Abstract

The invention discloses a kind of DNA aptamers of specific recognition liver-cancer stem cell and its screening technique and application, the nucleotide sequence of the DNA aptamers includes the characteristic sequence part as shown in Seq ID No.1.The screening technique includes the following steps：Utilize aptamer in-vitro screening technology, it is positive with CD133 positive expression hepatoma cell strain and sieves target, it is negative with CD133 feminine gender expression liver-cancer stem cell and sieves target, the aptamer with the hepatoma cell strain specific bond is filtered out from the random oligomerization library synthesized in vitro.DNA aptamers of the invention can be applied in design, the drug of preparation anti-liver cancer and anti-or detection reagent.Compared with prior art, DNA aptamers of the invention have the advantages that specificity is good, performance is stable and preparation cost is low etc..

Description

A DNA aptamer that specifically recognizes liver cancer stem cells and its screening method and application

technical field

The invention relates to the field of biomedicine, in particular to a DNA aptamer that specifically recognizes liver cancer stem cells and a screening method and application thereof.

Background technique

Primary liver cancer is one of the most common and most malignant tumors in the world, one of the fifth most common cancers in the world, and the death rate ranks third. China is the country with the largest number of new cases of liver cancer. Its 5-year survival rate is less than 5%, and the incidence rate is still increasing year by year, which brings a heavy economic burden to the society. At present, the main treatment methods for liver cancer include surgery, liver transplantation, radiofrequency ablation and hepatic arterial chemoembolization, among which surgery and liver transplantation are relatively the most mature treatment methods. Surgical treatment is the first choice for the treatment of liver cancer because it can be cured. However, postoperative recurrence is a problem that cannot be solved so far, and the recurrence rate is extremely high. For liver cancer patients with liver cirrhosis, liver transplantation is the most promising treatment, but due to the shortage of donor livers, the development of liver transplantation is greatly restricted. In summary, due to the limitations of various treatment methods, the survival rate of patients with liver cancer is low, and it is urgent to further develop new treatment methods combined with the study of the pathogenesis of liver cancer.

The tumor stem cell hypothesis believes that there is a small number of tumor stem cells in tumor tissue, which is considered to be the root cause of tumor proliferation, invasion, metastasis and recurrence. At present, tumor stem cells have been successfully isolated from various tumors such as leukemia, breast cancer, lung cancer, brain tumor, colorectal cancer, and prostate cancer. The existence of tumor stem cells in liver cancer is closely related to its characteristics of refractory, recurrence and drug resistance, and these characteristics also indicate that liver cancer is also a disease of tumor stem cells. , and drug resistance play an important role.

CD133/prominin-1 is a surface marker of hematopoietic stem cells and neural stem cells. Recent studies have found that CD133 is also expressed in tumor stem cells of various solid tumors and plays a variety of biological roles in vivo, and studies have shown that CD133 is an important marker of liver cancer stem cells. Nucleic acid aptamer is a nucleic acid molecule composed of DNA/RNA single strands, which can specifically recognize a single protein or small molecule. It has affinity and specificity comparable to antibodies, and at the same time has advantages that antibodies cannot match, such as It is not easily denatured by environmental factors such as pH and temperature and is cheap; it can be screened in vitro; it has no immunogenicity and toxicity, and can be prepared, modified and labeled by chemical synthesis; it has good chemical stability and can reversible denaturation and renaturation. Through enzyme amplification, cleavage, etc., these advantages make it have broad application prospects in the field of biomedicine.

Therefore, it is of great significance to find out a nucleic acid aptamer specific for liver cancer and apply it to the early detection of liver cancer, molecular imaging, and targeted delivery of drugs.

Contents of the invention

The purpose of the present invention is to provide a DNA aptamer with high specificity and stable performance for specific recognition of liver cancer stem cells and its screening method and application. The aptamer can specifically recognize the liver cancer PLC8024 cell line with positive expression of CD133 and its derivatives.

A DNA aptamer specifically recognizing liver cancer stem cells, the nucleotide sequence of the DNA aptamer includes the characteristic sequence part shown in Seq ID No.1.

Further, the liver cancer stem cells are selected from the liver cancer stem cells expressing CD133.

Further, the liver cancer stem cells are selected from PLC8024 liver cancer cell line.

The beneficial effect of the present invention is that: the nucleic acid aptamer of the present invention that can identify liver cancer cell lines can specifically recognize liver cancer tissue, and provide new ideas for the diagnosis, prediction and treatment of liver cancer with CD133 positive expression, especially for liver cancer Early detection is important.

The present invention also includes the above-mentioned DNA aptamer screening method, comprising the following steps: using in vitro nucleic acid aptamer screening technology, using CD133-positive liver cancer cell lines as positive screening targets, and using CD133-negative liver cancer stem cell lines as negative screening targets, The nucleic acid aptamer specifically combined with the liver cancer cell line was screened from a random oligomeric library synthesized in vitro.

Further, the screening method specifically includes the following steps:

S1. Synthesizing a random single-stranded library and primers: the random single-stranded library is:

ACCTTGGCTGTCGTGTTGT-25nt-AGGTCAGTGGTCAGAGCGT, the primers include 5' primer: 5'-FAM-ACCTTGGCTGTCGTGTTGT and 3' primer: 3'-Biotin-ACGCTCTGACCACTGACCT;

S2. Nucleic acid aptamer screening: incubate the random single-stranded library with liver cancer stem cells. After the incubation, collect the PLC8024 cell line and heat denature to separate the aptamer bound to the cell line, which is the nucleic acid aptamer obtained by screening. body-level library;

S3. Positive screening: incubate the supernatant of the primary nucleic acid aptamer library obtained in step S2 with the positive screening target, elute the high-affinity aptamer group bound to the surface of the target cells, and obtain enriched aptamers after amplification Positive screening aptamer library that specifically binds to target cells;

S4. Negative screening: incubate the positive screening aptamer library obtained in step S3 with the negative screening target, collect the supernatant after incubation of the cells after incubation, and obtain the enriched negative screening that specifically binds to the target cells Aptamer library;

S5. Analyze and identify the selectivity and affinity of each sequence of the negative screening aptamer library obtained in step S4, and finally obtain a DNA aptamer with a characteristic sequence as shown in Seq ID No.1.

Preferably, the screening method specifically includes the following steps:

S11. Synthesizing a random single-stranded library and primers: the random single-stranded library is:

ACCTTGGCTGTCGTGTTGT-25nt-AGGTCAGTGGTCAGAGCGT, the primers include 5' primer: 5'-FAM-ACCTTGGCTGTCGTGTTGT and 3' primer: 3'-Biotin-ACGCTCTGACCACTGACCT;

S21. Nucleic acid aptamer screening: incubate the random single-stranded library with liver cancer stem cells. After the incubation, collect the PLC8024 cell line and heat denature to separate the aptamer bound to the cell line, which is the nucleic acid aptamer obtained by screening. body-level library;

S31. PCR amplified library: performing PCR amplification on the nucleic acid aptamer primary library to obtain an amplified product;

S41. Positive screening: incubate the supernatant of the amplified product obtained in step S31 with the CD133-positive PLC8024 cell line, elute the high-affinity aptamer group bound to the surface of the target cell, and obtain enriched aptamers after amplification. Positive screening aptamer library for target cell specific binding;

S51. Negative screening: incubate the positive screening aptamer library obtained in step S41 with the CD133-negative PLC8024 cell line, and collect the supernatant after the incubation of the cells to obtain the enriched aptamer that specifically binds to the target cells aptamer library;

S61. Circular screening of nucleic acid aptamers: repeating steps S11 to S51 at least once, replacing random libraries with amplified products, until the affinity selectivity between the obtained aptamer library and target cells no longer increases;

S71. Sequencing identification: clone and sequence the aptamer library obtained in the step S61, respectively identify the selectivity and affinity of each sequence, and finally obtain a DNA aptamer with a characteristic sequence as shown in Seq ID No.1. Further, the screening method also includes the step of sorting liver cancer stem cells before the screening operation starts, specifically: after labeling PLC8024 liver cancer cell line with CD133 antibody, use flow cytometry to sort CD133-positive PLC8024 liver cancer stem cells as targets .

The beneficial effect of the present invention is that: the nucleic acid aptamer screened by the scheme of the present invention has higher affinity and specificity than the protein antibody without immunogenicity, can be chemically synthesized in vitro, has a small molecular weight, and can modify and replace different parts , and the sequence is stable, easy to store and easy to label, and the secondary antibody does not need to be labeled.

The present invention also includes the application of the above-mentioned DNA aptamer in the design and preparation of anti-liver cancer drugs or detection reagents.

The beneficial effect of the present invention is that when using the nucleic acid aptamer of the present invention to detect liver cancer cells, the operation is simpler and faster, and the synthesis cost of the nucleic acid aptamer of the present invention is lower than that of antibody preparation, and the cycle is short and reproducible. Good performance; the characteristic sequence of the nucleic acid aptamer of the present invention can be used as a molecular probe or drug target against liver cancer, which will provide strong support for molecular diagnosis and targeted therapy of liver cancer, and has important clinical value.

Detailed ways

In order to describe in detail the technical content, structural features, achieved objectives and effects of the present invention, the following will be described in detail in conjunction with the embodiments.

An embodiment of the present invention is: a DNA aptamer that specifically recognizes liver cancer stem cells and a screening method thereof, the nucleotide sequence of the DNA aptamer includes AGGAGGTTAGGGGTGGGTGGGTGGT, and the screening method includes the following steps:

1. Initial DNA library (i.e. primary library) preparation:

Design and synthesize two ends containing 19 nucleotides (primers), including a nucleic acid sequence random nucleic acid library and amplification primers of 25 nucleotide random sequences in the middle, as follows:

ACC TTG GCT GTC GTG TTG T (as shown in Seq ID No.2)-25nt-A GGT CAG TGG TCAGAG CGT (as shown in Seq ID No.3)

5' primer: ACC TTG GCT GTC GTG TTG T (as shown in Seq ID No.4)

3' primer: ACG CTC TGA CCA CTG ACC T' (as shown in Seq ID No.5)

2. Target Cell Preparation

2.1 Use the trypan blue staining experiment to determine the viability of liver cancer cells, and at the same time determine the number of cells used for incubation.

2.2 The library was incubated with liver cancer cells, and candidate aptamers were screened. Use the binding buffer to dissolve the random nucleic acid library above, the binding buffer solution is prepared with DPBS buffer, containing 5mM magnesium chloride, 4.5g/L glucose, 0.1mg/mL yeast tRNA and 1mg/mL bovine serum albumin (bovine serum albumin, BSA) . Shake at a constant temperature of 95°C for 5 minutes, quickly put it on ice, and then incubate with the cultured and pretreated PLC8024 cell line on ice for 1 hour.

2.3 Dissociate and elute the bound sequence. After the incubation, pour out the liquid in the incubation flask, wash and incubate with washing buffer (the washing buffer is prepared with DPBS buffer, containing 5mM magnesium chloride and 4.5g/L glucose) Cells in culture flasks. Scrape the cell pellet with DNase-free water, heat the cell and DNA mixture at 95°C for 10 minutes, heat denature and separate the aptamers bound to the cell surface, centrifuge at 13,000 rpm for 5 minutes, and collect the supernatant as the specific nucleic acid aptamer for liver cancer cells obtained by screening library.

3. Library amplification: Perform PCR amplification on the library, and take 100 μL of DNA aptamers that specifically bind to PLC8024 cells obtained through the above-mentioned screening. Amplify for 16 cycles, and then perform the amplification in this step to obtain the amplified product.

4. Digest the double-stranded DNA obtained by PCR amplification into a single-stranded DNA library.

5. Obtain candidate aptamers through multiple rounds of positive screening and negative screening processes, wherein the operation steps of the positive screening process are as follows: incubate the supernatant of the amplified product in the step with the CD133-positive PLC8024 cell line, wash The high-affinity aptamer group decombined on the surface of the target cell is amplified to obtain an enriched positive screening aptamer group library that specifically binds to the target cell;

The operation steps of the negative screening process are as follows: incubate the above-mentioned positive screening aptamer library with the CD133-negative PLC8024 cell line, collect the supernatant after the incubation of the cells after incubation, and obtain the enriched aptamer that specifically binds to the target cells aptamer library.

6. After completing the screening process, the final product was sequenced after TOPO-TA amplification, and the sequencing results were analyzed to obtain a highly enriched aptamer:

5'-AGGAGGTTAGGGGTGGGTGGGTGGT-3'

7. Identification of aptamer specificity and clinical significance

7.1 Use the original DNA library sequence as a negative sequence control to synthesize aptamers with 5'FAM fluorescent molecules and control aptamers.

7.2 Incubate 3×10 ⁵ PLC8024 cells with 250 nM fluorescent aptamer and control library in 200 μL binding buffer at 4 °C for 1 h.

7.3 After incubation, wash 3 times with 500 μL elution buffer for 5 min each time, resuspend with 500 μL elution buffer after washing, and measure the fluorescence intensity of the cells by flow cytometry.

7.4 Observation of aptamer binding specificity by fluorescence microscope, 1.5×10 ⁵ cells were planted in a 35 mm diameter petri dish, grown for 24 hours, after the residual medium was eluted with elution buffer, 250 nM fluorescently labeled aptamer and The control library was dissolved in 1 mL of binding buffer, incubated at 4°C for 1 h, and the binding of the aptamer was observed with a fluorescence microscope. The observation results showed that the aptamer of the sequence of the present invention has a strong binding force to the PLC8024 cell line.

7.5 Immunohistochemistry

Take the paraffin blocks of the tumor and paracancerous tissues of the liver cancer patients, dewax the sections with xylene, and then hydrate them with graded alcohols (100%, 95%, 90%, 80% and 70%) for 5 min at each concentration, and then After washing with DPBS solution for 5 min, the sample was treated with 0.01 mol/L, pH 6.0 citrate solution at 95°C for 20 min to restore the antigen, and left at room temperature until natural cooling. The blocking solution was prepared with binding buffer (adding 20% fetal bovine serum (FBS), 0.1 mg/mL silicon fish essence DNA) for blocking at room temperature for 1 h, and then in 200 μL of binding buffer, 250 nM FAM-labeled appropriate The ligand or control library was incubated on ice in the dark for 30 minutes, and the fluorescence luminescence was observed with a fluorescence microscope. Through observation, it was found that the aptamer of the sequence of the present invention has good recognition and detection ability for liver cancer tissue.

The experimental methods in the present invention are conventional methods unless otherwise specified, and the materials used in the experiment are purchased from conventional biochemical reagent stores unless otherwise specified; the source of PLC8024 liver cancer cells used in the present invention All cells used in this experiment are from tumors in South China State Key Laboratory of Science, other cells come from American Tissue CultureCollection.

The above is only an embodiment of the present invention, and does not limit the patent scope of the present invention. Any equivalent structure or equivalent process conversion made by using the content of the description of the present invention, or directly or indirectly used in other related technical fields, shall be The same reasoning is included in the patent protection scope of the present invention.

sequence listing

<110> The Fifth Affiliated Hospital of Sun Yat-sen University

<120>A DNA aptamer that specifically recognizes liver cancer stem cells and its screening method and application

<160> 5

<170>SIPOSequenceListing 1.0

<210> 1

<211> 25

<212>DNA

<213>Artificial Sequence

<400> 1

aggaggttaggggtgggtgggtggt 25

<210> 2

<211> 19

<212>DNA

<213>Artificial Sequence

<400> 2

accttggctgtcgtgttgt 19

<210> 3

<211> 19

<212>DNA

<213>Artificial Sequence

<400> 3

aggtcagtggtcagagcgt 19

<210> 4

<211> 19

<212>DNA

<213>Artificial Sequence

<400> 4

accttggctgtcgtgttgt 19

<210> 5

<211> 19

<212>DNA

<213>Artificial Sequence

<400> 5

acgctctgaccactgacct 19

Claims (8)

1. a kind of DNA aptamers of specific recognition liver-cancer stem cell, it is characterised in that：The nucleotides sequence of the DNA aptamers Column include the characteristic sequence part as shown in Seq ID No.1.

2. the DNA aptamers of specific recognition liver-cancer stem cell according to claim 1, it is characterised in that：The liver cancer Stem cell is selected from the liver-cancer stem cell of CD133 expression.

3. the DNA aptamers of specific recognition liver-cancer stem cell according to claim 2, it is characterised in that：The liver cancer Stem cell is selected from PLC8024 hepatoma cell strain.

4. a kind of screening technique of DNA aptamers as described in any one of claims 1-3, it is characterised in that：Including following step Suddenly：It using aptamer in-vitro screening technology, is positive with CD133 positive expression hepatoma cell strain and sieves target, with CD133 feminine gender Expression liver-cancer stem cell strain, which is negative, sieves target, filters out from the random oligomerization library synthesized in vitro special with the hepatoma cell strain The aptamer of different combination.

5. the screening technique of DNA aptamers according to claim 4, it is characterised in that：The screening technique, specifically includes Following steps：

S1, synthesis random single chain library and primer：The random single chain library is：

ACCTTGGCTGTCGTGTTGT-25nt-AGGTCAGTGGTCAGAGCGT, the primer include 5' primer：5'-FAM- ACCTTGGCTGTCGTGTTGT and 3' primer：3'-Biotin-ACGCTCTGACCACTGACCT；

S2, aptamer screening：The random single chain library and liver-cancer stem cell are incubated for, after the completion of incubation, collected PLC8024 cell strain cell heat denatured separates the aptamers being incorporated on cell strain, as screens resulting aptamer Level-one library；

S3, positive sieve：The supernatant in the obtained aptamer level-one library the step S2 and positive sieve target are incubated for, elution of bound In the high-affinity aptamers group of target cell surface, the positive sieve aptamers in conjunction with target cell specificity that are enriched with after amplification Group library；

S4, negative sieve：The positive sieve aptamers group library and negative sieve target that the step S3 is obtained are incubated for, and are collected after the completion of being incubated for thin Supernatant after born of the same parents' incubation, the negative sieve aptamers group library in conjunction with target cell specificity being enriched with；

S5, selectivity, the affinity for analyzing and identifying the obtained negative sieve each sequence in aptamers group library of the step S4, final DNA aptamers to band just like characteristic sequence shown in Seq ID No.1.

6. the screening technique of DNA aptamers according to claim 5, it is characterised in that：The screening technique, specifically includes Following steps：

S11, synthesis random single chain library and primer：The random single chain library is：

ACCTTGGCTGTCGTGTTGT-25nt-AGGTCAGTGGTCAGAGCGT, the primer include 5' primer：5'-FAM- ACCTTGGCTGTCGTGTTGT and 3' primer：3'-Biotin-ACGCTCTGACCACTGACCT；

S21, aptamer screening：The random single chain library and liver-cancer stem cell are incubated for, after the completion of incubation, collected PLC8024 cell strain cell heat denatured separates the aptamers being incorporated on cell strain, as screens resulting aptamer Level-one library；

S31, PCR amplification library：Aptamer level-one library is subjected to PCR amplification, obtains amplified production；

S41, positive sieve：The supernatant of the obtained amplified production of the step S31 and the PLC8024 cell strain of the CD133 positive are incubated for, Elution of bound in the high-affinity aptamers group of target cell surface, be enriched with after amplification in conjunction with target cell specificity just Sieve aptamers group library；

S51, negative sieve：The PLC8024 cell strain in the obtained positive sieve aptamers group library the step S41 and CD133 feminine gender is incubated It educates, the supernatant after cell incubation is collected after the completion of being incubated for, the aptamers group text in conjunction with target cell specificity being enriched with Library；

S61, aptamer Cycle Screening：It repeats step S11~S51 at least once, random library is replaced with amplified production, directly Affinity to obtained aptamers group library selectively no longer rises；

S71, sequencing identification：The aptamers group library that step S61 described in cloning and sequencing is obtained, identifies the selection of each sequence respectively Property and affinity, finally obtain DNA aptamers of the band just like characteristic sequence shown in Seq ID No.1.

7. according to the screening technique of the described in any item DNA aptamers of claim 4-6, it is characterised in that：The screening technique Further include the steps that carrying out liver-cancer stem cell sorting before screening operation starts, specially：PLC8024 is marked with CD133 antibody After hepatoma cell strain, make target with the PLC8024 liver-cancer stem cell that selected by flow cytometry apoptosis obtains the CD133 positive.

8. a kind of ask the described in any item DNA aptamers of 1-3 to be applied to design, the drug of preparation anti-liver cancer and anti-or detection such as right In reagent.