CN105044322B - Aptamer application in identifying and combine L selection element - Google Patents
Aptamer application in identifying and combine L selection element Download PDFInfo
- Publication number
- CN105044322B CN105044322B CN201510354158.3A CN201510354158A CN105044322B CN 105044322 B CN105044322 B CN 105044322B CN 201510354158 A CN201510354158 A CN 201510354158A CN 105044322 B CN105044322 B CN 105044322B
- Authority
- CN
- China
- Prior art keywords
- cell
- aptamer
- human
- sequence
- sgc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
Abstract
The invention discloses aptamer application in identifying and combine L selection element.Present invention firstly discovers that aptamer Sgc 3b with specific recognition and combine L and select element, and can utilize aptamer Sgc 3b Yu L to select the specific binding effect of element to establish detection L to select plain method.Being experimentally confirmed: the aptamer Sgc 3b of the present invention has the features such as affinity height, high specificity, non-immunogenicity and nontoxicity, the detection L set up based on aptamer Sgc 3b selects the method for element to can be used for the plain detection expressed of L selection and the diagnosis of relevant disease.
Description
Technical field
The invention belongs to biotechnology and technical field of clinical medicine, be specifically related to aptamer and identifying and combining L
Select the application in element.
Background technology
Aptamer (aptamer) be a class specifically can interact with target substance single stranded DNA, RNA, peptide core
Acid or the nucleotide sequence of chemical modification, be generally made up of 15-80 nucleotides.Aptamer can form specific three-dimensional knot
Structure is combined with target molecules high-affinity, and such as structures such as hair fastener, false knot, G-tetra-serobilas, combination is to pass through with high specificity
Van der Waals force, hydrogen bond, electrostatic interaction and hydrophobic effect equimolecular interphase interaction realize.Owing to aptamer has affine
Power is high, the best, non-immunogenicity, be easily-synthesized, transform and modify, biochemistry good stability, can reversible denaturation and renaturation
Etc. characteristic, so being referred to as " chemistry antibody ".
Aptamer can be used in diagnosis and detection, drug target location, new drug development and the transport of some diseases
The fields such as related drugs molecule, the aptamer being presently used for treating the disease such as cancer, AIDS also continues to bring out.Such as,
The aptamer (trade name Macugen) of the targeting VEGF developed by Eyetch/Pfizer has obtained criticizing of FDA for 2004
Standard, is successfully used to treat age relevant macular degeneration.In recent years propose utilizes the cell specific core of-SELEX technology screening
Acid aptamers, and then find the application prospect that the method for tumor markers has had.But the most only successful example of only a few,
Bottleneck problem therein is that the purifying/qualification of the aptamer target molecule being positioned on cell membrane.
L select element also known as CD62L, leukocyte-endothelial adhesion molecule-1 (LECAM-1), lymph node homing receptor and
MEL-14.L selects element after birth outskirt N end to have 1 c-type lectin-like domain, 1 EGF spline structure territory and 2 CCP domains.
L selects element to be expressed in some differential period of hematopoietic cell, including most of B cell and non-sensitized T cell and most of monokaryon
Cell, neutrophil leucocyte and EC.After PMA, cell factor or chemoattractant stimulate lymphocyte and neutrophil leucocyte, by
Enzymolysis in protease makes L select element to rapidly disappear, and makes soluble type L having high level in blood plasma select element.L selects
Element is internal a kind of important immune-regulating factor, may participate in stretching, extension and movement, signal conduction and the activation of cell of cell, is
Multiple physiology, the pathologic processes such as inflammatory reaction, immune response, thrombosis, metastases, wound healing, by measuring cell
Surface L selects sL in plain content and serum, blood plasma or other body fluid to select the concentration of element may determine that the degree of disease and divide
Analysis mechanism, for monitor the generation of some inflammatories or immunity disease, development and result for the treatment of be probably one potential
Practical index.
Summary of the invention
It is an object of the present invention to provide the new application of aptamer or derivatives thereof.
The invention provides aptamer or derivatives thereof in identifying and combine or assist in identifying and combine L selection element
Application；
Or aptamer or derivatives thereof is in preparation identifies and combine or assist in identifying and combine the product that L selects element
Application；
Described aptamer is the single strand dna shown in sequence 1.
Present invention also offers whether aptamer or derivatives thereof contains L in detection or auxiliary detection testing sample
Select the application in element；
Or aptamer or derivatives thereof L in detection or auxiliary detection testing sample selects the application in cellulose content；
Or whether aptamer or derivatives thereof contains L in preparation detection or auxiliary detection testing sample and selects element
Application in product；
Or aptamer or derivatives thereof L in preparation detection or auxiliary detection testing sample selects the product of cellulose content
In application；
Described aptamer is the single strand dna shown in sequence 1.
Present invention also offers aptamer or derivatives thereof in the material that the antibody that detection is plain with anti-L selection is combined
Application；
Or aptamer or derivatives thereof is in preparation detects the product of the material selecting the antibody of element to be combined with anti-L
Application；
Described aptamer is the single strand dna shown in sequence 1.
Present invention also offers aptamer or derivatives thereof and in preparation diagnosis and/or treat inflammatory disease or immunity
Application in the product of disease；
Described aptamer is the single strand dna shown in sequence 1.
In above-mentioned application, described derivative is the derivative of the arbitrary described aptamer in following (1)-(6):
(1) aptamer shown in sequence 1 deleted or increase one or several nucleotides, obtaining fitting with described nucleic acid
Part has the derivative of the aptamer of identical function；
(2) aptamer shown in sequence 1 is carried out nucleotides replacement or modification, obtain having with described aptamer
There is the derivative of the aptamer of identical function；
(3) it transform the skeleton of the aptamer shown in sequence 1 as phosphorothioate ester skeleton, obtain fitting with described nucleic acid
Part has the derivative of the aptamer of identical function；
(4) RNA molecule encoded by the aptamer shown in sequence 1, obtains having identical with described aptamer
The aptamer derivative of function；
(5) peptide nucleic acid encoded by the aptamer shown in sequence 1, obtains having identical merit with described aptamer
The derivative of the aptamer of energy；
(6) one end of the aptamer shown in sequence 1 or centre are connected signaling molecule and/or bioactive molecule and/or
Functional group, obtains the derivative with described aptamer with the aptamer of identical function；
Functional group in described (6) is biotin group or fluorophor.
In above-mentioned application, the derivative of described aptamer is glimmering at 5 ' ends or 3 ' the end marks of above-mentioned aptamer
Light group or biotin group.
In above-mentioned application, the derivative of described aptamer is 5 ' the end mark fluorescent groups at above-mentioned aptamer
Or biotin group.
In above-mentioned application, described testing sample is cell；Described cell is specially rat alveolar epithelial cells RAEC, people's embryo
Tire lung fibroblast MRC-5, people alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder
Cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, people's ovary
Cancer cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, mankind T
Cell leukemia cell Jurkat E6-1, people ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, human prostate
Cancer cell PC-3, human T cells lymthoma Hut-78, human colon cancer cell LoVo, acute lymphoblastic leukemia cell
Molt-4, human T lymphoma cell Sup-T1 or human B cell lymphoma cell Mo2058.
It is a further object to provide a kind of product.
The active component of the product that the present invention provides is the aptamer or derivatives thereof shown in sequence 1；Described product
Purposes be following 1)-5) and at least one:
1) identify and combine or assist in identifying and combine L selection element；
2) detect or assist the material that detection selects the antibody of element to be combined with anti-L；
3) detect or assist L in detection testing sample to select the content of element；
4) detect or assist whether detection testing sample contains L selection element；
5) diagnose and/or treat inflammatory disease or immunity disease.
In the said goods, described derivative is the derivative of the arbitrary described aptamer in following (1)-(6):
(1) aptamer shown in sequence 1 deleted or increase one or several nucleotides, obtaining fitting with described nucleic acid
Part has the derivative of the aptamer of identical function；
(2) aptamer shown in sequence 1 is carried out nucleotides replacement or modification, obtain having with described aptamer
There is the derivative of the aptamer of identical function；
(3) it transform the skeleton of the aptamer shown in sequence 1 as phosphorothioate ester skeleton, obtain fitting with described nucleic acid
Part has the derivative of the aptamer of identical function；
(4) RNA molecule encoded by the aptamer shown in sequence 1, obtains having identical with described aptamer
The aptamer derivative of function；
(5) peptide nucleic acid encoded by the aptamer shown in sequence 1, obtains having identical merit with described aptamer
The derivative of the aptamer of energy；
(6) one end of the aptamer shown in sequence 1 or centre are connected signaling molecule and/or bioactive molecule and/or
Functional group, obtains the derivative with described aptamer with the aptamer of identical function；
Described functional group is biotin group or fluorophor.
In the said goods, the derivative of described aptamer is glimmering at 5 ' ends or 3 ' the end marks of above-mentioned aptamer
Light group or biotin group.
In the said goods, the derivative of described aptamer is 5 ' the end mark fluorescent groups at above-mentioned aptamer
Or biotin group.
In the said goods, described testing sample is cell；Described cell is specially rat alveolar epithelial cells RAEC, people's embryo
Tire lung fibroblast MRC-5, people alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder
Cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, people's ovary
Cancer cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, mankind T
Cell leukemia cell Jurkat E6-1, people ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, human prostate
Cancer cell PC-3, human T cells lymthoma Hut-78, human colon cancer cell LoVo, acute lymphoblastic leukemia cell
Molt-4, human T lymphoma cell Sup-T1 or human B cell lymphoma cell Mo2058.
Present invention firstly discovers that aptamer Sgc-3b and can utilize nucleic acid with specific recognition and combine L and select element
Aptamers Sgc-3b and L select the specific binding effect of element to establish the method that detection L selects element.It is experimentally confirmed: this
The aptamer Sgc-3b of invention has the features such as affinity height, high specificity, non-immunogenicity and nontoxicity, based on nucleic acid
The detection L that aptamers Sgc-3b is set up selects the method for element to can be used for L and selects the plain detection expressed and the diagnosis of relevant disease.
Accompanying drawing explanation
Fig. 1 is ESI-MS and the MS/MS collection of illustrative plates that the L that Sgc-3b-Bio extracts selects plain representational polypeptide.Figure 1A attaches most importance to
Type isotope-labeled [M+2H]2+Ion ESI-MS spectrogram；Figure 1B is light-duty isotope-labeled [M+2H]2+Ion ESI-MS
Spectrogram.Fig. 1 C is heavy isotope-labeled [M+2H]2+Ion MS/MS spectrogram；Fig. 1 D is light-duty isotope-labeled [M+2H
]2+Ion MS/MS spectrogram.Wherein, half Guang amino acid residue is partially alkylated or alkylated；K* represents heavy isotope-labeled lysine.
Fig. 2 is the flow cytomery of the Jurkat E6-1 cell that Sgc-3b-FAM or anti-CD62L-PE dyes altogether
Result.Wherein, L45-FAM is fluorescein-labeled random sequence；IgG-PE is control antibodies.
Fig. 3 be variable concentrations Sgc-3b-FAM and 0.625 μ g/mL anti-CD62L-PE antibody competition to combine streaming thin
Born of the same parents' instrument measurement result.
Fig. 4 is that 5 μ g/mL anti-CD62L-PE antibody are surveyed with 100nM Sgc-3b-FAM competitive binding flow cytometer
Determine result.
After Fig. 5 is the siRNA interference CD62L protein expression utilizing CD62L antibody or aptamer Sgc-3b
The flow cytomery result of Jurkat E6-1 cell.
Detailed description of the invention
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
Jurkat E6-1 cell derived is in ATCC, and catalog number is TIB-152TM。
Being made up of solvent and solute in conjunction with buffer solution (pH=7.4), solvent is water, solute and concentration in a solvent thereof
For: 137mM NaCl, 2.7mM KCl, 2mM KH2PO4、10mM Na2HPO4、5mM MgCl2、1mM CaCl2。
Cell pyrolysis liquid is containing 2% (volume fraction) Triton X-100,0.5% (volume fraction) SDS, 5mM
EDTA, 0.1mM PMSF and the knot of 2 μ g/mL protease inhibitor cocktail (pepstatin, leupeptin and aprotinin)
Close buffer solution.
Embodiment 1, aptamer Sgc-3b specific recognition also combine the qualification that L selection is plain
One, aptamer Sgc-3b and the preparation of derivative thereof
1, the synthesis of aptamer Sgc-3b
By DNA synthesizer nucleic acid aptamers Sgc-3b, the nucleotide sequence of aptamer Sgc-3b is as follows:
5 '-CTTATTCAATTCCCGTGGGAAGGCTATAGAGGGGCCAGTCTATGAATAAG-3 ' (sequence 1), according to test needs
Different molecules can be marked on aptamer Sgc-3b, obtain the derivative of aptamer Sgc-3b.Wherein, following
Embodiment 1 have selected biotin labeling aptamer Sgc-3b；Other embodiments have selected fluorescein (FAM) mark core
Acid aptamers Sgc-3b.
2, DNA deprotection: after cold ammoniacal liquor deprotection, then DNA is dissolved in the middle of TEAA solution；
3, DNA purifies: purified by PAGE or high performance liquid chromatograph；
4, DNA is dried: be dried by centrifugal concentrating；
5, mensuration concentration is dissolved standby.
Two, aptamer Sgc-3b specific recognition and combine L select element qualification
1, the isotope mark of Jurkat E6-1 cell
Heavy isotope-labeled Jurkat E6-1 cell: to without lysine and the cultivation of arginic RPMI 1640
Base be separately added into heavy isotope-labeled lysine ([13C6,15N2]-1B) and the isotope-labeled arginine of heavy type
([13C6]-L-arginine), make heavy isotope-labeled lysine and the isotope-labeled arginine of heavy type in the medium
Concentration is respectively 0.274mM and 0.575mM.Cultivate cell 6-7 for rear standby.
Light-duty isotope-labeled Jurkat E6-1 cell: to without lysine and the cultivation of arginic RPMI 1640
Base be separately added into light-duty isotope-labeled lysine ([12C6,14N2]-1B) and light-duty isotope-labeled arginine
([12C6]-L-arginine), make light-duty isotope-labeled lysine and light-duty isotope-labeled arginine in the medium
Concentration is respectively 0.274mM and 0.575mM.Cultivate cell 6-7 for rear standby.
2, biotin labeled aptamer Sgc-3b and the preparation of biotin labeled comparison nucleotide sequence L45
(1) biotin labeled Sgc-3b (Sgc-3b-Bio)
Biotin labeled aptamer Sgc-3b (Sgc-3b-Bio) is even at the 5 ' ends of aptamer Sgc-3b
Connection biotin group obtains, with combining buffer solution Sgc-3b-Bio, after demarcating concentration (100nM) according to UV absorption,
95 DEG C of heating 5min, place 5min on ice, and room temperature places 15min.
(2) biotin labeled comparison nucleotide sequence L45 (L45-Bio)
Biotin labeled comparison nucleotide sequence L45 (L45-Bio) is biological in 5 ' the end couplings of comparison nucleotide sequence L45
Element group obtains, with combining buffer solution L45-Bio, after demarcating concentration (100nM) according to UV absorption, and 95 DEG C of heating
5min, places 5min on ice, and room temperature places 15min.The nucleotide sequence of comparison nucleotide sequence L45:
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN。
3, the extraction of aptamer Sgc-3b target proteins
(1) 2 × 10 are taken respectively8The heavy type isotope-labeled Jurkat E6-1 cell of individual exponential phase of growth and light-duty with
The Jurkat E6-1 cell of position element mark, after PBS washing, Sgc-3b biotin labeled with 100nM (Sgc-3b-Bio) respectively
Hatch 30 minutes with biotin labeled comparison nucleotide sequence L45 (L45-Bio), be subsequently adding formaldehyde and fix 10 minutes.
(2) PBS washs 2 times, adds the cell pyrolysis liquid of 1mL, hatches 1 hour.
(3) 2000rpm centrifugal segregation precipitation, collects supernatant, adds agarose microbeads (the GE public affairs that Streptavidin is modified
Department, article No.: 17-5113-01), hatch 1 hour, extract target proteins.
(4) wash, with PBS, the agarose microbeads that the Streptavidin after above-mentioned steps (3) is hatched is modified, wash 5 times, point
Do not obtain the isotope-labeled albumen of heavy type, comparison nucleotide sequence L45 that biotin labeled aptamer Sgc-3b extracts
It is light-duty isotope-labeled that the light-duty isotope-labeled albumen extracted, biotin labeled aptamer Sgc-3b extract
The isotope-labeled albumen of heavy type that albumen and comparison nucleotide sequence L45 extract.
4, forward and reversely testing
(1) forward experiment: the isotope-labeled albumen of heavy type that biotin labeled aptamer Sgc-3b is extracted
Light-duty isotope-labeled albumen mixing with compareing nucleotide sequence L45 extraction, obtains biotin labeled aptamer
The light-duty isotope-labeled mixture that the isotope-labeled albumen of heavy type that Sgc-3b extracts extracts with comparison nucleotide sequence L45
System.
(2) reversely experiment: the light-duty isotope-labeled albumen that biotin labeled aptamer Sgc-3b is extracted
Heavy type isotope-labeled albumen mixing with compareing nucleotide sequence L45 extraction, obtains biotin labeled aptamer
The isotope-labeled mixture of heavy type that the light-duty isotope-labeled albumen that Sgc-3b extracts extracts with comparison nucleotide sequence L45
System.
5, enzymolysis and the LC-MS of albumen identifies
(1) DTT reduction: the isotope-labeled egg of heavy type extracted to biotin labeled aptamer Sgc-3b respectively
The light-duty isotope-labeled mixed system that white and comparison nucleotide sequence L45 extracts, biotin labeled aptamer Sgc-
In the isotope-labeled mixed system of heavy type that the light-duty isotope-labeled albumen that 3b extracts and comparison nucleotide sequence L45 extract
Add 200 μ L 20mM dithiothreitol (DTT) (DTT), 56 DEG C of reaction 45min.
(2) IAA alkylation: be centrifuged by the product of step (1), abandons supernatant (removing DTT), is separately added into 200 μ in precipitation
L 55mM iodoacetamide (IAA), reacts 30min 37 DEG C of lucifuges.
(3) product of step (2) is centrifuged, abandons supernatant (removing IAA), in precipitation, add 5 μ g mass spectrum trypsase
(Promega company, catalog number: V5111), 37 DEG C are digested overnight, the polypeptide after being digested.
(4) polypeptide after being digested, after being concentrated in vacuo, adds 100ul water, utilizes Ziptip C18Microtrabeculae desalination.Mass spectrum
Before analysis, place-20 DEG C of refrigerators.
(5) LTQ-Orbitrap Velos mass spectrograph (Thermo Fisher Scientific, San Jose, CA) is utilized
It is analyzed identifying to the product of step (4), obtains original mass spectrometric data.
(6) data search analysis
MaxQuant search engine (version number: 1.3.0.5) is utilized the original mass spectrometric data that step (5) obtains to be existed
IPI albumen database (version number: 3.68) is retrieved.Some parameters of database search are as follows: immobilization is modified to half
Alkylation on cystine is modified, the variable oxidative modification being modified on methionine and the acetylation modification of protein N terminal.Permit
Permitted 2 leakages cut site, the fault-tolerant amount of parent ion be 20ppm, MS/MS fragment ion masses error be 0.5Da.For identifying candidate's
Albumen, has unique peptide identification of 2 or more than two to go out, and posteriority standard error (PEP) is less than 10-5.Candidate albumen needs
Forward experiment and reversely in experiment the most identified go out.
Table 1, utilize combination aptamer Sgc-3b or the protein of comparison nucleotide sequence L45 that SILAC identifies
[a]PEP represents posterior probability error；[b]Represent the mean value of the experiment of twice forward and twice reversely experiment ratio with
Standard deviation.
Result is as shown in table 1: SILAC (cold labeling technology) experimental identification goes out 18 albumen, aptamer
Sgc-3b and random controls nucleotide sequence L45 extract the protein abundance ratio only L more than 2 and select element, remaining include 7 endogenous
Property biotinylated protein is both less than 2 at the abundance ratio of 17 interior albumen.Illustrate that aptamer Sgc-3b can be specific
Identification and combine L select element.L selects the mass spectral results of element as shown in Figure 1: in forward is tested, heavy isotope-labeled L
Select element identified go out (m/z 1036.5 is [M+2H]2+The single isotopic peak of ion), Fig. 1 C is its MS/MS spectrogram；Instead
To experiment in, the light-dutyest isotope-labeled L select element identified go out (m/z 1032.5 is [M+2H]2+Ion single with
Element peak, position), Fig. 1 D is its MS/MS spectrogram.
Embodiment 2, flow cytometer showed method detection aptamer Sgc-3b Yu L selects the binding ability of element
One, the preparation of aptamer solution and the process of cell line
1, the preparation of fluorescein-labeled aptamer Sgc-3b solution (Sgc-3b-FAM) (100nM)
Fluorescein-labeled aptamer Sgc-3b is 5 ' the end coupling fluorescein base group at aptamer Sgc-3b
Obtain, with combining buffer solution Sgc-3b-FAM, after demarcating concentration (100nM) according to UV absorption, 95 DEG C of heating 5min,
Placing 5min on ice, room temperature places 15min.
2, the anti-L of PE mark selects the preparation of element antibody-solutions (anti-CD62L-PE)
The anti-L selection element antibody of PE mark is the product of eBioscience company, and each test adds 0.125 μ g, concentration
It is 1.25 μ g/mL.
3, the preparation of fluorescein-labeled comparison nucleotide sequence solution (L45-FAM) (100nM)
Fluorescein-labeled comparison nucleotide sequence L45 (L45-FAM) is 5 ' the end coupling fluorescence at comparison nucleotide sequence L45
Element group obtains, with combining buffer solution L45-FAM, after demarcating concentration (100nM) according to UV absorption, and 95 DEG C of heating
5min, places 5min on ice, and room temperature places 15min.The nucleotide sequence of comparison nucleotide sequence L45:
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN。
4, the preparation of fluorescein-labeled comparison aptamer solution (Sgc-4e-FAM) (100nM)
Fluorescein-labeled Sgc-4e (Sgc-4e-FAM) is 5 ' the end coupling fluorescein bases at aptamer Sgc-4e
Group obtains, with combining buffer solution Sgc-4e-FAM, after demarcating concentration (100nM) according to UV absorption, and 95 DEG C of heating
5min, places 5min on ice, and room temperature places 15min.The nucleotide sequence of aptamer Sgc-4e: 5 '-
TCACTTATTCAATTCGAGTGCGGATGCAAACGCCAGACAGGGGGACAGGAGATAAGTGA-3’。
5, the preparation of mouse IgG1K Isotype control immunoglobulin solution (lgG-PE) of PE mark
The mouse IgG1K Isotype control immunoglobulin (Ig) of PE mark is the product of eBioscience company, and each test adds
0.125 μ g, concentration is 1.25 μ g/mL.
6, the cultivation of human leukemia cell Jurkat E6-1
Human leukemia cell Jurkat E6-1 is trained at the RPMI 1640 containing 10%FBS, the penicillin of 1% and streptomysin
Support in base, 37 DEG C, cell culture incubator is cultivated under conditions of the carbon dioxide of 5%；Take the human leukemia cell of exponential phase of growth
Jurkat E6-1, washs with lavation buffer solution after directly dispelling, is equally divided into some parts, and every part of cell number is 5 × 104Individual.
Two, flow cytometer showed method detection aptamer Sgc-3b Yu L selects the binding ability of element
1, above-mentioned Jurkat E6-1 cell is carried out following four groups respectively to process:
First group: hatch being combined in buffer solution with the 100 μ L of L45-FAM (100nM) containing lgG-PE (1.25 μ g/mL)
Jurkat E6-1 cell；
Second group: be combined buffering containing anti-CD62L-PE (1.25 μ g/mL) with the 100 μ L of L45-FAM (100nM)
Liquid is hatched Jurkat E6-1 cell；
3rd group: be combined in buffer solution with the 100 μ L of Sgc-3b-FAM (100nM) containing lgG-PE (1.25 μ g/mL)
Hatch Jurkat E6-1 cell；
4th group: slow being combined containing anti-CD62L-PE (1.25 μ g/mL) and the 100 μ L of Sgc-3b-FAM (100nM)
Rush and liquid is hatched Jurkat E6-1 cell.
2, flow cytometer is analyzed
Cell after processing above-mentioned four groups respectively with flow cytometer is analyzed.Above-mentioned often group Setup Experiments three is only
Vertical repetition is tested.
The testing result of flow cytometer is as shown in Figure 2: first group is control antibodies (lgG-PE) and comparison nucleotide sequence
(L45-FAM) with the situation of Cell binding；Second group is in the presence of comparison nucleotide sequence (L45-FAM), and anti-L selects
Element antibody (anti-CD62L-PE) and the situation of Cell binding；3rd group is in the presence of control antibodies (lgG-PE),
Aptamer Sgc-3b-FAM and the situation of Cell binding；4th group is that anti-L selects element antibody anti-CD62L-PE and nucleic acid
With the situation of Cell binding in the case of aptamers Sgc-3b-FAM is simultaneous.Adaptive by above-mentioned four groups of results explanation nucleic acid
Body Sgc-3b can select element to combine with L, and aptamer Sgc-3b can substitute anti-L and select element antibody to use.
Three, the aptamer Sgc-3b and anti-L of flow cytometer showed method detection variable concentrations selects the competition of element antibody
1, above-mentioned Jurkat E6-1 cell is carried out following three groups respectively to process:
First group: be combined buffering containing anti-CD62L-PE (1.25 μ g/mL) with the 100 μ L of L45-FAM (100nM)
Liquid is hatched Jurkat E6-1 cell；
Second group: slow being combined containing anti-CD62L-PE (1.25 μ g/mL) and the 100 μ L of Sgc-3b-FAM (100nM)
Rush and liquid is hatched Jurkat E6-1 cell；
3rd group: be combined with the 100 μ L of Sgc-3b-FAM (1000nM) containing anti-CD62L-PE (1.25 μ g/mL)
Buffer solution is hatched Jurkat E6-1 cell.
2, flow cytometer is analyzed
Cell after processing above-mentioned three groups respectively with flow cytometer is analyzed.Above-mentioned often group Setup Experiments three is only
Vertical repetition is tested.
The testing result of flow cytometer is as shown in Figure 3: first group for existing according to nucleotide sequence (L45-FAM) random
Time, anti-L selects element antibody (anti-CD62L-PE) and Cell binding situation；Second group is the aptamer of same concentrations
Under conditions of Sgc-3b-FAM exists, anti-L selects element antibody (anti-CD62L-PE) and Cell binding situation, and its FL2 fluorescence is strong
Degree relatively first group is substantially to left dislocation；3rd group is the concentration of aptamer Sgc-3b-FAM when being 1000nM, and anti-L selects element
Antibody (anti-CD62L-PE) the most not with Cell binding.This explanation aptamer Sgc-3b can compete anti-
CD62L-PE antibody and the combination of cell, and random controls nucleotide sequence L-45 is without impact.
Four, flow cytometer showed method detects anti-L and selects the competition of element antibody and aptamer Sgc-3b
1, above-mentioned Jurkat E6-1 cell is carried out following two groups respectively to process:
First group: in the 100 μ L Cell binding liquid containing Sgc-3b-FAM (100nM), hatch Jurkat E6-1 cell；
Second group: at the 100 μ L Cell bindings containing anti-CD62L-PE (5 μ g/mL) Yu Sgc-3b-FAM (100nM)
Liquid is hatched Jurkat E6-1 cell.
2, flow cytometer is analyzed
Cell after processing above-mentioned two groups respectively with flow cytometer is analyzed.Above-mentioned often group Setup Experiments three is only
Vertical repetition is tested.
The testing result of flow cytometer is as shown in Figure 4: comprise only aptamer Sgc-3b-in buffer solution when combining
During FAM, FL1 channel fluorescence is stronger；And when adding the anti-L selection element antibody of 5 μ g/mL, its FL1 channel fluorescence is to left dislocation；This
Illustrate that antibody anti-CD62L can compete the combination of aptamer Sgc-3b and cell.
The binding site of above description of test aptamer Sgc-3b Yu L selection element may be with antibody anti-CD62L-
PE's is consistent, or its combination interferes with each other, and aptamer Sgc-3b can substitute antibody anti-CD62L-PE and use.
Five, the detection of flow cytometer showed method reduces the change in fluorescence after L selects element to express
1, the L utilizing siRNA technology to reduce Jurkat E6-1 cell selects element, and (NP_000646 submits to day: 2015 4
Months 28 days) in the expression of cell surface, obtain L and select element to express the Jurkat E6-1 cell reduced.
It is to prepare with siRNA kit that L selects element to express the Jurkat E6-1 cell reduced, and specifically comprises the following steps that
SELL siRNA selects the expression of element for reducing L, without the random siRNA sequence of target as comparison, is all U.S.
The product of GE Dharmacon company of state synthesis.
The Jurkat E6-1 cell about 2 × 10 specifically comprising the following steps that selection exponential phase of growth of siRNA electrotransfection5Individual carefully
Born of the same parents, are separately added into the SELL siRNA and comparison siRNA of 80pmol, utilizeCell Line
The X-001 program (Amaxa, Lonza) of Kit V kit and offer completes electrotransfection, obtains L and selects element to express reduction
Jurkat E6-1 cell.
The cell of above-mentioned process is cultivated in 37 DEG C of carbon dioxide cell incubators containing 5% cell after 72 hours with stream
Formula cell instrument detects.
2, above-mentioned L select element express Jurkat E6-1 cell (SiSELL) and Jurkat E6-1 cell reduced
(SiControl, compared with control cells) carries out following six groups respectively and processes:
First group: combine at the 100 μ L containing anti-CD62L-PE (1.25 μ g/mL) and buffer solution is hatched L selection element table
Reach the Jurkat E6-1 cell of reduction；
Second group: combine at the 100 μ L containing anti-CD62L-PE (1.25 μ g/mL) and buffer solution is hatched Jurkat
E6-1 cell.
3rd group: combine at the 100 μ L containing Sgc-3b-FAM (100nM) and buffer solution is hatched L selection element expression reduction
Jurkat E6-1 cell；
4th group: combine at the 100 μ L containing Sgc-3b-FAM (100nM) and buffer solution is hatched Jurkat E6-1 cell；
5th group: combine at the 100 μ L containing Sgc-4e-FAM (100nM) and buffer solution is hatched L selection element expression reduction
Jurkat E6-1 cell；
6th group: combine at the 100 μ L containing Sgc-4e-FAM (100nM) and buffer solution is hatched Jurkat E6-1 cell.
3, flow cytometer is analyzed
Cell after processing above-mentioned six groups respectively with flow cytometer is analyzed.Above-mentioned often group Setup Experiments three is only
Vertical repetition is tested.
Result is as shown in Figure 5: it can be seen that the cell containing anti-CD62L-PE or Sgc-3b-FAM is cultivated
Liquid fluorescence intensity after siRNA cell fluorescence intensity before treatment is all higher than process, and positive control aptamer Sgc-
4e-FAM siRNA process before and after without significant change.Illustrate Jurkat 6E-6 cell through siRNA process after, its L selects element
Expression reduce, consistent with TPPA result by Sgc-3b-FAM measurement result.
Embodiment 3, the aptamer Sgc-3b application in the L measuring dissimilar cell selects element expression
One, the preparation of fluorescein-labeled aptamer Sgc-3b solution (Sgc-3b-FAM)
With combining buffer solution Sgc-3b-FAM, after demarcating concentration (100nM) according to UV absorption, 95 DEG C of heating
5min, places 5min on ice, and room temperature places 15min.
Two, the pretreatment of cell line
Take each ware of cell line of following 16 kinds of growth logarithmic phases respectively: grow rat alveolar epithelial cells (RAEC), people
Embryo lung fibrocyte (MRC-5), people's alveolar epithelial cells (A549), human cervical carcinoma cell (Hela), human liver cancer cell (Huh-
7), human bladder cancer cell (T24), human liver cell cancer cell (SK-Hep-1), human breast cancer cell (MCF-7), resistance people's mammary gland
Cancer cell (MCF-7R), Proliferation of Human Ovarian Cell (SKOV-3), human breast cancer cell (MDA-MB-231), human epithelial cancer cells
(A431), people's ileocecum adenocarcinoma cell (HCT-8), human embryonic kidney cell (HEK-293), Human Prostate Cancer Cells (PC-3) and people
Colon cancer cell (LoVo), after being digested to single dispersing cell suspension with 0.2%EDTA, washs 2 times with lavation buffer solution, if being divided into
Dry part, every part of cell number is 5 × 104Individual；Respectively by the human leukemia cell (Jurkat E6-1) of suspension growth, human leukemia
Cell (K562), human T cells lymthoma (Hut-78), acute lymphoblastic leukemia cell (Molt-4), human T lymphoma
Cell (Sup-T1), human B cell lymphoma cell (Mo2058) wash 2 times with lavation buffer solution after directly dispelling, and are equally divided into
Some parts, every part of cell number is 5 × 104Individual.
Three, the fluorescein-labeled aptamer Sgc-3b (Sgc-3b-FAM) prepared by the step one of embodiment 2, glimmering
Comparison nucleotide sequence L-45 (L45-FAM) of light element mark, control antibodies (lgG-PE) and anti-L select plain antibody (be purchased from:
EBioscience company, catalog number: 12-0629) respectively clone with 22 kinds of separate sources mix, respectively obtain mixed
Close liquid, mixed liquor is hatched on ice 30min, wash twice with lavation buffer solution, after crossing 400 eye mesh screens, flow cytometer
Detect.
The fluorescence intensity data of first passage is collected, as cell table with the FACSCalibur flow cytometer of BD company
The fluorescence intensity in face.The instrument of each sample records fluorescence intensity deduction cell autofluorescence, obtains each sample and is combined in carefully
The fluorescence intensity of the aptamer of cellular surface.Set a threshold value so that percentage of cells has the comparison nucleic acid sequence more than 95%
The cell fluorescence intensity value that row L-45 processes is less than this threshold value.Cell fluorescence intensity value more than this threshold value be considered as aptamer with
Cell can be specific binding.After being combined using cell with aptamer, fluorescence intensity exceedes the percentage of cells of this threshold value as weighing apparatus
Amount aptamer is strong and weak with Cell binding ability.Wherein, nothing: the fluorescence intensity after cell to be measured is combined with aptamer exceedes this
The percentage of cells of one threshold value is less than 15%；Medium: the fluorescence intensity after cell to be measured is combined with aptamer exceedes this threshold
The percentage of cells of value is 15-60%；Strong: the fluorescence intensity after cell to be measured is combined with aptamer exceedes the thin of this threshold value
Born of the same parents' percentage is more than 60%.
Result is as shown in table 2: aptamer Sgc-3b measurement result and anti-L select element TPPA result complete
Cause.Illustrate that aptamer Sgc-3b can substitute anti-L and select element TPPA L to select element.
Table 2, anti-L select element antibody and aptamer Sgc-3b to measure dissimilar cell L and select the expression of element
Claims (8)
1. aptamer or derivatives thereof answering in preparing the product identifying and combining or assist in identifying and combine L selection element
With；
Described aptamer is the single strand dna shown in sequence 1；
Described derivative is that one end of the aptamer shown in sequence 1 is connected functional group, obtains adaptive with described nucleic acid
Body has the derivative of the aptamer of identical function；
Described functional group is biotin group or fluorophor.
2. whether aptamer or derivatives thereof contains the product of L selection element in preparation detection or auxiliary detection testing sample
In application；
Described aptamer is the single strand dna shown in sequence 1；
Described derivative is that one end of the aptamer shown in sequence 1 is connected functional group, obtains adaptive with described nucleic acid
Body has the derivative of the aptamer of identical function；
Described functional group is biotin group or fluorophor.
3. aptamer or derivatives thereof detects or in auxiliary detection testing sample in the product of L selection cellulose content in preparation
Application；
Described aptamer is the single strand dna shown in sequence 1；
Described derivative is that one end of the aptamer shown in sequence 1 is connected functional group, obtains adaptive with described nucleic acid
Body has the derivative of the aptamer of identical function；
Described functional group is biotin group or fluorophor.
4. aptamer or derivatives thereof answering in preparation detects the product of the material selecting the antibody of element to be combined with anti-L
With；
Described aptamer is the single strand dna shown in sequence 1；
Described derivative is that one end of the aptamer shown in sequence 1 is connected functional group, obtains adaptive with described nucleic acid
Body has the derivative of the aptamer of identical function；
Described functional group is biotin group or fluorophor.
5. aptamer or derivatives thereof application in the product of preparation diagnosis inflammatory disease or immunity disease；
Described aptamer is the single strand dna shown in sequence 1；
Described derivative is that one end of the aptamer shown in sequence 1 is connected functional group, obtains adaptive with described nucleic acid
Body has the derivative of the aptamer of identical function；
Described functional group is biotin group or fluorophor.
6. according to described application arbitrary in claim 1-5, it is characterised in that: described testing sample is cell；Described cell
It is specially rat alveolar epithelial cells RAEC, human embryonic lung fibrocyte MRC-5, people alveolar epithelial cells A549, human cervical carcinoma
Cell Hela, human liver cancer cell Huh-7, human bladder cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell
MCF-7, human breast cancer cell line Bcap-37 R, Proliferation of Human Ovarian Cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-
MB-231, human epithelial cancer cells A431, human t-cell leukemia cell Jurkat E6-1, people ileocecum adenocarcinoma cell HCT-
8, human embryonic kidney cell HEK-293, Human Prostate Cancer Cells PC-3, human T cells lymthoma Hut-78, human colon cancer cell
LoVo, acute lymphoblastic leukemia cell Molt-4, human T lymphoma cell Sup-T1 or human B cell lymphoma cell
Mo2058。
7. a product, its active component is the aptamer or derivatives thereof shown in sequence 1；
Described derivative is that one end of the aptamer shown in sequence 1 is connected functional group, obtains adaptive with described nucleic acid
Body has the derivative of the aptamer of identical function；
Described functional group is biotin group or fluorophor
The purposes of described product is following 1)-5) at least one:
1) identify and combine or assist in identifying and combine L selection element；
2) detect or assist the material that detection selects the antibody of element to be combined with anti-L；
3) detect or assist L in detection testing sample to select the content of element；
4) detect or assist whether detection testing sample contains L selection element；
5) diagnosis inflammatory disease or immunity disease.
Product the most according to claim 7, it is characterised in that: described testing sample is cell；Described cell is specially big
Mouse alveolar epithelial cells RAEC, human embryonic lung fibrocyte MRC-5, people alveolar epithelial cells A549, human cervical carcinoma cell Hela,
Human liver cancer cell Huh-7, human bladder cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human milk
Adenocarcinoma cell MCF-7R, Proliferation of Human Ovarian Cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, people
Class epithelial cancer cells A431, human t-cell leukemia cell Jurkat E6-1, people ileocecum adenocarcinoma cell HCT-8, Human embryo
Nephrocyte HEK-293, Human Prostate Cancer Cells PC-3, human T cells lymthoma Hut-78, human colon cancer cell LoVo, acute
Lymphoblastic Leukemia Cells Molt-4, human T lymphoma cell Sup-T1 or human B cell lymphoma cell Mo2058.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354158.3A CN105044322B (en) | 2015-06-24 | 2015-06-24 | Aptamer application in identifying and combine L selection element |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354158.3A CN105044322B (en) | 2015-06-24 | 2015-06-24 | Aptamer application in identifying and combine L selection element |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105044322A CN105044322A (en) | 2015-11-11 |
| CN105044322B true CN105044322B (en) | 2016-09-07 |
Family
ID=54451029
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510354158.3A Active CN105044322B (en) | 2015-06-24 | 2015-06-24 | Aptamer application in identifying and combine L selection element |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105044322B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624166B (en) * | 2016-01-31 | 2018-05-04 | 湖南大学 | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared |
| CN106191069B (en) * | 2016-07-14 | 2019-03-01 | 中国科学院化学研究所 | A kind of aptamer sequence and its application identified and combine human TfR |
| CN106591314B (en) * | 2016-11-30 | 2019-02-12 | 吴冬 | The aptamer WYZ-4 and its screening technique of ovarian mucinous cancer cell 3AO and application |
| CN106520773B (en) * | 2016-11-30 | 2019-01-25 | 吴冬 | The aptamer WYZ-3 and its screening technique of ovarian mucinous cancer cell 3AO and application |
| CN107085110A (en) * | 2017-05-31 | 2017-08-22 | 江西乐成生物医疗有限公司 | One kind is used for thyroid cancer external diagnosis reagent case and its detection method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002077262A2 (en) * | 2001-03-22 | 2002-10-03 | Somalogic, Inc. | Method and apparatus for the automated generation of nucleic acid ligands |
| CN101537189A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Aptamer and new use of derivative thereof |
| CN101538613A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Molecular probe related to disease and method for producing the same |
| CN102251036A (en) * | 2011-07-07 | 2011-11-23 | 中国人民解放军总医院 | Method for simultaneously detecting 17 genes |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6280932B1 (en) * | 1990-06-11 | 2001-08-28 | Gilead Sciences, Inc. | High affinity nucleic acid ligands to lectins |
-
2015
- 2015-06-24 CN CN201510354158.3A patent/CN105044322B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002077262A2 (en) * | 2001-03-22 | 2002-10-03 | Somalogic, Inc. | Method and apparatus for the automated generation of nucleic acid ligands |
| CN101537189A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Aptamer and new use of derivative thereof |
| CN101538613A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Molecular probe related to disease and method for producing the same |
| CN102251036A (en) * | 2011-07-07 | 2011-11-23 | 中国人民解放军总医院 | Method for simultaneously detecting 17 genes |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105044322A (en) | 2015-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105044322B (en) | Aptamer application in identifying and combine L selection element | |
| US10195290B1 (en) | Preparation of therapeutic exosomes using membrane proteins | |
| Tan et al. | DNA aptamers that target human glioblastoma multiforme cells overexpressing epidermal growth factor receptor variant III in vitro | |
| Liu et al. | An aptamer-based probe for molecular subtyping of breast cancer | |
| CN104988154B (en) | Application of the aptamer in identifying and combining integrin alpha 4 | |
| CN105567641B (en) | A kind of preparation method and applications carrying anti-tumor protein targeting exosome | |
| KR101189790B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to Pancreatic Cancer Cell or Tissue and Use Thereof | |
| CN106191069B (en) | A kind of aptamer sequence and its application identified and combine human TfR | |
| CN103387988A (en) | Aptamer EpCAM (epithelial cell adhesion molecule) Ccut of EpCAM and preparation method thereof | |
| Bing et al. | Aptameric probe specifically binding protein heterodimer rather than monomers | |
| CN109913462B (en) | Application research of aptamer recognition and combination with CD171 and related functions thereof | |
| CN103732748A (en) | Production method for nucleic acid aptamer | |
| CN109337909A (en) | It is a kind of detect liver cancer drug-resistant cell strain aptamer and its application | |
| CN104480114B (en) | The method of high performance liquid chromatography screening aptamer and aptamer and application | |
| CN105755005A (en) | Aptamer for osteosarcoma detection and kit for osteosarcoma detection | |
| US20210113641A1 (en) | Extraction of plant source "medicinal soup" and manual preparation of "herbal medicine" and related products | |
| Wang et al. | X-aptamers targeting Thy-1 membrane glycoprotein in pancreatic ductal adenocarcinoma | |
| CN103463619B (en) | BMP 4 is in the application suppressing in cancer | |
| CN104804092B (en) | A kind of nano antibody of anti-B cell growth-stimulating factor and application thereof | |
| WO2022148491A1 (en) | Assembled protein element and use thereof | |
| CN109554369B (en) | Use of aptamers for recognition and binding of alkaline phosphatase heterodimers | |
| CN107326028B (en) | Aptamer capable of being combined with CD123 and construction and application of targeting drug-loading system thereof | |
| US9354237B2 (en) | Methods for isolating proteins | |
| KR101678946B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to 25-hydroxy Vitamin D3 and Uses Thereof | |
| CN106771216B (en) | Improve the method and its application of immunoreagent detection specificity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |