CN104988154B - Application of the aptamer in identifying and combining integrin alpha 4 - Google Patents
Application of the aptamer in identifying and combining integrin alpha 4 Download PDFInfo
- Publication number
- CN104988154B CN104988154B CN201510354245.9A CN201510354245A CN104988154B CN 104988154 B CN104988154 B CN 104988154B CN 201510354245 A CN201510354245 A CN 201510354245A CN 104988154 B CN104988154 B CN 104988154B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- cell
- integrin alpha
- human
- cancer cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of the aptamer in identifying and combining integrin alpha 4.Present invention firstly discovers that aptamer Sgc 4e can be with specific recognition and with reference to integrin alpha 4, and the method for detecting integrin alpha 4 is established using aptamer Sgc 4e and integrin alpha 4 specific binding effect.It is experimentally confirmed：The aptamer Sgc 4e of the present invention have the characteristics that affinity height, high specificity, non-immunogenicity and nontoxicity, and the method based on the aptamer Sgc 4e detection integrin alphas 4 established can provide new strategy for treatment multiple sclerosis.
Description
Technical field
The invention belongs to biotechnology and technical field of clinical medicine, and in particular to aptamer is being identified and combined whole
Close the application in plain α 4.
Background technology
Aptamer (aptamer) is a kind of single stranded DNA, RNA, peptide that can be interacted with the specificity of target substance
Nucleic acid or the nucleotide sequence of chemical modification, are generally made up of 15-80 nucleotides.Aptamer can form specific three-dimensional
Structure is combined with target molecules high-affinity, such as hair fastener, false knot, the serobila structures of G- tetra-, and combination is logical with high specificity
Cross what Van der Waals force, hydrogen bond, electrostatic interaction and the interphase interaction of hydrophobic effect equimolecular were realized.It has affinity high, special
Property good, non-immunogenicity, be easily-synthesized, transform with modification, biochemistry stability it is good, can the characteristic such as reversible denaturation and renaturation, institute
To be referred to as " chemical antibody ".
Aptamer can be used in the diagnosis and detection, drug target positioning, new drug development and transport of some diseases
The fields such as related drugs molecule, the aptamer for being presently used for the diseases such as treating cancer, AIDS also continue to bring out.For example,
FDA batch has been obtained within 2004 by the targeting VEGF of Eyetch/Pfizer exploitations aptamer (trade name Macugen)
Standard, it is successfully used to treat the macular degeneration of age correlation.In recent years what is proposed utilizes cell-SELEX technology screening specificity cores
Sour aptamers, and then find the application prospect that the method for tumor markers has had.But there was only the successful example of only a few at present,
Bottleneck problem therein is that purifying/identification of the aptamer target molecule on cell membrane.
Integrin alpha 4 is also known as CD49d, with the integrins of integrin β_1 subunit (CD29) 4 β of composition α 1.Mainly it is expressed in thymus gland
Cell, monocyte, lymphocyte etc., part are VCAM-1 and fibronectin, can provide collaboration thorn for T cell activation and propagation
Energizing signal, participate in sticking between lymphocyte and leucocyte migrates to inflammation part, while it is also expressed in some solid tumor tables
Face.Research shows：The formation of thrombus, the transfer of leucocyte, angiogenesis and the transfer of tumour cell are all sharp with integral protein
Work is relevant, wherein, CD49d unconventionality expression is relevant with the morbidity and prognosis of some hematologic diseases, as CD49d is thin with chronic lymphatic
Prognostic significance is close for born of the same parents' property leukaemia (Chronic lymphoid leukemia, CLL), so CD49d is by as thin based on streaming
Born of the same parents' instrument analyzes the biomarker of chronic lymphocytic leukemia.
Multiple sclerosis (MS) is a kind of common chronic, inflammatory, demyelinate central nervous system disease, infringement
The myelin of central nervous system, so as to cause neurologic impairment, this damage frequently can lead to handicap.Every 100000
There is 2-150 people's morbidity in people, the whole world has more than a million people and perplexed by this kind of disease, the difference of race and geographic latitude
Its incidence of disease is also different.Natalizumab (Natalizumab) be ELAN companies research and development humanization monoclonal antibody, action target spot
Integrin alpha is approved by the FDA in the United States for 4,2004, is ratified by European Union EMA within 2006, at present in Canada, Switzerland, the big profit of Australia
More than 65 countries such as Asia go through to list, trade name Tysabri, are mainly used in the treatment of multiple sclerosis.
The content of the invention
It is an object of the present invention to provide the new application of aptamer or derivatives thereof.
The invention provides aptamer or derivatives thereof to identify and combine or assist in identifying and combine integrin alpha 4
In application；
Or aptamer or derivatives thereof is identified and combined preparing or assists in identifying and combine the product of integrin alpha 4
In application；
The aptamer is the single strand dna shown in sequence 1.
Present invention also offers aptamer or derivatives thereof identify and combine or assist in identifying and binding activity it is whole
Close the application in plain α 4；
Or aptamer or derivatives thereof is identified and combined or assist in identifying and binding activity integrin alpha 4 preparing
Application in product；
The aptamer is the single strand dna shown in sequence 1.
Present invention also offers aptamer or derivatives thereof to detect or aid in detection and the antibody of anti-integrin alpha 4
With reference to material in application；
Or aptamer or derivatives thereof is preparing the thing of detection or auxiliary detection and the antibody binding of anti-integrin alpha 4
Application in the product of matter；
The aptamer is the single strand dna shown in sequence 1.
Whether present invention also offers aptamer or derivatives thereof is detecting or aid in detection testing sample containing whole
Close the application in plain α 4；
Or aptamer or derivatives thereof answering in the content of integrin alpha 4 in detecting or aiding in detection testing sample
With；
Or aptamer or derivatives thereof is preparing detection or is aiding in whether detection testing sample contains integrin alpha 4
Application in product；
Or aptamer or derivatives thereof content of integrin alpha 4 in detection or auxiliary detection testing sample is prepared
Application in product；
The aptamer is the single strand dna shown in sequence 1.
Present invention also offers aptamer or derivatives thereof to prepare diagnosis and/or the production for the treatment of multiple sclerosis
Application in product；
The aptamer is the single strand dna shown in sequence 1.
In above-mentioned application, the derivative is the derivative of any described aptamer in following (1)-(6)：
(1) aptamer shown in sequence 1 is deleted or increases one or several nucleotides, obtain fitting with the nucleic acid
Part has the derivative of the aptamer of identical function；
(2) aptamer shown in sequence 1 is carried out into nucleotides to substitute or modification, obtains and the aptamer has
There is the derivative of the aptamer of identical function；
(3) it transform the skeleton of the aptamer shown in sequence 1 as phosphorothioate ester skeleton, obtains fitting with the nucleic acid
Part has the derivative of the aptamer of identical function；
(4) RNA molecule encoded as the aptamer shown in sequence 1, obtain having with the aptamer identical
The aptamer derivative of function；
(5) peptide nucleic acid encoded as the aptamer shown in sequence 1, obtains having identical work(with the aptamer
The derivative of the aptamer of energy；
(6) by one end of the aptamer shown in sequence 1 or centre connect signaling molecule and/or bioactive molecule and/or
Functional group, obtain the derivative of aptamer that there is identical function with the aptamer；
Functional group in (6) is biotin group or fluorophor.
In above-mentioned application, the derivative of the aptamer is glimmering at 5 ' ends of above-mentioned aptamer or 3 ' end marks
Light group or biotin group.
In above-mentioned application, the derivative of the aptamer is to hold mark fluorescent group the 5 ' of above-mentioned aptamer
Or biotin group.
In above-mentioned application, the testing sample is cell；The cell is specially rat alveolar epithelial cells RAEC, people's embryo
Tire lung fibroblast MRC-5, people's alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder
Cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, people's ovary
Cancer cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, mankind T
Cell leukemia cell Jurkat E6-1, people's ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, human prostate
Cancer cell PC-3, human T cells lymthoma Hut-78 or human colon cancer cell LoVo.
It is a further object to provide a kind of product.
The active component of product provided by the invention is aptamer shown in sequence 1 or derivatives thereof；The product
Purposes be following 1) -6) at least one of：
1) identify and combine or assist in identifying and combine integrin alpha 4；
2) identify and combine or assist in identifying simultaneously binding activity integrin alpha 4；
3) detect or aid in the content of the integrin alpha 4 of detection testing sample；
4) detect or aid in whether to contain integrin alpha 4 in detection testing sample；
5) detect or aid in the material of detection and the antibody binding of anti-integrin alpha 4；
6) diagnose and/or treat multiple sclerosis.
In the said goods, the derivative is the derivative of any described aptamer in following (1)-(6)：
(1) aptamer shown in sequence 1 is deleted or increases one or several nucleotides, obtain fitting with the nucleic acid
Part has the derivative of the aptamer of identical function；
(2) aptamer shown in sequence 1 is carried out into nucleotides to substitute or modification, obtains and the aptamer has
There is the derivative of the aptamer of identical function；
(3) it transform the skeleton of the aptamer shown in sequence 1 as phosphorothioate ester skeleton, obtains fitting with the nucleic acid
Part has the derivative of the aptamer of identical function；
(4) RNA molecule encoded as the aptamer shown in sequence 1, obtain having with the aptamer identical
The aptamer derivative of function；
(5) peptide nucleic acid encoded as the aptamer shown in sequence 1, obtains having identical work(with the aptamer
The derivative of the aptamer of energy；
(6) by one end of the aptamer shown in sequence 1 or centre connect signaling molecule and/or bioactive molecule and/or
Functional group, obtain the derivative of aptamer that there is identical function with the aptamer；
Functional group in (6) is biotin group or fluorophor.
In above-mentioned application, the derivative of the aptamer is glimmering at 5 ' ends of above-mentioned aptamer or 3 ' end marks
Light group or biotin group.
In above-mentioned application, the derivative of the aptamer is to hold mark fluorescent group the 5 ' of above-mentioned aptamer
Or biotin group.
In the said goods, the testing sample is cell；The cell is specially rat alveolar epithelial cells RAEC, people's embryo
Tire lung fibroblast MRC-5, people's alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder
Cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, people's ovary
Cancer cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, mankind T
Cell leukemia cell Jurkat E6-1, people's ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, human prostate
Cancer cell PC-3, human T cells lymthoma Hut-78 or human colon cancer cell LoVo.
Present invention firstly discovers that aptamer Sgc-4e can be with specific recognition and with reference to integrin alpha 4, and utilize nucleic acid
The method that the specific binding effect of aptamers Sgc-4e and integrin alpha 4 establishes detection integrin alpha 4.It is experimentally confirmed：
The aptamer Sgc-4e of the present invention has the characteristics that affinity height, high specificity, non-immunogenicity and nontoxicity, based on core
The method for the detection integrin alpha 4 that sour aptamers Sgc-4e is established can provide new strategy for treatment multiple sclerosis.
Brief description of the drawings
Fig. 1 is ESI-MS the and MS/MS collection of illustrative plates of the representational polypeptide of the albumen of integrin alpha 4 of Sgc-4e-Bio extractions.Figure 1A
For [M+2H] of heavy isotope marks2+Ion ESI-MS spectrograms；Figure 1B is [M+2H] of light-duty isotope marks2+Ion
ESI-MS spectrograms；Fig. 1 C are [M+2H] of heavy isotope marks2+Ion MS/MS spectrograms, wherein, R* represents heavy isotope mark
The arginine of note；Fig. 1 D are [M+2H] of light-duty isotope marks2+Ion MS/MS spectrograms.
Fig. 2 is the Jurkat E6-1 dyed altogether with Sgc-4e-FAM and anti-CD49d-PE or anti-CD29-PE antibody
The flow cytomery result of cell.Wherein, L45-FAM is fluorescein-labeled control nucleic acid sequence；IgG-PE is control
Antibody.
Fig. 3 is the anti-antibody of integrin alpha 4 or aptamer Sgc-4e respectively with stablizing after wild type K562 cells or transfection
Express the flow cytomery result of the K562 cells of integrin alpha 4.
Fig. 4 is aptamer Sgc-4e, control nucleic acid sequence L45 and control nucleic acid aptamers Sgc-3b Western
Blot analysis results.
Fig. 5 is Jurkat E6-1s of the aptamer Sgc-4e with expression integrin alpha 4 in the solution containing different ions
The combination situation of cell.Wherein, L45 is control nucleic acid sequence.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.
Jurkat E6-1 cell deriveds are in ATCC, catalog number TIB-152TM。
Combination buffer (pH=7.4) is made up of solvent and solute, and solvent is water, solute and its concentration in a solvent
For：137mM NaCl、2.7mM KCl、2mM KH2PO4、10mM Na2HPO4、5mM MgCl2、1mM CaCl2。
Cell pyrolysis liquid is to contain 2% (volume fraction) Triton X-100,0.5% (volume fraction) SDS, 5mM
EDTA, 0.1mM PMSF and 2 μ g/mL protease inhibitor cocktails (pepstatin, leupeptin and aprotinin) knot
Close buffer solution.
Embodiment 1, aptamer Sgc-4e specificity identify and combine the identification of integrin alpha 4
First, the preparation of aptamer Sgc-4e and its derivative
1st, aptamer Sgc-4e synthesis
It is as follows by DNA synthesizer nucleic acid aptamers Sgc-4e, aptamer Sgc-4e nucleotide sequence：
5 '-TCACTTATTCAATTCGAGTGCGGATGCAAACGCCAGACAGGGGGACAGGAGA TAAGTGA-3 ' (sequence 1)；Root
Different molecules (such as biotin and fluorescence can be marked according to the needs of experiment on aptamer Sgc-4e 5 ' ends or 3 ' ends
Element etc.), obtain aptamer Sgc-4e derivative.
2nd, DNA is deprotected
After being deprotected with cold ammonia, then DNA is dissolved among TEAA solution.
3rd, DNA is purified
Purified by PAGE or high performance liquid chromatograph.
4th, DNA is dried
Dried by centrifugal concentrating.
5th, dissolving measure concentration is standby.
2nd, aptamer Sgc-4e specificity identifies and combines the identification of Integrin α4β1
1st, the isotope marks of Jurkat E6-1 cells
The Jurkat E6-1 cells of heavy isotope marks：To the culture without lysine and arginic RPMI 1640
Be separately added into base heavy isotope marks lysine ([13C6,15N2] -1B) and heavy isotope marks smart ammonia
Acid ([13C6]-L-arginine), make heavy isotope marks lysine and heavy isotope marks arginine in the medium
Concentration be respectively 0.274mM and 0.575mM.Cell 6-7 is cultivated for rear standby.
The Jurkat E6-1 cells of light-duty isotope marks：To the culture without lysine and arginic RPMI 1640
Be separately added into base light-duty isotope marks lysine ([12C6,14N2] -1B) and light-duty isotope marks smart ammonia
Acid ([12C6]-L-arginine), make light-duty isotope marks lysine and light-duty isotope marks arginine in the medium
Concentration be respectively 0.274mM and 0.575mM.Cell 6-7 is cultivated for rear standby.
2nd, the control nucleic acid sequence L45 of the aptamer Sgc-4e of biotin labeling and biotin labeling preparation
(1) the aptamer Sgc-4e (Sgc-4e-Bio) of biotin labeling
The aptamer Sgc-4e of biotin labeling is to hold couple biotin group the 5 ' of aptamer Sgc-4e
Obtain, dissolve Sgc-4e-Bio with combination buffer, after UV absorption demarcation concentration (100nM), 95 DEG C of heating 5min,
5min is placed on ice, and room temperature places 15min.
(2) the aptamer L45 (L45-Bio) of biotin labeling
The control nucleic acid sequence L45 of biotin labeling is to hold couple biotin groups to obtain the 5 ' of control nucleic acid sequence L45
Arrive, dissolve L45-Bio with combination buffer, after UV absorption demarcation concentration (100nM), 95 DEG C of heating 5min, on ice
5min is placed, room temperature places 15min.Control nucleic acid sequence L45 nucleotide sequence：
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN。
3rd, the extraction of aptamer Sgc-4e target proteinses
(1) 1 × 10 is taken respectively8Jurkat E6-1 cells of the heavy isotope marks of individual exponential phase of growth and light-duty same
Position element mark Jurkat E6-1 cells, PBS washing after, respectively with the Sgc-4e (Sgc-4e-Bio) of 4mL biotin labelings
The control nucleic acid sequence L45 (L45-Bio) of (100nM) or biotin labeling is incubated 30 minutes, is then added formaldehyde and is fixed 10 points
Clock.
(2) PBS is washed 2 times, adds 1mL cell pyrolysis liquid, is incubated 1 hour.
(3) 2000rpm centrifugations remove precipitation, collect supernatant, and the agarose microbeads for adding Streptavidin modification (are purchased from GE
Company, article No.：17-5113-01), it is incubated 1 hour.
(4) agarose microbeads that the Streptavidin after above-mentioned steps (3) are incubated is modified are washed with PBS, are washed 5 times, point
Albumen, the control nucleic acid sequence L45 of the heavy isotope marks of the aptamer Sgc-4e extractions of biotin labeling are not obtained
The light-duty isotope marks of the aptamer Sgc-4e extractions of the albumen, biotin labeling of the light-duty isotope marks of extraction
The albumen of albumen and the heavy isotope marks of control nucleic acid sequence L45 extractions.
4th, forward and reverse is tested
(1) positive experiment：By the albumen of the aptamer Sgc-4e of the biotin labeling heavy isotope marks extracted
Mixed with the albumen of the light-duty isotope marks of control nucleic acid sequence L45 extractions, obtain the aptamer of biotin labeling
The mixture of the albumen of the heavy isotope marks of Sgc-4e extractions and the light-duty isotope marks of control nucleic acid sequence L45 extractions
System.
(2) reversely experiment：By the albumen of the aptamer Sgc-4e of the biotin labeling light-duty isotope marks extracted
Mixed with the albumen of the heavy isotope marks of control nucleic acid sequence L45 extractions, obtain the aptamer of biotin labeling
The mixture of the albumen of the light-duty isotope marks of Sgc-4e extractions and the heavy isotope marks of control nucleic acid sequence L45 extractions
System.
5th, the enzymolysis of albumen and LC-MS identifications
(1) DTT is reduced：Respectively to the egg of the aptamer Sgc-4e of the biotin labeling heavy isotope marks extracted
Mixed system, the aptamer Sgc- of biotin labeling of the light-duty isotope marks of white and control nucleic acid sequence L45 extractions
In the albumen of the light-duty isotope marks of 4e extractions and the mixed system of the heavy isotope marks of control nucleic acid sequence L45 extractions
Add 200 μ L 20mM dithiothreitol (DTT)s (DTT), 56 DEG C of reaction 45min.
(2) IAA is alkylated：The product of step (1) is centrifuged, supernatant (removing DTT) is abandoned, 200 μ is separately added into precipitation
L 55mM iodoacetamides (IAA), react 30min in 37 DEG C of lucifuges.
(3) product of step (2) is centrifuged, abandons supernatant (removing IAA), 5 μ g mass spectrum trypsase are added into precipitation
(Promega companies, catalog number：V5111), 37 DEG C of digestions are stayed overnight, and obtain the polypeptide after digestion.
(4) polypeptide after digestion adds 100ul water, utilizes Ziptip C after vacuum concentration18Microtrabeculae desalination.Mass spectrum
Before analysis, -20 DEG C of refrigerators are placed.
(5) LTQ-Orbitrap Velos mass spectrographs (Thermo Fisher Scientific, San Jose, CA) are utilized
The product of step (4) is analyzed and identified.
(6) data search is analyzed：By original mass spectrometric data, MaxQuant search engines (version number is utilized：1.3.0.5)
In IPI albumen databases (version number：3.68) retrieved in.Some parameters of database search are as follows：Immobilization is modified to half Guang
Alkylation modification on propylhomoserin, the acetylation modification of the variable oxidative modification being modified on methionine and protein N terminal.Allow
2 leakage enzyme sites, the fault-tolerant amount of parent ion is 20ppm, and MS/MS fragment ion masses error is 0.5Da.Egg for identifying candidate
In vain, the unique peptide identification for having 2 or more than two goes out, and posteriority standard error (PEP) is less than 10-5.Candidate albumen need to be just
It is accredited out simultaneously to experiment and reversely in experiment.
Table 1, the protein using the SILAC combination aptamer Sgc-4e identified or control nucleic acid sequence L45
[a] PEP represents posterior probability error；[b] represents positive experiment twice and the twice average value of reverse experiment ratio
With standard deviation.
As a result it is as shown in table 1：SILAC (cold labeling technology) experimental identification goes out 20 albumen, aptamer
Sgc-4e and control nucleic acid sequence L45 extraction protein abundance ratio more than 2 are talin 1, integrin alpha 4 and integrin β_1, its
The remaining ratio including 7 Endogenous Biotin albumen is both less than 2., can be whole with memebrane protein and talin 1 is intracellular protein
Close the plain β 1 of α 4 to interact, cause intracellular signal to be conducted to extracellular signal.Illustrate that aptamer Sgc-4e can be with specific
Identify and combine Integrin α4β1；Aptamer Sgc-4e is to be combined following experiments with integrin alpha 4 or integrin β_1 to give
Prove.Wherein, the mass spectral results of integrin alpha 4 are as shown in Figure 1：In forward direction is tested, the integrin alpha 4 of heavy isotope marks is reflected
Make that (m/z 512.3 is [M+2H]2+The single isotopic peak of ion), Fig. 1 C are its MS/MS spectrograms；In reverse experiment, only
The integrin alpha 4 for having light-duty isotope marks is accredited out that (m/z 508.3 is [M+2H]2+The single isotopic peak of ion), Fig. 1 D
It is its MS/MS spectrogram.
2nd, the combination of flow cytometer showed method detection aptamer Sgc-4e and Integrin α4β1
1st, the preparation of aptamer solution and antibody-solutions and the processing of cell line
(1) preparation of fluorescein-labeled aptamer Sgc-4e solution (Sgc-4e-FAM) (100nM)
Fluorescein-labeled aptamer Sgc-4e is 5 ' the end coupling fluorescein base groups in aptamer Sgc-4e
Obtain, dissolve Sgc-4e-FAM with combination buffer, after UV absorption demarcation concentration (100nM), 95 DEG C of heating 5min,
5min is placed on ice, and room temperature places 15min.
(2) preparation of the antibody-solutions of anti-integrin alpha 4 (anti-CD49d-PE) (1.25 μ g/mL) of PE marks
The antibody of anti-integrin alpha 4 (anti-CD49d-PE) of PE marks is the product of eBioscience companies, each to test
Add 0.125 μ g, final concentration of 1.25 μ g/mL.
(3) preparation of fluorescein-labeled control nucleic acid sequence solutions (L45-FAM) (100nM)
Fluorescein-labeled control nucleic acid sequence L45-FAM is 5 ' the end coupling fluorescence in control nucleic acid sequence L45-FAM
What plain group obtained, with buffer solution L45-FAM, after UV absorption demarcation concentration (100nM), 95 DEG C are heated 5min,
5min is placed on ice, and room temperature places 15min.Control nucleic acid sequence L45 nucleotide sequence：
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN。
(4) preparation of the mouse IgG1K Isotype controls immunoglobulin solution (lgG-PE) (1.25 μ g/mL) of PE marks
The mouse IgG1K Isotype control immunoglobulins of PE marks are the products of eBioscience companies, and each test adds
0.125 μ g, final concentration of 1.25 μ g/mL.
(5) preparation of the anti-integrin β_1 antibody-solutions (anti-CD29-PE) (1.25 μ g/mL) of PE marks
The anti-integrin β_1 antibody (anti-CD29-PE) of PE marks is the product of eBioscience companies, each to test
Add 0.125 μ g, final concentration of 1.25 μ g/mL.
(6) culture of Jurkat E6-1 cells
Human leukemia Jurkat E6-1 cells are trained in the RPMI 1640 containing 10%FBS, 1% penicillin and streptomysin
Support in base, 37 DEG C, cultivated in cell culture incubator under conditions of 5% carbon dioxide.The cell of exponential growth is taken, after directly dispelling
Washed with lavation buffer solution, be equally divided into several pieces, every part of cell number is 5 × 104It is individual.
2nd, experiment packet and processing
Above-mentioned Jurkat E6-1 cells are handled according to following six groups respectively：
First group：It is incubated in the 100 μ L combination buffers containing lgG-PE (1.25 μ g/mL) and L45-FAM (100nM)
Jurkat E6-1 cells；
Second group：Containing anti-CD49d-PE (1.25 μ g/mL) buffering is being combined with L45-FAM (100nM) 100 μ L
Jurkat E6-1 cells are incubated in liquid；
3rd group：It is slow being combined containing anti-CD49d-PE (1.25 μ g/mL) with Sgc-4e-FAM (100nM) 100 μ L
Jurkat E6-1 cells are incubated in fliud flushing；
4th group：In the 100 μ L combination buffers containing lgG-PE (1.25 μ g/mL) and Sgc-4e-FAM (100nM)
It is incubated Jurkat E6-1 cells；
5th group：In the 100 μ L combination buffers containing anti-CD29-PE (1.25 μ g/mL) Yu L45-FAM (100nM)
Middle incubation Jurkat E6-1 cells；
6th group：It is slow being combined containing anti-CD29-PE (1.25 μ g/mL) with Sgc-4e-FAM (100nM) 100 μ L
Jurkat E6-1 cells are incubated in fliud flushing.
3rd, flow cytometry analysis
The cell after above-mentioned six groups of processing is analyzed respectively with flow cytometer.Above-mentioned every group of Setup Experiments three are solely
It is vertical to repeat to test.
The testing result of flow cytometer is as shown in Figure 2：First group is control antibodies (lgG-PE) and control nucleic acid sequence
(L45-FAM) situation about being combined with cell；Second group is the anti-integration in the presence of control nucleic acid sequence (L45-FAM)
The situation that the plain antibody of α 4 (anti-CD49d-PE) is combined with cell；3rd group be the anti-antibody anti-CD49d-PE of integrin alpha 4 and
Situation about being combined in the case of aptamer Sgc-4e-FAM is simultaneous with cell；4th group is in control antibodies (lgG-
PE in the presence of), situation that aptamer Sgc-4e-FAM is combined with cell；5th group is in control nucleic acid sequence
(L45-FAM) in the presence of, situation that anti-integrin β_1 antibody (anti-CD29-PE) is combined with cell；6th group is anti-
The feelings combined in the case of integrin β_1 antibody anti-CD29-PE and aptamer Sgc-4e-FAM are simultaneous with cell
Condition.Because integrin alpha 4 and the subunits of β 1 form heterodimer in cell membrane surface, aptamer Sgc-4e can be with anti-integration
Plain α 4 or beta 1 antibodies are incorporated into cell surface altogether, and it is in good linear relation that aptamer, which is combined with its antibody binding, illustrates core
Sour aptamers Sgc-4e can be combined with Integrin α4β1, and not interacted with its antibody binding.In order to further verify core
Sour aptamers Sgc-4e is combined with integrin alpha 4 or integrin β_1, has carried out following experiment.
4th, flow cytometer showed method proves the combination of aptamer Sgc-4e and integrin alpha 4
1st, the structure of the recombinant vectors of pcDNA3.1- α 4
By the DNA sequence dna insertion pcDNA3.1 carriers (Life of the encoding human integrin alpha 4 (ITGA4) shown in sequence 3
Technologies companies) NotI and XhoI restriction enzyme sites between, obtain the recombinant vectors of pcDNA3.1- α 4.
Sequence verification is carried out to the recombinant vectors of pcDNA3.1- α 4：As a result it is by sequence to show the recombinant vectors of pcDNA3.1- α 4
Between NotI the and XhoI restriction enzyme sites of DNA sequence dna insertion pcDNA3.1 carriers shown in 3, and keep other of pcDNA3.1 carriers
The constant obtained carrier of sequence.Integrin alpha 4 shown in the vector expression sequence 2.
2nd, the 5 μ g recombinant vectors of pcDNA3.1- α 4 are utilizedCell LineKit V
For kit (Amaxa, Lonza) electrotransfection into K562 cells, the cell after transfection is containing 0.8g/L Geneticins (G418)
RPMI1640 culture mediums cell culture fluid in cultivate, obtain the K562 cells of stable expression Integrin α4β1.
3rd, further integrin is expressed by stable on flow cytometer using the anti-antibody anti-CD49d-PE of integrin alpha 4
The β 1 of α 4 K562 cell sortings obtain the K562 cells of high expression Integrin α4β1.
4th, the above-mentioned high K562 cells for expressing Integrin α4β1 or K562 cells are carried out following four groups and handled respectively：
First group：K562 cells are incubated in the 100 μ L combination buffers containing anti-CD49d-PE (1.25 μ g/mL)；
Second group：Stable expression is incubated in the 100 μ L combination buffers containing anti-CD49d-PE (1.25 μ g/mL)
The K562 cells of Integrin α4β1；
3rd group：K562 cells are incubated in the 100 μ L combination buffers containing Sgc-4e-FAM (100nM)；
4th group：Stable expression integrin alpha 4 is incubated in the 100 μ L combination buffers containing Sgc-4e-FAM (100nM)
β 1 K562 cells.
5th, flow cytometer is analyzed
The cell after above-mentioned four groups of processing is analyzed respectively with flow cytometer.Above-mentioned every group of Setup Experiments three are solely
It is vertical to repeat to test.
As a result it is as shown in Figure 3：The high expression integrin β_1 of K562 cells, but the albumen of integrin alpha 4 is not expressed, stable expression
The K562 cells of Integrin α4β1 can express integrin alpha 4 and integrin β_1 simultaneously.It can be seen that anti-CD49d-
PE antibody can combine the K562 cells (β 1 of K562- α 4) of transfection integrin alpha 4, but not combine the K562 cells of wild type
(K562-WT)；And aptamer Sgc-4e-FAM can equally combine the K562 cells (β of K562- α 4 of transfection integrin alpha 4
1) the K562 cells (K562-WT) of wild type, are not combined yet.Illustrate that aptamer Sgc-4e can specifically bind integration
Plain α 4.
The application of embodiment 2, aptamer Sgc-4e in the expression of integrin alpha 4 of measure different type cell
In order to which clear and definite aptamer Sgc-4e determines the feelings of integrin alpha 4 (NP_000876) expression in different cells
Condition, it is Bu Tong to be measured by flow cytometer measure to be utilized respectively fluorescence labeling aptamer Sgc-4e and the anti-antibody of integrin alpha 4
The expression of the integrin alpha 4 of cell.Comprise the following steps that：
First, the preparation of fluorescein-labeled aptamer Sgc-4e solution (Sgc-4e-FAM)
Fluorescein-labeled aptamer Sgc-4e is 5 ' the end coupling fluorescein base groups in aptamer Sgc-4e
Obtain, dissolve Sgc-4e-FAM with combination buffer, after UV absorption demarcation concentration (100nM), 95 DEG C of heating 5min,
5min is placed on ice, and room temperature places 15min.
2nd, the pretreatment of cell line
Each ware of cell of the growth logarithmic phase of following 16 kinds of cell lines is taken respectively：Rat alveolar epithelial cells (RAEC),
Human embryonic lung's fibrocyte (MRC-5), people's alveolar epithelial cells (A549), human cervical carcinoma cell (Hela), human liver cancer cell
(Huh-7), human bladder cancer cell (T24), human liver cell cancer cell (SK-Hep-1), human breast cancer cell (MCF-7), resistance people
Breast cancer cell (MCF-7R), Proliferation of Human Ovarian Cell (SKOV-3), human breast cancer cell (MDA-MB-231), human epithelium's cancer are thin
Born of the same parents (A431), people's ileocecum adenocarcinoma cell (HCT-8), human embryonic kidney cell (HEK-293), Human Prostate Cancer Cells (PC-3),
Human colon cancer cell (LoVo), after being digested to single dispersing cell suspension with 0.2%EDTA, is washed with lavation buffer solution, if being divided into
Dry part, every part of cell number are 5 × 104It is individual；Respectively by the human leukemia cell (Jurkat E6-1) of suspension growth, human leukemia
Cell (K562), human T cells lymthoma (Hut-78) are washed 2 times after directly dispelling with lavation buffer solution, are equally divided into some
Part, every part of cell number is 5 × 104It is individual.
3rd, flow cytomery
Fluorescein-labeled aptamer Sgc-4e (Sgc-4e-FAM) that the step of embodiment 2 one is prepared, fluorescence
Control nucleic acid sequence L-45 (L45-FAM), control antibodies (lgG-PE) and the antibody of anti-integrin alpha 4 of element mark (are purchased from：
EBioscience companies, catalog number：12-0499) cell line respectively with 19 kinds of separate sources mixes, and respectively obtains mixed
Liquid is closed, mixed liquor is incubated 30min on ice, washed twice with lavation buffer solution, after crossing 400 eye mesh screens, flow cytometer
Detected.
The fluorescence intensity data of first passage is collected with the FACSCalibur flow cytometers of BD companies, as cell table
The fluorescence intensity in face.The instrument of each sample measures fluorescence intensity and deducts cell autofluorescence, obtains each sample and is incorporated in carefully
The fluorescence intensity of the aptamer of cellular surface.Set a threshold value so that percentage of cells has the control nucleic acid sequence more than 95%
The cell fluorescence intensity value of row L-45 processing is less than the threshold value.Cell fluorescence intensity value be more than the threshold value be considered as aptamer with
Cell can be specifically bound.Rear fluorescence intensity is combined with aptamer using cell and is used as weighing apparatus more than the percentage of cells of this threshold value
It is strong and weak with cell binding ability to measure aptamer.Wherein, nothing：Fluorescence intensity after cell to be measured is combined with aptamer exceedes this
The percentage of cells of one threshold value is less than 15%；It is medium：Fluorescence intensity after cell to be measured is combined with aptamer exceedes this threshold
The percentage of cells of value is 15-50%；By force：Fluorescence intensity after cell to be measured is combined with aptamer exceedes the thin of this threshold value
Born of the same parents' percentage is 50-80%；It is very strong：Cell to be measured combined with aptamer after fluorescence intensity exceed this threshold value cell
Percentage is more than 80%.
The testing result of the cell line to be measured of 19 kinds of separate sources is as shown in table 2：As can be seen from the table, aptamer
Sgc-4e measurement results and the anti-TPPA result of integrin alpha 4 are completely the same.It is anti-to illustrate that aptamer Sgc-4e can be substituted
The detection of the TPPA integrin alpha 4 of integrin alpha 4.
Table 2, the expression for being utilized respectively the anti-antibody of integrin alpha 4 and aptamer measure different type cellular integration element α 4
The influence of the combination of embodiment 3, divalent ion to aptamer Sgc-4e and integrin alpha 4
The activity of integrin alpha 4 is by divalent ion (particularly Mg2+、Ca2+Or Mn2+) regulation and control, in order to prove aptamer
Sgc-4e can be combined with active integrin alpha 4, have studied divalent ion to aptamer Sgc-4e and integrin alpha 4
With reference to the influence of situation.
First, the preparation of fluorescein-labeled aptamer Sgc-4e solution (Sgc-4e-FAM)
Fluorescein-labeled aptamer Sgc-4e is 5 ' the end coupling fluorescein base groups in aptamer Sgc-4e
Obtain, dissolve Sgc-4e-FAM with combination buffer, after being 100nM according to UV absorption demarcation concentration, 95 DEG C of heating 5min,
5min is placed on ice, and room temperature places 15min.
2nd, above-mentioned Jurkat E6-1 cells are handled according to following five groups respectively：
First group：Jurkat E6-1 cells are incubated in the 100 μ L combination buffers containing L45-FAM (100nM)；
Second group：Jurkat is incubated in the 100 μ L cushioning liquid without divalent ion, containing Sgc-4e-FAM (100nM)
E6-1 cells；
3rd group：Comprising only Mg2+Ion, Sgc-4e-FAM (100nM) 100 μ L cushioning liquid in be incubated Jurkat
E6-1 cells；
4th group：Comprising only Ca2+Ion, Sgc-4e-FAM (100nM) 100 μ L cushioning liquid in be incubated Jurkat
E6-1 cells；
5th group：Comprising only Mn2+Ion, Sgc-4e-FAM (100nM) 100 μ L cushioning liquid in be incubated Jurkat
E6-1 cells；
Above-mentioned cushioning liquid is made up of 20mM Hepes (pH 7.4) and 140mM NaCl.
2nd, flow cytometer is analyzed
The cell after above-mentioned five groups of processing is analyzed respectively with flow cytometer.Above-mentioned every group of Setup Experiments three are solely
It is vertical to repeat to test.
As a result it is as shown in Figure 4：In the presence of without divalent ion, integrin alpha 4 is inactive, aptamer Sgc-4e not with
Integrin alpha 4 combines；And in Mg2+、Ca2+Or Mn2+In the presence of, integrin alpha 4 is active, and aptamer Sgc-4e is with integrating
The plain high specifics of α 4 combine.
Integrin alpha 4 in embodiment 4, aptamer Sgc-4e pull-down cell pyrolysis liquids
In order to which clear and definite aptamer Sgc-4e is in Western blot, Co-IP etc. application, biotin mark is utilized
Integrin alpha 4 in the aptamer Sgc-4e pull-down cell pyrolysis liquids of note.
First, the preparation of the aptamer Sgc-4e solution (Sgc-4e-FAM) of biotin labeling
Fluorescein-labeled aptamer Sgc-4e is 5 ' the end coupling fluorescein base groups in aptamer Sgc-4e
Obtain, dissolve Sgc-4e-FAM with combination buffer, after being 100nM according to UV absorption demarcation concentration, 95 DEG C of heating 5min,
5min is placed on ice, and room temperature places 15min.
2nd, protein extraction
1st, 2 × 10 are respectively taken7Individual exponential growth human leukemia cell (Jurkat E6-1), after PBS washings, respectively with compareing
Nucleotide sequence L45, control nucleic acid aptamers Sgc-3b or aptamer Sgc-4e are incubated 30min, then add 1% formaldehyde
It is crosslinked 10min.
Aptamer Sgc-3b nucleotide sequence：5’-
CTTATTCAATTCCCGTGGGAAGGCTATAGAGGGGCCAGTCTATGAATAAG-3’；
Control nucleic acid sequence L45 nucleotide sequence：
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN。
2nd, after washing 2 times with combination buffer, the cell pyrolysis liquid concussion for being separately added into 1mL is incubated 60min.
3rd, 7000rpm is centrifuged, and takes supernatant to be separately added into 20ul Streptavidin agarose microbeads, and concussion is incubated 60min, so
Wash 5 times afterwards.
3rd, Western blot
1st, microballoon is separately added into 1 × SDS loading buffers, and in 95 DEG C of heat denatured 30min, then loading, 150V are electric
Piezoelectricity is swum；
2nd, using Trans-Blot Turbo transfer systems (Bole company) at 4 DEG C by albumen transferring film to pvdf membrane, then
It is incubated 6 hours in 4 DEG C of closings using PBS-T (the PBS with 0.1%Tween) solution containing 5% milk；
3 then add anti-CD-49d antibody (rabbit-anti human antibody ab81280,1：4000 dilutions, Abcam) 4 DEG C incubate overnight
Educate；
4th, after washing three times, the goat anti-rabbit igg secondary antibody for adding HRP marks is incubated at room temperature 1 hour；
5th, concussion washing three times, adds Pierce ECL Western Blotting substrate reactions 5min, development.
As a result it is as shown in Figure 5：Aptamer Sgc-4e pull-down sample has band at 150kD, shows core
Sour aptamers Sgc-4e can be with pull-down integrin alphas 4, and control nucleic acid sequence L45 or control nucleic acid aptamers Sgc-3b
Can not pull-down integrin alphas 4.Illustrate that aptamer Sgc-4e can substitute the anti-antibody of integrin alpha 4 and be used for Western
In blot, Co-IP, ELISA.
The antibody natalizumab (Natalizumab) of anti-integrin alpha 4 is that a kind for the treatment of clinically applied is multiple
Property hardening antibody drug, and aptamer Sgc-4e can be combined with the integrin alpha 4 of active form, therefore it has
The medicine of exploitation treatment multiple sclerosis or the purposes of product.
Claims (10)
1. aptamer or derivatives thereof is identifying and is combining or assist in identifying and combine examining for the non-disease in integrin alpha 4
Application in disconnected and treatment method；
Or aptamer or derivatives thereof is in preparing and identifying and combine or assist in identifying and combine the product of integrin alpha 4
Using；
The aptamer is the single strand dna shown in sequence 1；
The derivative is that one end of the aptamer shown in sequence 1 or centre are connected into functional group, is obtained and the core
Sour aptamers have the derivative of the aptamer of identical function；
The functional group is biotin group or fluorophor.
2. non-disease of the aptamer or derivatives thereof in identifying and combining or assist in identifying simultaneously binding activity integrin alpha 4
Diagnostic and therapeutic method in application；
Or aptamer or derivatives thereof is preparing identification and is combining or assist in identifying the product of simultaneously binding activity integrin alpha 4
In application；
The aptamer is the single strand dna shown in sequence 1；
The derivative is that one end of the aptamer shown in sequence 1 or centre are connected into functional group, is obtained and the core
Sour aptamers have the derivative of the aptamer of identical function；
The functional group is biotin group or fluorophor.
3. aptamer or derivatives thereof non-disease in detecting or aiding in material of the detection with the antibody binding of anti-integrin alpha 4
Application in the diagnostic and therapeutic method of disease；
Or aptamer or derivatives thereof is preparing detection or auxiliary detection and the material of the antibody binding of anti-integrin alpha 4
Application in product；
The aptamer is the single strand dna shown in sequence 1；
The derivative is that one end of the aptamer shown in sequence 1 or centre are connected into functional group, is obtained and the core
Sour aptamers have the derivative of the aptamer of identical function；
The functional group is biotin group or fluorophor.
4. aptamer or derivatives thereof is detecting or aided in whether detection testing sample contains the non-disease in integrin alpha 4
Diagnostic and therapeutic method in application；
Or non-disease of the aptamer or derivatives thereof in the content of integrin alpha 4 in detecting or aiding in detection testing sample
Diagnostic and therapeutic method in application；
Aptamer or derivatives thereof prepare detection or auxiliary detection testing sample whether the product containing integrin alpha 4
In application；
Or the product of aptamer or derivatives thereof content of integrin alpha 4 in detection or auxiliary detection testing sample is prepared
In application；
The aptamer is the single strand dna shown in sequence 1；
The derivative is that one end of the aptamer shown in sequence 1 or centre are connected into functional group, is obtained and the core
Sour aptamers have the derivative of the aptamer of identical function；
The functional group is biotin group or fluorophor.
5. application of the aptamer or derivatives thereof in the product for preparing diagnosis and/or treatment multiple sclerosis；
The aptamer is the single strand dna shown in sequence 1；
The derivative is that one end of the aptamer shown in sequence 1 or centre are connected into functional group, is obtained and the core
Sour aptamers have the derivative of the aptamer of identical function；
The functional group is biotin group or fluorophor.
6. according to any described application in claim 4, it is characterised in that：The testing sample is cell.
7. application according to claim 6, it is characterised in that：The cell is rat alveolar epithelial cells RAEC, people's embryo
Tire lung fibroblast MRC-5, people's alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder
Cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, people's ovary
Cancer cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, mankind T
Cell leukemia cell Jurkat E6-1, people's ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, human prostate
Cancer cell PC-3, human T cells lymthoma Hut-78 or human colon cancer cell LoVo.
8. a kind of active component is the product of the aptamer shown in sequence 1 or derivatives thereof；The purposes of the product is such as
At least one of lower 1) -6)：
1) identify and combine or assist in identifying and combine integrin alpha 4；
2) identify and combine or assist in identifying simultaneously binding activity integrin alpha 4；
3) detect or aid in the content of the integrin alpha 4 of detection testing sample；
4) detect or aid in whether to contain integrin alpha 4 in detection testing sample；
5) detect or aid in the material of detection and the antibody binding of anti-integrin alpha 4；
6) diagnose and/or treat multiple sclerosis；
The derivative is that one end of the aptamer shown in sequence 1 or centre are connected into functional group, is obtained and the core
Sour aptamers have the derivative of the aptamer of identical function；
The functional group is biotin group or fluorophor.
9. product according to claim 8, it is characterised in that：The testing sample is cell.
10. product according to claim 9, it is characterised in that：The cell is rat alveolar epithelial cells RAEC, people's embryo
Tire lung fibroblast MRC-5, people's alveolar epithelial cells A549, human cervical carcinoma cell Hela, human liver cancer cell Huh-7, human bladder
Cancer cell T24, human liver cell cancer cell SK-Hep-1, human breast cancer cell line Bcap-37, human breast cancer cell line Bcap-37 R, people's ovary
Cancer cell SKOV-3, Leukemia K562 cell, human breast cancer cell MDA-MB-231, human epithelial cancer cells A431, mankind T
Cell leukemia cell Jurkat E6-1, people's ileocecum adenocarcinoma cell HCT-8, human embryonic kidney cell HEK-293, human prostate
Cancer cell PC-3, human T cells lymthoma Hut-78 or human colon cancer cell LoVo.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354245.9A CN104988154B (en) | 2015-06-24 | 2015-06-24 | Application of the aptamer in identifying and combining integrin alpha 4 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354245.9A CN104988154B (en) | 2015-06-24 | 2015-06-24 | Application of the aptamer in identifying and combining integrin alpha 4 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104988154A CN104988154A (en) | 2015-10-21 |
| CN104988154B true CN104988154B (en) | 2017-12-08 |
Family
ID=54300049
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510354245.9A Active CN104988154B (en) | 2015-06-24 | 2015-06-24 | Application of the aptamer in identifying and combining integrin alpha 4 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104988154B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624166B (en) * | 2016-01-31 | 2018-05-04 | 湖南大学 | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared |
| TWI642778B (en) | 2016-11-17 | 2018-12-01 | 國立清華大學 | Aptamer specific to ovarian cancer and detection method for ovarian cancer |
| CN106520773B (en) * | 2016-11-30 | 2019-01-25 | 吴冬 | The aptamer WYZ-3 and its screening technique of ovarian mucinous cancer cell 3AO and application |
| CN106591314B (en) * | 2016-11-30 | 2019-02-12 | 吴冬 | The aptamer WYZ-4 and its screening technique of ovarian mucinous cancer cell 3AO and application |
| CN114058623B (en) * | 2020-08-06 | 2023-12-12 | 中国科学院化学研究所 | Aptamer for recognizing and combining integrin alpha 3 subunit and related functions thereof |
| CN115820650B (en) * | 2022-11-11 | 2024-07-05 | 湖南大学 | Nucleic acid aptamer capable of specifically recognizing and combining integrin alpha 4 and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101537189A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Aptamer and new use of derivative thereof |
| CN101538613A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Molecular probe related to disease and method for producing the same |
| WO2011020874A1 (en) * | 2009-08-20 | 2011-02-24 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Vla-4 as a biomarker for prognosis and target for therapy in duchenne muscular dystrophy |
| WO2014021630A1 (en) * | 2012-07-31 | 2014-02-06 | 포항공과대학교 산학협력단 | Aptamer specific to integrin αvβ3 and use thereof |
-
2015
- 2015-06-24 CN CN201510354245.9A patent/CN104988154B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101537189A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Aptamer and new use of derivative thereof |
| CN101538613A (en) * | 2009-04-28 | 2009-09-23 | 谭蔚泓 | Molecular probe related to disease and method for producing the same |
| WO2011020874A1 (en) * | 2009-08-20 | 2011-02-24 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Vla-4 as a biomarker for prognosis and target for therapy in duchenne muscular dystrophy |
| WO2014021630A1 (en) * | 2012-07-31 | 2014-02-06 | 포항공과대학교 산학협력단 | Aptamer specific to integrin αvβ3 and use thereof |
Non-Patent Citations (2)
| Title |
|---|
| Aptamer therapeutics advance;Jennifer F Lee 等;《Current Opinion in Chemical Biology》;20060418;第10卷(第3期);第282-289页 * |
| Aptamer-conjugated magnetic nanoparticles enable efficient targeted detection of integrin αvβ3 via magnetic resonance imaging;Eun-Kyung Lim 等;《journal of biomedical materials research》;20130409;第102卷(第1期);第49-59页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104988154A (en) | 2015-10-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104988154B (en) | Application of the aptamer in identifying and combining integrin alpha 4 | |
| Lane et al. | Cell-derived extracellular vesicles can be used as a biomarker reservoir for glioblastoma tumor subtyping | |
| Eva et al. | Rab11 and its effector Rab coupling protein contribute to the trafficking of β1 integrins during axon growth in adult dorsal root ganglion neurons and PC12 cells | |
| Xiong et al. | Cancer protein biomarker discovery based on nucleic acid aptamers | |
| Hu et al. | Potentiality of exosomal proteins as novel cancer biomarkers for liquid biopsy | |
| CN104903350B (en) | It is specific to the new antibodies and application thereof of CLEC14A | |
| CN102827845B (en) | Nucleic acid aptamer of epithelial cell adhesion molecule and preparation method thereof | |
| CN104293794B (en) | Nucleic acid aptamers specifically combined with beta-amyloid precursor protein lyase 1 and application of aptamers | |
| CN105044322B (en) | Aptamer application in identifying and combine L selection element | |
| KR20210093266A (en) | Method for Simultaneous Detection of Exosome Membrane Protein and mRNA | |
| CN106191069B (en) | A kind of aptamer sequence and its application identified and combine human TfR | |
| Haskins et al. | Molecular characteristics in MRI-classified group 1 glioblastoma multiforme | |
| Chen et al. | Anti-human CD138 monoclonal antibodies and their bispecific formats: generation and characterization | |
| CN109337909A (en) | It is a kind of detect liver cancer drug-resistant cell strain aptamer and its application | |
| Zhang et al. | αvβ1 integrin is enriched in extracellular vesicles of metastatic breast cancer cells: A mechanism mediated by galectin‐3 | |
| Hong et al. | Universal endogenous antibody recruiting nanobodies capable of triggering immune effectors for targeted cancer immunotherapy | |
| RU2009132631A (en) | PEPTIDES WHICH TARGETS ARE BLOODY VESSELS OF MALIGNANT LUNG NEW FORMATIONS, AND THEIR APPLICATIONS | |
| Yang et al. | Activated leukocyte cell adhesion molecule (ALCAM)/CD166 in pancreatic cancer, a pivotal link to clinical outcome and vascular embolism | |
| Scholze et al. | Two distinct populations of α1α6-containing GABAA-receptors in rat cerebellum | |
| CN109837281A (en) | Specifically bind aptamer and its screening, identification and application of S100P albumen | |
| Henderson et al. | A balance between actin and Eps8/IRSp53 utilization in branched versus linear actin networks determines tunneling nanotube formation | |
| KR101439856B1 (en) | A marker comprising anti-ATIC autoantibodies and a composition comprising antigen thereof for diagnosing liver cancer | |
| Manzano et al. | Proteomic landscape of tunneling nanotubes reveals CD9 and CD81 tetraspanins as key regulators | |
| CN108239646A (en) | Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer | |
| Perez-Hernandez et al. | An integrated workflow for phosphopeptide identification in natural killer cells (NK-92MI) and their targets (MDA-MB-231) during immunological synapse formation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |