CN105624166A - Nucleic acid aptamer for detecting human bladder transitional cell carcinoma cells and application of nucleic acid aptamer to preparation of detection preparations - Google Patents
Nucleic acid aptamer for detecting human bladder transitional cell carcinoma cells and application of nucleic acid aptamer to preparation of detection preparations Download PDFInfo
- Publication number
- CN105624166A CN105624166A CN201610069906.8A CN201610069906A CN105624166A CN 105624166 A CN105624166 A CN 105624166A CN 201610069906 A CN201610069906 A CN 201610069906A CN 105624166 A CN105624166 A CN 105624166A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- nucleic acid
- cell carcinoma
- acid aptamer
- human bladder
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3517—Marker; Tag
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a nucleic acid aptamer for detecting human bladder transitional cell carcinoma cells (T24) and application of the nucleic acid aptamer to preparation of detection preparations. Compared with the prior art, the nucleic acid aptamer and application thereof have the advantages that the found nucleic acid aptamer with no immunogenicity has higher affinity and specificity than associated protein antibodies, can be synthesized chemically in vitro, is small in molecular weight, capable of modifying and substituting for different parts of nucleic acid aptamers, stable in sequence, convenient to store and mark and the like; the nucleic acid aptamer is simpler and rapider to operate when being used for human bladder transitional cell carcinoma cell detection, and is lower in synthesis cost than antibody preparation cost, short in period and good in reproducibility.
Description
Technical field
The present invention relates to a kind of aptamer and application thereof, particularly relate to a kind of aptamer that can be used for Human Bladder Transitional Cell Carcinoma cell and clinical sample tissue detection and the application process of preparation detectable thereof.
Background technology
Bladder cancer is China's Urology Surgery one of modal tumor clinically, is the disease of a kind of direct threat survival of patients. Worldwide, bladder cancer sickness rate occupies the 9th of malignant tumor, male's ranking the 6th, after women comes the tenth. America and Europe, bladder cancer sickness rate occupies the 4th of male malignancy, after ranking carcinoma of prostate, pulmonary carcinoma and colon cancer, also comes after ten at female malignant. Within 2002, world bladder cancer age standardization sickness rate male is 10.1/10 ten thousand, and women is 2.5/10 ten thousand, and age-standardized death rate male is 4/,100,000, and women is 1.1/10 ten thousand. American male bladder cancer sickness rate is 24.1/10 ten thousand, and women is 6.4/10 ten thousand. American Cancer Society's prediction U.S.'s bladder cancer neopathy number of cases in 2010 is 70530 examples (male 52760 examples, female 17770 examples), and death number is 14680 examples (male 10410 examples, female 4270 examples). In China, male bladder cancer morbidity occupies the 8th of general tumour, and women comes after the 12nd, and sickness rate is far below western countries, and within 2002, China bladder cancer age standardization sickness rate male is 3.8/10 ten thousand, and women is 1.4/10 ten thousand. In recent years, China urban tumor incidence reports that showing that bladder cancer sickness rate has increases trend. Bladder cancer male's sickness rate is 3-4 times of women. And urbanite's bladder cancer mortality rate is apparently higher than rural area. Within 2009, China urbanite bladder cancer age-standardized death rate male is 3.79/10 ten thousand, and women is 1.30/10 ten thousand; And rural area Male resident bladder cancer age-standardized death rate is 2.42/10 ten thousand, women is 0.81/10 ten thousand.
Bladder cancer patients there will be cystic fibrosis, and bladder capacity reduces, and even occurs that ureteral refluxes, and with kiney edema and kidney inflammation, hematuria occurs, even kidney necrosis and uremia, threat to life. Showing according to another relevant report, bladder cancer can cause tuberculosis, has the patient of tuberculosis medical history after positive antibacterial therapy, still has urinary tract infection symptom or Urine sediments analyzer abnormal. Additionally, bladder cancer patients pain when swollen urine can double, it is necessary to after waiting until to urinate, pain just can be slightly slow. Various pressure in life all can make aggravation or the recurrence of bladder cancer patients, greatly reduces the quality of life of patient.
Bladder cancer has polytype, including urothelium (dividing a word with a hyphen at the end of a line) cell carcinoma, squamous cell carcinoma and carcinoma glanular cell, and next also more rare small cell carcinoma, mixed type carcinoma, carcinosarcoma and metastatic carcinoma etc. In the middle of this, Urothelial Carcinoma of Bladder is most commonly seen, accounts for more than the 90% of bladder cancer; Squamous cell carcinoma of bladder is more rare, accounts for the 3%��7% of bladder cancer.
Nowadays, urinary cytology inspection is Diagnosis of Bladder and postoperative with one of main method examined. The collection of Urine specimens is generally by naturally urinating, it is also possible to by bladder irrigation, so can obtain more cancerous cell, be beneficial to raising diagnosis. The sensitivity of urinary cytology detection bladder cancer is 13%��75%, and specificity is 85%��100%. Sensitivity is closely related with the pernicious classification of cancerous cell, the low bladder cancer sensitivity of classification is relatively low, it is owing to tumor cell differentiation is better on the one hand, its feature is similar to normal cell, not easily differentiate, on the other hand owing to cohering relative close between cancerous cell, it does not have abundant cancerous cell is shed in urine and is detected, so urinary cytology feminine gender can not get rid of the existence of low level bladder transitional cell carcinoma. Additionally, in Urine specimens, cancer cell number is few, cell be not true to type or the factor such as technological disparity of degeneration, urinary system infection, calculus, bladder instillation to treat and examiner can affect urinary cytology and check result. Although major part urine bladder cancer label shows higher sensitivity, but its specificity is general lower than urinary cytology inspection, up to the present, remain without a kind of desirable label and can replace cystoscope and urinary cytology inspection and to the diagnosis of bladder cancer, treatment, postoperative with examining and the aspect such as prognosis makes enough judgements. Therefore, search out a kind of desirable label so that can develop quickly, the method for Accurate Diagnosis and treatment bladder cancer is just particularly important.
Aptamer (nucleicacidaptamer) is the oligonucleotide of the 20-50 base of the energy high-affinity binding target molecule screened from the random single chain nucleic acid library of synthetic, including DNA aptamer and RNA aptamer. Aptamers has the features such as target molecule is wide, affinity is high, high specificity because of the multiformity of its structure, meanwhile, compares conventional antibodies, and the transformation little, easy of adaptor molecules amount is modified, preparation is convenient and non-immunogenicity. Therefore, aptamers presents wide application prospect in basic research, clinical diagnosis, drug development etc. Utilize these aptamers that the target molecule of the cell surface that it combines is characterized and detected, contribute to finding new biomarker. Aptamer is widely used in identifying various cancer target molecules, it has been found that new biomarker.
Owing to having the similarity of certain protein expression between all kinds of cancers, therefore, we use to a library, and this library is the library utilizing binding ability that another one cancer cell system is screened by aptamer triage techniques (CELL-SELEX) the strongest. We utilize this library and substantial amounts of cancer cell tying to close, it is intended to searching out can the cancer cell system of good combination with this library. Through substantial amounts of cell line selection, finally found that Human Bladder Transitional Cell Carcinoma cell and this library binding ability are very good, specificity is also very strong simultaneously. After we are analyzed by the high-flux sequence result in this library of analysis and are verified afterwards, finally pick out this sequence of D7. D7 shows the high-affinity with Human Bladder Transitional Cell Carcinoma cell and specificity, is especially suitable for and carries out Human Bladder Transitional Cell Carcinoma cell characterization and detection, and the searching of surface cancer target molecules from now on.
Summary of the invention
It is an object of the invention to provide the application process of a kind of high degree of specificity, stability, the aptamers that can be used for Human Bladder Transitional Cell Carcinoma cell detection and preparation detectable thereof.
A kind of aptamer detecting Human Bladder Transitional Cell Carcinoma cell, sequence is as follows:
5��-ACGCTCGGATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCACGTCCATGAG-3����
The aptamer of described detection Human Bladder Transitional Cell Carcinoma cell, it is also possible to be undertaken modifying and transforming by aptamer when the conserved nucleotide sequence D7 keeping underscore part is constant, specifically include any one in following three kinds:
A) the conserved nucleotide sequence D7 of aptamer underscore part is constant, and the nucleotide at constant sequence two ends is deleted;
B) the conserved nucleotide sequence D7 of aptamer underscore part is constant, and the base of constant sequence two terminal nucleotide carries out artificial bases's replacement;
C) aptamer connects upper fluorescent material, radioactive substance, therapeutic substance, biotin or enzyme labelling.
The application process of the aptamer of described detection Human Bladder Transitional Cell Carcinoma cell, is used for preparing the preparation of detection Human Bladder Transitional Cell Carcinoma cell by described aptamer.
Compared with prior art, it is an advantage of the current invention that: the present invention has the affinity higher than protein antibodies and specificity by screening the aptamer obtained; Non-immunogenicity; Can synthesizing by iii vitro chemical, molecular weight is little, it is possible to different parts is modified and replaces, and sequence is stable, it is easy to preserve; It is easy to the advantages such as labelling. Adopt the aptamer of the present invention when carrying out Human Bladder Transitional Cell Carcinoma cell detection, operate more simple, rapid, and the synthesis cost of aptamer of the present invention relatively antibody preparation cost is low, and the cycle is short, favorable reproducibility.
Accompanying drawing explanation
Fig. 1 be used primarily for screening the library of various cell line and Human Bladder Transitional Cell Carcinoma cell (T24) and normal human bladder transitional cell (SV-HUC-1) in conjunction with situation;
Fig. 2 is by analyzing after high-flux sequence result, pick out several representative sequences and T24 in conjunction with situation;
Fig. 3 be the D7 that picks out in the middle of library with Human Bladder Transitional Cell Carcinoma cell (T24) and normal human bladder transitional cell (SV-HUC-1) in conjunction with situation;
Fig. 4 Human Bladder Transitional Cell Carcinoma cell after processing through E.C. 3.4.21.64 and pancreatin, D7 and Human Bladder Transitional Cell Carcinoma cell in conjunction with situation. (a) T24 through E.C. 3.4.21.64 process after with D7 in conjunction with situation; (b) T24 through pancreatin process after with D7 in conjunction with situation;
The laser co-focusing figure of Fig. 5 D7 and Human Bladder Transitional Cell Carcinoma Cell binding;
Fig. 6 D7 plus after the primer sequence of two ends after a series of deleting with Human Bladder Transitional Cell Carcinoma cell in conjunction with situation;
The D7 of Fig. 7 (a) variable concentrations gradient and Human Bladder Transitional Cell Carcinoma cell in conjunction with situation; (b) affinity constant according to figure (a) computed D7 and T24 out;
Detailed description of the invention
Below example is easy to be better understood from the present invention, but is not limited to the present invention. Experimental technique in following example if no special instructions, is conventional method. Experiment material used in subordinate's embodiment if no special instructions, is from the purchase of routine biochemistry reagent shop obtained.
Cell derived:
Cell line Human Bladder Transitional Cell Carcinoma cell (T24) and normal human bladder transitional cell (SV-HUC-1) that this experiment is used derive from Chinese Academy of Sciences's Shanghai cell bank.
Embodiment 1: high throughput testing and data analysis
Determine that library that the binding ability that another one cancer cell system is screened is the strongest and T24 cell line have through checking repeatedly very strong specific binding, raw work order-checking portion is delivered in this library by us, utilize Illumina company Miseq or Hiseq2000 platform to check order, create the initial data more than 150,000.. We are by picking out front 100 sequences that occurrence number is maximum to the analysis of initial data and in conjunction with each sequence occurrence number, and these 100 sequences are carried out homology alignment incorporate sequence close for homology into family into. Finally, in the middle of every family, select representative sequence and pick out 10 sequences (see table 1) of next step checking in conjunction with putting in order of occurrence number.
Table 1
Embodiment 2: determine the sequence the strongest with T24 cell line specific binding capacity
First, being digested from culture dish by the T24 cell of adhered state with 0.2%EDTA and 2%EDTA, respectively by cell harvesting to centrifuge tube, and centrifuge washing is several times with lavation buffer solution (PBS, containing the glucose of 0.45%, 5mM magnesium chloride); Secondly, the 10 of final concentration of 250nM sequences and random library are added separately in the T24 cell that binding buffer liquid (D-PBS, containing the glucose of 0.45%, 5mM magnesium chloride, 100mg/LtRNA, 1g/LBSA) soaks; It is then placed into 4 DEG C of shaking tables and hatches 40min; After having hatched and with lavation buffer solution (PBS, containing the glucose of 0.45%, 5mM magnesium chloride) centrifuge washing twice, and carry out fluoroscopic examination (result see illustrate only several representative sequences in Fig. 2, figure) by flow cytometer. Testing result display D7 and T24 Cell binding ability is the strongest.
Embodiment 3:D7 specific recognition Human Bladder Transitional Cell Carcinoma cell
This experiment and some in cell-based screening technology (CELL-SELEX) process step similarity. First, respectively T24 and the SV-HUC-1 of adhered state is digested from culture dish with 0.2%EDTA and 2%EDTA, respectively by cell harvesting to centrifuge tube, and with lavation buffer solution (PBS, containing the glucose of 0.45%, 5mM magnesium chloride) centrifuge washing is several times; In T24 and SV-HUC-1, add the binding buffer liquid (D-PBS, containing the glucose of 0.45%, 5mM magnesium chloride, 100mg/LtRNA, 1g/LBSA) of equivalent respectively, and put into D7 and the random library of final concentration of 250nM respectively; It is then placed into 4 DEG C of shaking tables and hatches 40min; After having hatched and with lavation buffer solution (PBS, containing the glucose of 0.45%, 5mM magnesium chloride) centrifuge washing twice, and carry out fluoroscopic examination (result is shown in Fig. 3) by flow cytometer. Result display D7 has high-affinity and special with T24 Cell binding, and not with normal SV-HUC-1 Cell binding.
Embodiment 4:D7 sequence plus both sides primer complete sequence delete method
It is which section sequence is combined by force with T24 on earth owing to we do not know in the middle of complete sequence, so we carry out the optimization of sequence by following method of deleting:
(underscore part is the conserved nucleotide sequence of D7)
D7 sequence is classified as plus the primer total order on both sides:
ACGCTCGGATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCACGTCCATGAG
8 bases are deleted in guiding region, the D7a:(left side, and 15 bases are deleted in guiding region, the right)
ATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCAC
18 bases are deleted in guiding region, the D7b:(left side, and 18 bases are deleted in guiding region, the right)
AGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGT
8 bases are deleted in guiding region, the D7c:(left side, and 10 bases are deleted in guiding region, the right)
ATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCA
5 bases are deleted in guiding region, the D7d:(left side, and 15 bases are deleted in guiding region, the right)
CGGATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCAC
5 bases are deleted in guiding region, the D7e:(left side, and 10 bases are deleted in guiding region, the right)
CGGATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCA
We by above-mentioned a series of delete after sequence and carry out flow cytomery (result is shown in Fig. 6) after hatching plus primer complete sequence and the T24 on both sides, find that the binding ability of D7e is the strongest, but do not add that the primer complete sequence binding ability on both sides is good.
Embodiment 5: probe into whether D7 is combined on the memebrane protein of T24 cell surface
First, the T24 cell 0.2%EDTA of adhered state is digested from Tissue Culture Dish, collect with six centrifuge tubes. Wherein adding E.C. 3.4.21.64 in two solencytes, add pancreatin in two solencytes, all cells is positioned in the middle of 37 DEG C of cell culture incubators all simultaneously. Set two and process time respectively 5min and 20min, it is disposed afterwards with lavation buffer solution (PBS, containing the glucose of 0.45%, 5mM magnesium chloride) centrifuge washing, then add 250nMD7 to five solencytes, the cell that a pipe additionally did not process adds the random library of 250nM, is placed in 4 DEG C of shaking tables and hatches 40min, use lavation buffer solution centrifuge washing twice after hatching, finally carry out fluorescence signal detection (result is Fig. 4 such as) with flow cytometer. The result of flow cytometer shows, after E.C. 3.4.21.64 and pancreatin process, the binding capacity of D7 and T24 can decline to some extent, and D7 is described, and some is incorporated on the albumen of T24 surface of cell membrane. And it also is able to be clearly visible that the surface that D7 major part is incorporated in T24 cell by the result (Fig. 5) of laser confocal microscope.
Claims (4)
1. detecting an aptamer for Human Bladder Transitional Cell Carcinoma cell, sequence is as follows:
5��-ACGCTCGGATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCACGTCCATGAG-3����
2. the aptamer of detection Human Bladder Transitional Cell Carcinoma cell according to claim 1, it is characterised in that undertaken modifying and transforming by aptamer when the conserved nucleotide sequence D7 keeping underscore part is constant.
3. the aptamer of detection Human Bladder Transitional Cell Carcinoma cell according to claim 2, it is characterised in that aptamer includes any one in following three kinds:
A) the conserved nucleotide sequence D7 of aptamer underscore part is constant, and the nucleotide at constant sequence two ends is deleted;
B) the conserved nucleotide sequence D7 of aptamer underscore part is constant, and the base of constant sequence two terminal nucleotide carries out artificial bases's replacement;
C) aptamer connects upper fluorescent material, radioactive substance, therapeutic substance, biotin or enzyme labelling.
4. the application process of the aptamer of the detection Human Bladder Transitional Cell Carcinoma cell described in any one of claim 1-3, it is characterised in that described aptamer is used for preparing the preparation of detection Human Bladder Transitional Cell Carcinoma cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610069906.8A CN105624166B (en) | 2016-01-31 | 2016-01-31 | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610069906.8A CN105624166B (en) | 2016-01-31 | 2016-01-31 | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105624166A true CN105624166A (en) | 2016-06-01 |
| CN105624166B CN105624166B (en) | 2018-05-04 |
Family
ID=56039511
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610069906.8A Active CN105624166B (en) | 2016-01-31 | 2016-01-31 | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105624166B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108034658A (en) * | 2017-11-08 | 2018-05-15 | 湖南大学 | A kind of aptamer for detecting people's uveal melanoma cells |
| CN109266654A (en) * | 2018-11-30 | 2019-01-25 | 湖南大学 | Detect aptamer and its application of bladder cancer |
| WO2019149115A1 (en) * | 2018-02-02 | 2019-08-08 | 中国科学院化学研究所 | Use of nucleic acid aptamer in alkaline phosphatase heterodimer recognition and binding or in tumor detection |
| CN114317545A (en) * | 2022-01-19 | 2022-04-12 | 南京大学 | Aptamer and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104988154A (en) * | 2015-06-24 | 2015-10-21 | 中国科学院化学研究所 | Application of nucleic acid aptamers in identifying and being bound with integrin alpha4 |
| CN105044322A (en) * | 2015-06-24 | 2015-11-11 | 中国科学院化学研究所 | Application of aptamer in recognition of L selectin and combination with L selectin |
| CN105087594A (en) * | 2014-05-16 | 2015-11-25 | 深圳市第二人民医院 | Aptamer of human beta-catenin and application of aptamer |
| CN105087595A (en) * | 2014-05-16 | 2015-11-25 | 深圳市第二人民医院 | Aptamer of human NF-kB and application of aptamer |
| CN105263958A (en) * | 2013-03-13 | 2016-01-20 | 比奥阿赛斯技术有限公司 | Fragments of p97 and uses thereof |
-
2016
- 2016-01-31 CN CN201610069906.8A patent/CN105624166B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105263958A (en) * | 2013-03-13 | 2016-01-20 | 比奥阿赛斯技术有限公司 | Fragments of p97 and uses thereof |
| CN105087594A (en) * | 2014-05-16 | 2015-11-25 | 深圳市第二人民医院 | Aptamer of human beta-catenin and application of aptamer |
| CN105087595A (en) * | 2014-05-16 | 2015-11-25 | 深圳市第二人民医院 | Aptamer of human NF-kB and application of aptamer |
| CN104988154A (en) * | 2015-06-24 | 2015-10-21 | 中国科学院化学研究所 | Application of nucleic acid aptamers in identifying and being bound with integrin alpha4 |
| CN105044322A (en) * | 2015-06-24 | 2015-11-11 | 中国科学院化学研究所 | Application of aptamer in recognition of L selectin and combination with L selectin |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108034658A (en) * | 2017-11-08 | 2018-05-15 | 湖南大学 | A kind of aptamer for detecting people's uveal melanoma cells |
| CN108034658B (en) * | 2017-11-08 | 2023-09-05 | 湖南大学 | Nucleic acid aptamer for detecting human uveal melanoma cells |
| WO2019149115A1 (en) * | 2018-02-02 | 2019-08-08 | 中国科学院化学研究所 | Use of nucleic acid aptamer in alkaline phosphatase heterodimer recognition and binding or in tumor detection |
| CN109266654A (en) * | 2018-11-30 | 2019-01-25 | 湖南大学 | Detect aptamer and its application of bladder cancer |
| CN114317545A (en) * | 2022-01-19 | 2022-04-12 | 南京大学 | Aptamer and application thereof |
| CN114317545B (en) * | 2022-01-19 | 2023-12-15 | 南京大学 | Aptamer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105624166B (en) | 2018-05-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103146688A (en) | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis | |
| CN104471402A (en) | Biomarkers for triple negative breast cancer | |
| CN107447033A (en) | A kind of diagnosis of colorectal carcinoma biomarker and its application | |
| CN107177683B (en) | Bladder cancer screening and detecting kit | |
| CN105624166A (en) | Nucleic acid aptamer for detecting human bladder transitional cell carcinoma cells and application of nucleic acid aptamer to preparation of detection preparations | |
| CN110283914A (en) | A kind of novel gene diagnostic kit of bladder cancer and its application | |
| CN110541030B (en) | Bladder cancer detection kit and application thereof | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN109161593A (en) | The application of circular rna and microRNA in colorectal cancer sieving and diagnosis | |
| CN110229899B (en) | Plasma marker combinations for early diagnosis or prognosis prediction of colorectal cancer | |
| CN112501294B (en) | Colorectal cancer biomarker and application thereof | |
| CN114150063A (en) | Urine miRNA marker for bladder cancer diagnosis, diagnostic reagent and kit | |
| CN111944820B (en) | Rapid screening of tissue samples of bladder cancer aptamer and application of rapid screening in detection preparation | |
| CN106754938B (en) | A kind of aptamer detecting people's clear cell carcinoma of kidney cell and its application in preparation detection preparation | |
| CN109628455B (en) | Aptamer for detecting human colon cancer and application of aptamer in preparation of detection preparation | |
| KR102211972B1 (en) | Method for early diagnosis of breast cancer and monitoring after treatment using liquid biopsy multi-cancer gene biomarkers | |
| CN116189904A (en) | Gene methylation diagnosis model of differentiated thyroid cancer and construction method thereof | |
| CN103529005B (en) | High-efficiency capillary electrophoresis-laser induced fluorescence detection equipment and application of diagnostic kit in early diagnosis of breast cancer | |
| CN108103178A (en) | The high-throughput detection kit and detection method of neoplastic hematologic disorder fusion | |
| CN107326092A (en) | Applications and colorectal cancer detection kit of the related miRNA of colorectal cancer as biomarker | |
| CN113637753A (en) | Bladder cancer marker lncRNA TERC based on urine exosome and application thereof | |
| CN103083686B (en) | Application of DKK4 gene and coding protein thereof in preparation of medicament | |
| CN101671728B (en) | Method for detecting expression quantity of carcinoembryonic antigen mRNA and special kit thereof | |
| CN101519686B (en) | Molecular detecting method used for detecting stomach cancer and transfer of stomach cancer tissues and kit | |
| CN108929909A (en) | Screening kit for metastatic screening of thyroid papillary carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |