CN108866061A - A kind of aptamer identifying liver cancer cells and its screening technique and purposes - Google Patents
A kind of aptamer identifying liver cancer cells and its screening technique and purposes Download PDFInfo
- Publication number
- CN108866061A CN108866061A CN201810640736.3A CN201810640736A CN108866061A CN 108866061 A CN108866061 A CN 108866061A CN 201810640736 A CN201810640736 A CN 201810640736A CN 108866061 A CN108866061 A CN 108866061A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- library
- liver cancer
- aptamers
- sieve
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Abstract
The invention discloses a kind of aptamer for identifying liver cancer cells and its screening technique and purposes, the nucleotide sequence of the aptamer includes the characteristic sequence part as shown in Seq ID No.1.The purposes includes the purposes by above-mentioned aptamer in design, the drug of preparation anti-liver cancer and anti-or detection reagent.The detection reagent includes enzyme linked immunoassay, radiommunoassay or fluorescent method detection reagent.The invention also includes a kind of targeting preparation and a kind of pharmaceutical composition, the targeting preparation includes above-mentioned aptamer and acceptable carrier or excipient in the pharmacy.Described pharmaceutical composition includes above-mentioned aptamer, acceptable carrier at least one anti-tumor drug and pharmacy.Compared with prior art, aptamers of the invention can specific recognition liver cancer cells, have a good application prospect.
Description
Technical field
The present invention relates to fields of biomedicine, and in particular to it is a kind of identify liver cancer cells aptamer and its screening
Method and purposes.
Background technique
Primary carcinoma of liver is one of most common highest tumour of grade malignancy in worldwide, therefore, for liver cancer
Therapy study is very urgent.In clinical treatment, although operative treatment can eradicate liver cancer, it is only limitted to small part patient, it is right
In most of patients, because lesion is larger or the factors such as postoperative high relapse rate, can not be cured.Therefore, chemotherapy is still mainly to control
Treatment means, but the chemotherapy of liver cancer still lacks effective therapeutic agent at present, to ensure the chemotherapy effect of liver cancer, compels to be essential
New therapeutic agent or method are further developed in conjunction with the study of incident mechanism of liver cancer.
Tumor stem cell hypothesis thinks that there are a kind of tumor stem cells of negligible amounts in tumor tissues, it is considered to be
Tumor proliferation, invasion, transfer and the root of recurrence.Currently, in leukaemia, breast cancer, lung cancer, brain tumor, colorectal cancer, preceding
Tumor stem cell is successfully isolated in the kinds of tumors such as column gland cancer., recurrence refractory with it that there are tumor stem cells in liver cancer
And the features such as drug resistance, is closely related, and these features also show liver cancer and are likely to be also a kind of tumor stem cell disease, it is related
Research shows that the liver-cancer stem cell isolated using cell surface molecule recurrence, in terms of play an important role.
Aptamer be through in-vitro screening technology screening go out energy specific bond metal ion, polypeptide, protein or even
Oligonucleotide (DNA/RNA) segment of entire cell, specificity have strictly combinative ligand as synantibody
Recognition capability and high affinity.However studies have shown that aptamer is compared to the aptamers of the polypeptides such as antibody
For (peptide aptamer), there is apparent advantage, the report that such as prepares that simple and fast, chemical property is stable, so far there are no
Road there are immunogenicity or toxicity, target molecule range is wide, affinity is high, high specificity and be easy to be transformed modification etc..
Therefore, the aptamer for finding out a species specificity for liver cancer is applied to the early detection of liver cancer, molecule
Imaging, the targeting of drug conveying are of great significance.
Summary of the invention
It is an object of the invention to：A kind of core with high degree of specificity and the stable identification liver cancer cells of performance is provided
Sour aptamers and its screening technique and purposes, the aptamers being capable of specific recognition liver cancer PLC8024 cell strain and its derivatives
Object.
A kind of aptamer identifying liver cancer cells, the nucleotide sequence of the aptamer include such as Seq ID
Characteristic sequence part shown in No.1.
The beneficial effects of the present invention are：Aptamers of the invention have high degree of specificity and performance is stablized, the aptamers
It being capable of specific recognition liver cancer PLC8024 cell strain and its derivative.
Further, the nucleotides sequence of the aptamer is classified as：
X-GGGGGATGGAGGGTGGGTCGTATAT-Y, wherein X and Y is each independently at least one in A, T, C, G
At least one in a base or X and Y is not present.
Further, at least one end has modification group in the both ends of the aptamer.
Further, the modification group includes but is not limited to that amino, carboxyl, sulfydryl, fluorescent molecule, biotin, gallbladder are solid
Alcohol or polyethylene group.
Further, there is base modification in the aptamer.
Further, the base modification includes but is not limited to modify through thio, ammonia generation, lock nucleic acid, fluoro or methoxyl group
Afterwards.
The beneficial effects of the present invention are：The base of the aptamer is modified, is made it have compared with without repairing
The more excellent stability of the aptamer of decorations.
The invention also includes the screening techniques of above-mentioned aptamer, include the following steps：It is external using aptamer
Screening technique is positive with PLC8024 liver cancer cells and sieves target, is negative with liver immortalized cells LO2 and is sieved target, is closed from external
At random oligomerization library in filter out aptamer with hepatoma cell strain specific bond.
Further, the screening technique, specifically includes following steps：
S1, synthesis random single chain library and primer：The random single chain library is：
ACCTTGGCTGTCGTGTTGT-25nt-AGGTCAGTGGTCAGAGCGT, the primer include 5' primer：5'-
FAM-ACCTTGGCTGTCGTGTTGT and 3' primer：3'-Biotin- ACGCTCTGACCACTGACCT；
S2, aptamer screening：The random single chain library and liver-cancer stem cell are incubated for, after the completion of incubation, collected
PLC8024 cell strain cell heat denatured separates the aptamers being incorporated on cell strain, as screens resulting aptamer
Level-one library；
S3, positive sieve：The supernatant in the obtained aptamer level-one library the step S2 and positive sieve target are incubated for, washed
The de- high-affinity aptamers group combined in target cell surface, be enriched with after amplification in conjunction with target cell specificity just
Sieve aptamers group library；
S4, negative sieve：The positive sieve aptamers group library and negative sieve target are incubated for, collect cell incubation after the completion of being incubated for
Supernatant afterwards, the negative sieve aptamers group library in conjunction with target cell specificity being enriched with；
S5, selectivity, the affinity for analyzing and identifying the obtained negative sieve each sequence in aptamers group library of the step S4,
Finally obtain aptamer of the band just like characteristic sequence shown in Seq ID No.1.
Further, the screening technique, specifically includes following steps：
S11, synthesis random single chain library and primer：The random single chain library is：
ACCTTGGCTGTCGTGTTGT-25nt-AGGTCAGTGGTCAGAGCGT, the primer include 5' primer：5'-
FAM-ACCTTGGCTGTCGTGTTGT and 3' primer：3'-Biotin- ACGCTCTGACCACTGACCT；
S21, aptamer screening：The random single chain library and liver-cancer stem cell are incubated for, after the completion of incubation, received
Collection PLC8024 cell strain cell heat denatured separates the aptamers being incorporated on cell strain, as screens resulting nucleic acid adaptation
Body level-one library；
S31, PCR amplification library：Aptamer level-one library is subjected to PCR amplification, obtains amplified production；
S41, positive sieve：The supernatant of the obtained amplified production of the step S31 and PLC8024 cell strain are incubated for, elution knot
The high-affinity aptamers group in target cell surface is closed, the positive sieve in conjunction with target cell specificity being enriched with after amplification is suitable
Ligand group library；
S51, negative sieve：The positive sieve aptamers group library that the step S41 is obtained and liver immortalized cells LO2 cell
Strain is incubated for, and collects supernatant, the negative sieve aptamers group library in conjunction with target cell specificity being enriched with after the completion of being incubated for；
S61, aptamer Cycle Screening：It repeats step S11~S51 at least once, random text is replaced with amplified production
Library, until the affinity in obtained aptamers group library selectively no longer rises；
S71, sequencing identification：The aptamers group library that step S61 described in cloning and sequencing is obtained, identifies each sequence respectively
Selectivity and affinity, finally obtain aptamer of the band just like characteristic sequence shown in Seq ID No.1.
The beneficial effects of the present invention are：The present invention program is referred to as the ligand of index concentration using in-vitro screening technology
Phyletic evolution (Systematic evolution of ligand by exponential enrichment, SELEX) skill
Art, the aptamer screened have affinity more higher than protein antibodies and specific non-immunogenicity, can be external
Chemical synthesis, molecular weight is small, different parts can be modified and be replaced, and sequence stablize, be easy to save convenient for label and
Secondary antibody does not need to mark.
The invention also includes purposes of the above-mentioned aptamer in design, the drug of preparation anti-liver cancer and anti-or detection reagent.
Further, the detection reagent includes but is not limited to enzyme linked immunoassay, radiommunoassay and fluorescent method
Detection reagent.
The invention also includes a kind of targeting preparations, including above-mentioned aptamer.
Further, the targeting preparation further includes selected from acceptable carrier or excipient in pharmacy.
Further, any one of the carrier in nano-medicament carrier, tumor imaging agent or dye molecule.
The invention also includes a kind of pharmaceutical composition, described pharmaceutical composition includes above-mentioned aptamer, at least one
Acceptable carrier on anti-tumor drug and pharmacy.
The beneficial effects of the present invention are：When carrying out the detection of liver cancer cells using aptamer of the invention, operation
More simple, rapidly, and the synthesis cost of aptamer of the present invention is at low cost compared with Antibody preparation, and the period is short and reproducibility
It is good；The characteristic sequence of aptamer of the invention can be used as the molecular probe or drug target of anti-liver cancer and anti-, by dividing for liver cancer
Son diagnosis and targeted therapy provide strong support, and have important clinical value.
Detailed description of the invention
Fig. 1 is aptamers of the embodiment of the present invention (left figure) and compares aptamers (right figure) and PLC8024 hepatoma cell strain
Specific binding figure；
Fig. 2 is that aptamers of the embodiment of the present invention and the paraffin mass (right figure) of tumor tissues (left figure) and cancer beside organism are special
Property combine figure.
Specific embodiment
In order to describe the technical content, the structural feature, the achieved object and the effect of this invention in detail, below in conjunction with embodiment party
Formula simultaneously cooperates attached drawing to be explained in detail.
The embodiment of the present invention is：A kind of aptamer and its screening technique identifying liver cancer cells, the nucleic acid adaptation
The nucleotide sequence of body includes AGGAGGTTAGGGGTGGGTGGGTGGT, and screening technique includes the following steps：
1. initial DNA library (i.e. level-one library) prepares：
Design synthesis both ends contain 19 nucleotide (primer), and centre includes the nucleic acid sequence of 25 nucleotide random sequences
Random nucleic acid library and amplimer, it is specific as follows：
ACC TTG GCT GTC GTG TTG T (as shown in Seq ID No.2) -25nt-A GGT CAG TGG TCA
GAG CGT (as shown in Seq ID No.3)
5' primer：ACC TTG GCT GTC GTG TTG T (as shown in Seq ID No.4)
3' primer：ACG CTC TGA CCA CTG ACC T'(is as shown in Seq ID No.5)
2. target cell prepares
2.1 test the vigor for determining liver cancer cells with Trypan Blue, while determining the cell number of incubation.
2.2 libraries and liver cancer cells are incubated for, and screen candidate aptamers.Above-mentioned random nucleic acid is dissolved using combination buffer
Library, in conjunction with buffer solution with DPBS buffer, magnesium chloride containing 5mM, 4.5g/L glucose, 0.1mg/mL yeast tRNA
With 1mg/mL bovine serum albumin(BSA) (bovine serum albumin, BSA).95 DEG C constant temperature oscillation 5 minutes, be put into ice rapidly
In then be incubated on ice with the PLC8024 cell strain cultivated and pre-processed 1 hour.
The sequence of 2.3 dissociation and elution of bound, pours out the liquid being incubated in culture bottle, uses washing buffer after the completion of being incubated for
Liquid (washing buffer with DPBS buffer, magnesium chloride containing 5mM and 4.5g/L glucose) washing is incubated in culture bottle
Cell.It is precipitated with no DNase water scraping cells, 95 DEG C of heating cells and DNA mixture 10min, heat denatured separation combines
In the aptamers of cell surface, 13000rpm is centrifuged 5min, and collecting supernatant is the special core for screening gained and being directed to liver cancer cells
Sour aptamers library.
3. amplified library：PCR amplification is carried out to library, takes 100 μ L aforesaid operations to screen resulting PLC8024 cell special
The DNA aptamers of different combination need a cell-specific aptamer library of full income expanding 16 in advance after first round screening
Circulation, then the amplification of this step is carried out, obtain amplified production.
4. digesting the double-stranded DNA obtained through PCR amplification at single-stranded DNA banks.
5. obtaining candidate aptamers through the positive sieve of excessive wheel and negative sieved journey, wherein the operating procedure for being just sieved through journey
It is as follows：The supernatant of the step amplified production and PLC8024 cell strain are incubated for, height parent of the elution of bound in target cell surface
With power aptamers group, the positive sieve aptamers group library in conjunction with target cell specificity being enriched with after amplification；
The operating procedure of the negative sieved journey is as follows：By above-mentioned positive sieve aptamers group library and liver immortalized cells LO2
Cell strain is incubated for, and the supernatant after cell incubation is collected after the completion of being incubated for, and what is be enriched with is suitable in conjunction with target cell specificity
Ligand group library.
6. after completing screening process, being sequenced after carrying out TOPO-TA amplification to final product, analyzing sequencing result, obtain
The aptamers highly enriched to one：
5’-GGGGGATGGAGGGTGGGTCGTATAT-3’
7. the specificity of aptamers and the identification of clinical meaning
7.1 do negative sequence control, the aptamers and control of 5 ' FAM fluorescent molecule of anamorphic zone with original DNA libraries sequence
Aptamers.
7.2 with fluorescence aptamers and compare library and 3 × 10 with 250nM in 200 μ L combination buffers5It is a
4 DEG C of PLC8024 cell incubation, 1h.
It is washed 3 times, each 5min after the completion of 7.3 incubations with 500 μ L elution buffers, finally with 500 μ L elution buffer weights
Outstanding cell precipitation, stream measuring cell fluorescence intensity.
7.4 fluorescence microscope aptamers binding specificities, 1.5 × 105A cell kind is in 35mm culture dish, growth
24 hours, after eluting residual media with elution buffer, in the 1mL combination buffer dissolution aptamers of fluorescent marker and right
So that its ultimate density is reached 250nM according to library, 4 DEG C, after being incubated for 1h, observation result as shown in Figure 1, from figure 1 it appears that
The aptamer of sequence of the present invention and PLC8024 cell have extremely strong binding force, and compare the binding forces of aptamers then compared with
It is weak.
7.5 immunohistochemistry
The tumour of hepatocarcinoma patient and the paraffin mass of cancer beside organism are taken, is sliced after dimethylbenzene dewaxes, uses graded ethanol
(100%, 95%, 90%, 80% and 70%) hydration-treated, each concentration handle 5min, then wash 5min with DPBS solution
Afterwards, with 95 DEG C of 0.01mol/L, the citrate solution processing sample 20min of pH6.0 to repair antigen, be placed at room temperature for until
Natural cooling.Confining liquid with combination buffer prepare (addition 20% fetal calf serum (fetal bovine serum, FBS),
The silicon milt DNA of 0.1mg/mL) room temperature closing 1h, the adaptation then marked in 200 μ L combination buffers with the FAM of 250nM
Body or control library are protected from light and are incubated for 30min on ice, fluorescence microscope fluorescence radiation situation, the result observed such as Fig. 2 institute
Show, the aptamers for the sequence of the present invention that makes discovery from observation have good recognition detection ability to liver cancer tissue.
Experimental method is conventional method unless otherwise specified in the present invention, and material used in experiment is such as without special
Illustrate, then buys gained for routine biochemistry reagent shop；Institute used in PLC8024 liver cancer cells this experiment of source used in the present invention
There is cell to be all from south China oncology National Key Laboratory, other cell origins are in American Tissue Culture
Collection。
The above description is only an embodiment of the present invention, is not intended to limit the scope of the invention, all to utilize this hair
Equivalent structure or equivalent flow shift made by bright specification and accompanying drawing content, it is relevant to be applied directly or indirectly in other
Technical field is included within the scope of the present invention.
Sequence table
<110>Attached 5th hospital of Zhongshan University
<120>A kind of aptamer identifying liver cancer cells and its screening technique and purposes
<160> 5
<170> SIPO SequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gggggatgga gggtgggtcg tatat 25
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
accttggctg tcgtgttgt 19
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
aggtcagtgg tcagagcgt 19
<210> 4
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
accttggctg tcgtgttgt 19
<210> 5
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
acgctctgac cactgacct 19
Claims (9)
1. a kind of aptamer for identifying liver cancer cells, it is characterised in that：The nucleotide sequence of the aptamer includes
The characteristic sequence part as shown in Seq ID No.1.
2. the aptamer of identification liver cancer cells according to claim 1, it is characterised in that：The aptamer
At least one end has modification group in both ends.
3. the aptamer of identification liver cancer cells according to claim 1, it is characterised in that：In the aptamer
With base modification.
4. a kind of screening technique of aptamer as described in any one of claims 1-3, it is characterised in that：Including following step
Suddenly：It using aptamer in-vitro screening technology, is positive with PLC8024 liver cancer cells and sieves target, with liver immortalized cells LO2
It is negative and sieves target, the aptamer with hepatoma cell strain specific bond is filtered out from the random oligomerization library synthesized in vitro.
5. screening technique according to claim 4, it is characterised in that：Specifically include following steps：
S1, synthesis random single chain library and primer：The random single chain library is：
ACCTTGGCTGTCGTGTTGT-25nt-AGGTCAGTGGTCAGAGCGT, the primer include 5' primer：5'-FAM-
ACCTTGGCTGTCGTGTTGT and 3' primer：3'-Biotin-ACGCTCTGACCACTGACCT；
S2, aptamer screening：The random single chain library and positive sieve target are incubated for, after the completion of incubation, collect PLC8024
Cell strain cell heat denatured separates the aptamers being incorporated on cell strain, as screens resulting aptamer level-one text
Library；
S3, positive sieve：The supernatant in the obtained aptamer level-one library the step S2 and positive sieve target are incubated for, elution of bound
In the high-affinity adaptation group of target cell surface, the positive sieve aptamers group in conjunction with target cell specificity that is enriched with after amplification
Library；
S4, negative sieve：The positive sieve aptamers group library and negative sieve target are incubated for, it is upper after cell incubation is collected after the completion of being incubated for
Clear liquid, the negative sieve aptamers group library in conjunction with target cell specificity being enriched with；
S5, selectivity, the affinity for analyzing and identifying the obtained negative sieve each sequence in aptamers group library of the step S4, final
Aptamer to band just like characteristic sequence shown in Seq ID No.1.
6. aptamer as described in any one of claims 1-3 is in design, the drug of preparation anti-liver cancer and anti-or detection reagent
Purposes.
7. purposes according to claim 6, it is characterised in that：The detection reagent includes enzyme linked immunoassay, radiates and exempt from
Epidemic disease measurement or fluorescent method detection reagent.
8. a kind of targeting preparation, it is characterised in that：Including aptamer as described in any one of claims 1-3.
9. a kind of pharmaceutical composition, it is characterised in that：Described pharmaceutical composition includes core as described in any one of claims 1-3
Sour aptamers, acceptable carrier at least one anti-tumor drug and pharmacy.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810640736.3A CN108866061A (en) | 2018-06-21 | 2018-06-21 | A kind of aptamer identifying liver cancer cells and its screening technique and purposes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810640736.3A CN108866061A (en) | 2018-06-21 | 2018-06-21 | A kind of aptamer identifying liver cancer cells and its screening technique and purposes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108866061A true CN108866061A (en) | 2018-11-23 |
Family
ID=64340235
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810640736.3A Pending CN108866061A (en) | 2018-06-21 | 2018-06-21 | A kind of aptamer identifying liver cancer cells and its screening technique and purposes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108866061A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536504A (en) * | 2018-12-06 | 2019-03-29 | 湖南大学 | A kind of aptamer and its application, kit with ischemic tissue of brain specific bond |
| CN110184273A (en) * | 2019-06-17 | 2019-08-30 | 长春理工大学 | The aptamer of selectively targeted breast cancer cell line mcf-7 screens and its application |
| CN110257382A (en) * | 2019-06-20 | 2019-09-20 | 燕山大学 | The aptamer and its screening technique and purposes of identification intestinal cancer serum markers |
| CN114480403A (en) * | 2022-01-24 | 2022-05-13 | 郑州大学 | Polyoma-bound nucleic acid aptamer and application thereof in tumor detection |
| CN114470239A (en) * | 2022-04-01 | 2022-05-13 | 浙江省肿瘤医院 | Polydopamine-coated slow-release MnO2Nano microsphere drug-loading system |
| CN114703194A (en) * | 2022-05-24 | 2022-07-05 | 中山大学附属第五医院 | Fluorine-18 labeled CD63 targeting compound and preparation method and application thereof |
| CN116426532A (en) * | 2023-06-08 | 2023-07-14 | 时夕(广州)生物科技有限公司 | Targeting aptamer and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104781417A (en) * | 2012-08-02 | 2015-07-15 | 迪肯大学 | CD133 aptamers for detection of cancer stem cells |
| CN104862317A (en) * | 2015-05-18 | 2015-08-26 | 江汉大学 | Hepatoma cell-specific aptamer and preparation method thereof |
| CN106164293A (en) * | 2014-02-05 | 2016-11-23 | 迪肯大学 | Aptamer constructs |
| CN107137377A (en) * | 2017-03-29 | 2017-09-08 | 浙江大学 | A kind of tumor stem cell targeting lipids nanoparticle and preparation method and application |
-
2018
- 2018-06-21 CN CN201810640736.3A patent/CN108866061A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104781417A (en) * | 2012-08-02 | 2015-07-15 | 迪肯大学 | CD133 aptamers for detection of cancer stem cells |
| CN106164293A (en) * | 2014-02-05 | 2016-11-23 | 迪肯大学 | Aptamer constructs |
| CN104862317A (en) * | 2015-05-18 | 2015-08-26 | 江汉大学 | Hepatoma cell-specific aptamer and preparation method thereof |
| CN107137377A (en) * | 2017-03-29 | 2017-09-08 | 浙江大学 | A kind of tumor stem cell targeting lipids nanoparticle and preparation method and application |
Non-Patent Citations (1)
| Title |
|---|
| WANG YIN: "Novel strategies to overcome drug resistance in liver cancer", 《DRO》 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536504A (en) * | 2018-12-06 | 2019-03-29 | 湖南大学 | A kind of aptamer and its application, kit with ischemic tissue of brain specific bond |
| CN109536504B (en) * | 2018-12-06 | 2020-01-14 | 湖南大学 | Aptamer specifically combined with ischemic brain tissue, application thereof and kit |
| CN110184273A (en) * | 2019-06-17 | 2019-08-30 | 长春理工大学 | The aptamer of selectively targeted breast cancer cell line mcf-7 screens and its application |
| CN110257382A (en) * | 2019-06-20 | 2019-09-20 | 燕山大学 | The aptamer and its screening technique and purposes of identification intestinal cancer serum markers |
| CN114480403A (en) * | 2022-01-24 | 2022-05-13 | 郑州大学 | Polyoma-bound nucleic acid aptamer and application thereof in tumor detection |
| CN114480403B (en) * | 2022-01-24 | 2023-04-14 | 郑州大学 | Multi-tumor-bound nucleic acid aptamer and application thereof in tumor detection |
| CN114470239A (en) * | 2022-04-01 | 2022-05-13 | 浙江省肿瘤医院 | Polydopamine-coated slow-release MnO2Nano microsphere drug-loading system |
| CN114470239B (en) * | 2022-04-01 | 2022-07-26 | 浙江省肿瘤医院 | Polydopamine-coated slow-release MnO 2 Nano microsphere drug-loading system |
| CN114703194A (en) * | 2022-05-24 | 2022-07-05 | 中山大学附属第五医院 | Fluorine-18 labeled CD63 targeting compound and preparation method and application thereof |
| CN116426532A (en) * | 2023-06-08 | 2023-07-14 | 时夕(广州)生物科技有限公司 | Targeting aptamer and application thereof |
| CN116426532B (en) * | 2023-06-08 | 2023-09-12 | 时夕(广州)生物科技有限公司 | Targeting aptamer and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108866061A (en) | A kind of aptamer identifying liver cancer cells and its screening technique and purposes | |
| CN103642810B (en) | Application in a kind of aptamer and screening method, the before detection strain of row adenocarcinoma cell | |
| CN105039333B (en) | Hepatoma-targeting peptide and its application | |
| CN106191069B (en) | A kind of aptamer sequence and its application identified and combine human TfR | |
| CN108034658B (en) | Nucleic acid aptamer for detecting human uveal melanoma cells | |
| CN108866062A (en) | The DNA aptamers and its screening technique of a kind of specific recognition liver-cancer stem cell and application | |
| CN104593372B (en) | A kind of aptamer, kit and method for detecting Pancreatic neoplasms | |
| CN104894243B (en) | Nucleic acid aptamer probe, device and its application for tumour cell detection | |
| CN104711263B (en) | A kind of nucleic acid aptamer sequence and application for being used to target KB cell | |
| CN109913462B (en) | Application research of aptamer recognition and combination with CD171 and related functions thereof | |
| CN105779618A (en) | Novel target gene for diagnosing and treating tongue squamous carcinoma and application thereof | |
| WO2019149115A1 (en) | Use of nucleic acid aptamer in alkaline phosphatase heterodimer recognition and binding or in tumor detection | |
| Wang et al. | Development of aptamer-based molecular tools for rapid intraoperative diagnosis and in vivo imaging of serous ovarian cancer | |
| CN110295172B (en) | Application of rapidly-screened renal cancer aptamer and preparation thereof in preparation and detection | |
| Lu et al. | Evaluation of a new magnetic bead as an integrated platform for systematic CTC recognition, capture and clinical analysis | |
| CN105624166B (en) | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared | |
| WO2020176534A1 (en) | Multiplexed signal amplification methods using enzymatic based chemical deposition | |
| JP2021099248A (en) | Non-alcoholic steatohepatitis marker and use thereof | |
| CN103463619B (en) | BMP 4 is in the application suppressing in cancer | |
| CN106754938B (en) | A kind of aptamer detecting people's clear cell carcinoma of kidney cell and its application in preparation detection preparation | |
| CN111944821B (en) | Tissue sample rapid screening of colon cancer aptamer and application of tissue sample rapid screening in detection preparation | |
| CN105925719A (en) | Gene related to liver cancer differentiation and application of gene | |
| CN109709328A (en) | A kind of diagnosis marker of oophoroma and its application | |
| CN116376917A (en) | Application of aptamer SWL-3G, SWL-3bG in preparation of medicines for treating bladder cancer | |
| CN109628455A (en) | A kind of aptamer detecting human colon carcinoma and its application in preparation detection preparation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181123 |
|
| RJ01 | Rejection of invention patent application after publication |