CN110408620B - Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof - Google Patents
Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof Download PDFInfo
- Publication number
- CN110408620B CN110408620B CN201910759904.5A CN201910759904A CN110408620B CN 110408620 B CN110408620 B CN 110408620B CN 201910759904 A CN201910759904 A CN 201910759904A CN 110408620 B CN110408620 B CN 110408620B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- acid aptamer
- aptamer
- sequence
- random sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Urology & Nephrology (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a nucleic acid aptamer, an obtaining method thereof, a derivative thereof and application thereof, wherein the sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACACGTG-3'; n is a random sequence; the method for obtaining the nucleic acid aptamer comprises the following steps: a truncation step: truncating nucleotides of an aptamer JHIT targeting a human hepatoma cell HepG2 from the 5 'end and the 3' end; the sequence of the aptamer JHIT is 5 '-AGAGACCTGACTNACCGGTGGCTTCTT-3'; n is a random sequence; a prediction step: predicting the truncated aptamer JHIT as containing a secondary structure, and selecting the shortest sequence to obtain a nucleic acid aptamer; the application of the nucleic acid aptamer is that the nucleic acid aptamer is used for identifying liver cancer cells HepG2; the nucleic acid aptamer is easy to carry out structure-activity relation research, and can be used as a targeting probe for replacing a specific antibody to carry out subsequent diagnosis and treatment of hepatocellular carcinoma.
Description
Technical Field
The invention relates to a nucleic acid aptamer, an obtaining method thereof, a derivative thereof and application thereof, belonging to the technical field of molecular biology.
Background
Oligonucleotide aptamers (aptamers) are also called aptamers, aptamers or aptamers, and are single-stranded DNA/RN A oligonucleotides which are obtained by in vitro screening, amplification and enrichment and can be combined with target substances such as small molecular substances, polypeptides, proteins, organelles, nucleic acids, cells and tissues with high affinity and high specificity by using a systematic evolution of ligands by exponential enrichment (SELE X) technology, and the structural basis of the combination of the oligonucleotides and the target spots is that the oligonucleotides and the target spots can be folded into unique secondary or tertiary structures so as to have very high affinity and specificity to the target. Aptamers behave like antibodies and almost exclusively oligonucleotides can be used instead in all fields of application involving antibodies. Due to the specific binding property of the aptamer, the aptamer can be used for screening and identifying target substances and has wide application in the fields of drug screening, analysis and detection and the like.
For liver cancer, because symptoms of patients show later, most liver cancer patients are diagnosed in the later stage, even if early detection is carried out, the postoperative recurrence rate is very high, and the health of people in China is seriously threatened, the liver cancer targeting agent has important significance for specific diagnosis and treatment of late stage liver cancer and postoperative tumor recurrence, the aptamer can be used for determining a liver cancer target, and the specificity and affinity of the aptamer are further improved, so that the diagnosis speed is accelerated, and the accuracy is improved.
Disclosure of Invention
In order to overcome the disadvantages of the prior art, a first object of the present invention is to provide a nucleic acid aptamer, the structure of which is optimized, and the affinity and specificity of which are greatly improved.
The second object of the present invention is to provide a method for obtaining the above-mentioned nucleic acid aptamer.
The third object of the present invention is to provide a derivative of the above-mentioned nucleic acid aptamer, which has the same or similar function as the nucleic acid aptamer.
The fourth object of the present invention is to provide the use of the above-mentioned nucleic acid aptamer.
The first purpose of the invention can be achieved by adopting the following technical scheme:
a nucleic acid aptamer, wherein the sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACACGTG-3'; n is a random sequence; shown as SEQ ID NO. 1.
Further, the random sequence N is GCGAACCCAATCAATCATCAACATGTG, which is shown in SEQ ID NO. 2.
Further, the Kd value of the nucleic acid aptamer was 12.18. + -. 4.93nM.
Further, the nucleic acid aptamer comprises a secondary structure.
Further, the secondary structure is a stem-loop structure.
Further, random sequences are included in the stem-loop structure.
The second purpose of the invention can be achieved by adopting the following technical scheme: a method for obtaining a nucleic acid aptamer, comprising:
a truncation step: truncating nucleotides of an aptamer JHIT targeting a human hepatoma cell HepG2 from the 5 'end and the 3' end; the sequence of the aptamer JHIT is 5 '-AGAGAGACCTGACTNACACGGGTGGCT TCTT-3'; n is a random sequence shown as SEQ ID NO. 3;
a prediction step: predicting the truncated aptamer JHIT as containing a secondary structure, and selecting the shortest sequence to obtain the nucleic acid aptamer.
Further, in the truncation step, the aptamer JHIT is obtained by screening through a Cell-SELEX technology.
Further, in the predicting step, the prediction is performed by at least one of an RNAstructure-6.1 and an mfold prediction program.
Further, in the predicting step, the secondary structure is a stem-loop structure.
The third purpose of the invention can be achieved by adopting the following technical scheme:
a derivative of a nucleic acid aptamer, which is obtained by performing nucleotide substitution or modification on the nucleic acid aptamer; the sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACCGGTG-3'; and N is a random sequence.
Further, the modification is at least one of phosphorylation, methylation, amination, sulfhydrylation, and isotopic modification, but is not limited to the above-listed modification modes; the modifying group is at least one of biotin group, radioactive substance, therapeutic substance, digoxin, fluorescent group, nano luminescent material and enzyme label, but not limited to the above-listed modifying groups.
The fourth purpose of the invention can be achieved by adopting the following technical scheme:
an application of a nucleic acid aptamer, wherein the nucleic acid aptamer is used for identifying liver cancer cells HepG2; the sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACCGGTG-3'; and N is a random sequence.
The formulation design principle of the invention is as follows: the research proves that the aptamer is screened by the conventional method, the full-length aptamer generated in the screening process comprises fixed primer sequences used for PCR amplification at two ends of the nucleotide, but not all the nucleotides of the aptamer are necessary structures for forming targeting, however, if the nucleotide chain of the aptamer is shorter, higher affinity and specificity can be embodied, and good synthetic benefit is achieved; based on the above, the invention firstly carries out truncation optimization on the full-length aptamer, but retains similar secondary structure, thereby obtaining a brand-new nucleic acid aptamer.
Compared with the prior art, the invention has the beneficial effects that:
1. the nucleic acid aptamer has small relative molecular mass, 1 order of magnitude lower than that of a monoclonal antibody, strong tissue penetrating capability and quick clearance from blood, can obtain a high signal-to-noise ratio at an early time point after entering a tissue, and is more than 200 times higher than that of an antibody;
2. the nucleic acid aptamer has strong affinity and specificity to a target molecule or a target protein, and the dissociation constant is generally nmol/L-pmol/L;
3. the nucleic acid aptamer has good stability, and can be stored or transported for a long time at pH4.0-9.0 and at the temperature of less than 35 ℃;
4. the nucleic acid aptamer can be synthesized in full length, the method is simple, the repeatability is good, and the difference among batches is very small;
5. the nucleic acid aptamer is easy to carry out structure-activity relation research, site specific modification or coupling of single complexing molecules, photoactivation probes, radionuclides, toxins and pharmacokinetic modification; can be used as a targeting probe for replacing a specific antibody to carry out subsequent diagnosis and treatment of hepatocellular carcinoma, is equivalent to finding an anti-human hepatoma cell antibody, and can be used for detection of hepatoma and a targeting treatment carrier;
6. the target molecules of the nucleic acid aptamer are wider, even comprise cells, and can be screened under the condition of living cells without knowing the target in advance; therefore, the nucleic acid aptamer has an antibody-like effect and can overcome the defects of antibodies, and the research result is easy to popularize in clinic.
Drawings
FIG. 1 is a graphical representation of the RNAstructure-6.1 and mfold prediction programs of example 1;
FIG. 2 is a comparison of the binding of cells in example 2;
FIG. 3 is a comparison of the binding of cells in example 2;
FIG. 4 is a graph of fluorescence intensity versus aptamer concentration for example 3;
FIG. 5 is a fluorescent representation of specific binding capacity of example 4.
Detailed Description
The invention is further described with reference to the following drawings and detailed description:
a nucleic acid aptamer, wherein the sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACACGTG-3'; n is GCGAACCCAATCAATGTGG; 1.18 ± 4.93nM of the nucleic acid aptamer; the nucleic acid aptamer comprises a stem-loop structure, and the random sequence N is contained in the stem-loop structure.
The nucleic acid aptamer is obtained by the following method:
a truncation step: screening by using a Cell-SELEX technology to obtain an aptamer JHIT targeting a human hepatoma Cell HepG2, and truncating nucleotides from the 5 'end and the 3' end of the aptamer JHIT; the sequence of the aptamer JHIT is 5 '-AGAGAGACCTGACTNACACGGGTGGCTTCTT-3'; n is a random sequence;
a prediction step: the truncated aptamer J HIT is predicted to contain a stem-loop structure by an RNAscope-6.1 and mfold prediction program, and the shortest sequence is selected to obtain the nucleic acid aptamer.
The JHIT2 secondary structure is predicted by using two nucleic acid secondary structure prediction programs of RNAstructure-6.1 and mfold, based on a secondary structure formed by an intermediate random sequence, nucleotides are respectively truncated from the 5 'end and the 3' end, then two kinds of software are used for predicting the corresponding secondary structure, and a sequence which is shortest and can keep the main secondary structure is determined after comparison. According to the results of two nucleic acid secondary structure prediction programs, the intermediate random sequence in the JHIT2 sequence forms a main secondary stem-loop structure, which means that the stem-loop structure is particularly important for targeting binding, and a small difference can cause large changes in specificity and affinity. Based on the structure, a certain amount of nucleotides are truncated and optimized from the 5 'end and the 3' end respectively, and the results of two secondary structure prediction programs are combined to obtain the nucleic acid aptamer after truncation and optimization, so that the secondary structure of the nucleic acid aptamer can be kept unchanged finally, and the secondary structure of the nucleic acid aptamer is truncated continuously, so that the secondary structure of the nucleic acid aptamer is obviously changed. Therefore, we determined the sequence that is the shortest and that retains its primary secondary structure.
The relative molecular mass of the aptamer is about 15000, which is 1 order of magnitude lower than that of the monoclonal antibody (about 150000), and therefore has a strong ability to penetrate tissue and is rapidly cleared from blood.
The derivative of the nucleic acid aptamer can achieve the function of identifying liver cancer cell Hep G2 which is the same as or similar to the nucleic acid aptamer; the derivative is obtained by carrying out nucleotide substitution or modification on the nucleic acid aptamer; the modification is at least one of phosphorylation, methylation, amination, sulfhydrylation and isotopic alteration, but is not limited to the modifications listed above; the modifying group is at least one of biotin group, radioactive substance, therapeutic substance, digoxin, fluorescent group, nano luminescent material and enzyme label, but not limited to the above-listed modifying groups.
The application of the nucleic acid aptamer and the derivative thereof is to use the nucleic acid aptamer or the derivative thereof for recognizing liver cancer cells HepG2.
Example 1:
obtaining a nucleic acid aptamer by:
a truncation step: screening by a Cell-SELEX technology to obtain an aptamer JHIT of a targeted human hepatoma Cell HepG2, and truncating nucleotides from the 5 'end and the 3' end of the aptamer JHIT; the sequence of the aptamer JHIT is 5; as shown in SEQ ID NO. 4;
a prediction step: predicting the truncated aptamer J HIT to contain a stem-loop structure by an RNAstructure-6.1 and an mfold prediction program, as shown in FIG. 1, wherein in FIG. 1, a first row is a prediction diagram of mfold, a second row is a prediction diagram of RNAstructure-6.1, and the first to eight rows from left to right sequentially select the shortest sequence for the secondary structure of the aptamer when the aptamer is truncated to 61, 5, 54, 53, 52, 51, 50, 49 nucleotides, so as to obtain a nucleic acid aptamer JHIT2e sequence of 5 'GACCCTTGACTGCGAACCCAATCGCACCATCACTCAGACAGGACGGTG 3'; as shown in SEQ ID NO. 5; .
Example 2:
analyzing the targeting of the truncated and optimized aptamer JHIT2e to the liver cancer cells through flow cytometry:
properly digesting HepG2 cells and L02 cells by using enzyme-free cell digestive juice to ensure that the cells just depart from a culture bottle, centrifuging and discarding the culture medium, and counting the cells by 2.5 multiplied by 10 5 Washing twice with 500. Mu.L washing buffer, adding binding buffer 2 00. Mu.L containing FAM-JHIT2e with concentration of 200nM into a group of HepG2 cells and L02 cells, adding binding buffer 200. Mu.L containing FAM-JHIT with concentration of 200nM into a group of HepG2 cells and L02 cells, and incubating for 30 minutes at 4 ℃. Unbound aptamers were then discarded by washing twice and finally resuspended with 300. Mu.L of PBS. The fluorescence intensity was measured by counting 10,000 cells with a flow cytometer. The results are shown in fig. 2, which is a blank control, a diagram of the combination condition of the JHIT and HepG2 cells and a diagram of the combination condition of the JHIT2e and HepG2 cells in sequence from left to right, wherein the JHIT2e of the nucleic acid aptamer has an affinity in a daminomol range similar to that of the JHIT, and the combination degree of the JHIT2e of the nucleic acid aptamer and HepG2 cells is good; as shown in fig. 3, the left-to-right graph shows the binding of the blank control, JHIT2e and L02 cells; JHIT2e has no obvious combination with normal liver cell L02.
Example 3:
analyzing the change of the binding affinity of the truncated optimized nucleic acid aptamer JHIT2e and HepG2 cells by a flow cytometry:
using enzyme-free cell digestive juice to moderately digest HepG2 cells, enabling the HepG cells to just separate from a culture bottle, centrifuging and discarding the culture medium, and counting the cells by 2.5 multiplied by 10 5 In each case, 7 samples were prepared, and 200. Mu.L of binding buffer containing FAM-JHIT2e at a concentration of 0, 2, 5, 10, 20, 50, 100nM was added to each sample and incubated at 4 ℃ for 30 minutes. Washing twice with washing buffer to discard unbound aptamers, finally adding 300 μ L of PBS for resuspension, and counting 10,000 cells by using a flow cytometer to determine fluorescence intensity; fitting the relation between the average fluorescence intensity and the aptamer concentration by using a saturation equation, as shown in FIG. 4; the nucleic acid aptamer JHIT2e has similar affinity in the danner range as JHIT, and has a slight increase, with a Kd value of 12.18 + -4.93 nM.
Example 4:
specific binding capacity of JHIT2 and truncated and optimized aptamer JHIT2e to HepG2 cells is visually observed through a confocal experiment:
HepG2 cells, L02 cells, and PC3 cells at 1X 10 5 The culture medium is paved on a 20mm confocal dish for culturing for 24h, after the culture medium is discarded, the washing buffer is used for washing twice, 500 mu L of binding buffer containing FAM-JHI T2e with the concentration of 200nM is respectively added, and the incubation is carried out for 30min at 4 ℃; washing twice with washing buffer to discard the uncombined aptamer, then adding 200 mu L of 4wt% paraformaldehyde for fixation for 10min, and washing twice with washing buffer; then, 200. Mu.L of DAPI was added to stain the nuclei for 5-10min, washed 2 times with PBS, quenched by adding 400. Mu.L of an anti-quencher, and then observed with a confocal microscope. As shown in FIG. 5, FAM-JHIT2e showed significant fluorescence after incubation with HepG2 cells (FAM column), while FAM-JHIT2e showed no significant fluorescence after incubation with L02 and PC 3.
Various other changes and modifications to the above-described embodiments and concepts will become apparent to those skilled in the art from the above description, and all such changes and modifications are intended to be included within the scope of the present invention as defined in the appended claims.
Sequence listing
<110> secondary third Hospital of Zhongshan university
<120> nucleic acid aptamer, method for obtaining same, derivative thereof and application thereof
<130> 2019
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (11)..(11)
<223> n = random sequence
<400> 1
gaccctgact nacacggtg 19
<210> 2
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gcgaacccaa tcgcaccaca tctcaacatg tgg 33
<210> 3
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (14)..(14)
<223> n = random sequence
<400> 3
agagaccctg actnacacgg tggcttctt 29
<210> 4
<211> 61
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agagaccctg actgcgaacc caatcgcacc acatctcaac atgtggacac ggtggcttct 60
<210> 5
<211> 51
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gaccctgact gcgaacccaa tcgcaccaca tctcaacatg tggacacggt g 51
Claims (8)
1. A nucleic acid aptamer, wherein the sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACACGTG-3'; the N is a random sequence; the random sequence N is GCGAACCCAATCACAACATGTGG.
2. The nucleic acid aptamer according to claim 1, wherein the nucleic acid aptamer comprises a secondary structure.
3. The nucleic acid aptamer according to claim 2, wherein the secondary structure is a stem-loop structure.
4. The nucleic acid aptamer according to claim 3, wherein the random sequence is contained in a stem-loop structure.
5. A method for obtaining a nucleic acid aptamer, comprising:
a truncation step: truncating nucleotides of an aptamer JHIT targeting a human hepatoma cell HepG2 from the 5 'end and the 3' end; the sequence of the aptamer JHIT is 5 '-AGAGAGACCTGACTNACACGGGTGGCTTCTT-3'; the N is a random sequence; the random sequence N is GCGAACCCAATCACAACATGTGG;
a prediction step: predicting that the truncated aptamer JHIT contains a secondary structure to obtain a truncated nucleic acid aptamer JHIT2e, wherein the sequence of the nucleic acid aptamer JHIT2e is 5 '-GACCCTGACTNACACGTG-3'; n is GCGAACCCAATCAATGTGG.
6. The method for obtaining a nucleic acid aptamer according to claim 5, wherein in the predicting step, the prediction is performed by at least one of RNAstructure-6.1 and mfold prediction programs.
7. A derivative of a nucleic acid aptamer, wherein the derivative is obtained by modifying a nucleic acid aptamer; the sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACCGGTG-3'; the N is a random sequence; the random sequence N is GCGAACCCAATCACAACATGTGG; the modification is at least one of phosphorylation, methylation, amination, sulfhydrylation, and isotopic amination; the modifying group is at least one of biotin group, radioactive substance, digoxin and fluorescent group.
8. The application of the nucleic acid aptamer is characterized in that the nucleic acid aptamer is applied to the preparation of a kit for identifying liver cancer cells HepG2; the sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACCGGTG-3'; the N is a random sequence; the random sequence N is GCGAACCCAATCACAACATGTGG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910759904.5A CN110408620B (en) | 2019-08-16 | 2019-08-16 | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910759904.5A CN110408620B (en) | 2019-08-16 | 2019-08-16 | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110408620A CN110408620A (en) | 2019-11-05 |
| CN110408620B true CN110408620B (en) | 2023-03-21 |
Family
ID=68367557
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910759904.5A Active CN110408620B (en) | 2019-08-16 | 2019-08-16 | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110408620B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115927343B (en) * | 2021-12-24 | 2024-03-12 | 三峡大学 | Aptamer Aptamer-Wu of targeted activated hepatic stellate cells and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011160738A (en) * | 2010-02-10 | 2011-08-25 | Kanazawa Univ | DNA APTAMER HAVING SPECIFIC BONDABILITY TO HUMAN HEPATOCELLULAR LIVER CARCINOMA CELL LINE HepG2 |
| CN102226185A (en) * | 2011-05-09 | 2011-10-26 | 华中科技大学同济医学院附属同济医院 | RNA aptamer of targeting hepatocyte and nucleotide sequence thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010140834A2 (en) * | 2009-06-01 | 2010-12-09 | 성균관대학교산학협력단 | Nucleic acid aptamer specifically binding to pancreatic cancer cells or tissues and use thereof |
| CN103374573B (en) * | 2012-04-28 | 2016-01-06 | 复旦大学附属华山医院 | Liver cancer cell nucleic acid aptamer sequence and uses thereof |
| CN105385691B (en) * | 2015-12-28 | 2019-02-19 | 湖南大学 | For detecting the aptamer and detection kit of people's height transfer colon cancer cell line LoVo |
| CN108239646B (en) * | 2018-01-26 | 2020-06-12 | 青岛大学 | Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer |
| CN109337909B (en) * | 2018-11-12 | 2020-10-13 | 湖南大学 | Aptamer for detecting liver cancer drug-resistant cell strain and application thereof |
-
2019
- 2019-08-16 CN CN201910759904.5A patent/CN110408620B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011160738A (en) * | 2010-02-10 | 2011-08-25 | Kanazawa Univ | DNA APTAMER HAVING SPECIFIC BONDABILITY TO HUMAN HEPATOCELLULAR LIVER CARCINOMA CELL LINE HepG2 |
| CN102226185A (en) * | 2011-05-09 | 2011-10-26 | 华中科技大学同济医学院附属同济医院 | RNA aptamer of targeting hepatocyte and nucleotide sequence thereof |
Non-Patent Citations (1)
| Title |
|---|
| 刘品多 等.全细胞的核酸适配体筛选的研究进展.2016,(第4期),第382-388页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110408620A (en) | 2019-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230039899A1 (en) | In situ rna analysis using probe pair ligation | |
| CN108034658B (en) | Nucleic acid aptamer for detecting human uveal melanoma cells | |
| CN105385691B (en) | For detecting the aptamer and detection kit of people's height transfer colon cancer cell line LoVo | |
| CN109913462B (en) | Application research of aptamer recognition and combination with CD171 and related functions thereof | |
| US20240002917A1 (en) | Method of detection of a target nucleic acid sequence | |
| EP4060047A1 (en) | Method for detecting or quantifying oligonucleotide | |
| WO2019149115A1 (en) | Use of nucleic acid aptamer in alkaline phosphatase heterodimer recognition and binding or in tumor detection | |
| CN114127293B (en) | Method for screening PD-L1 DNA nucleic acid aptamer in vitro and application of method in cancer diagnosis | |
| KR20140114714A (en) | Method for Dectecting of Target Molecules Using PNA Aptamers | |
| CN111304208A (en) | Aptamer specifically binding to P-glycoprotein, preparation method and application thereof | |
| CN108430336A (en) | Circulating cells, the internal collection of protein and nucleic acid and Local Quantitative and signature analysis | |
| Li et al. | PD-L1 aptamer isolation via Modular-SELEX and its applications in cancer cell detection and tumor tissue section imaging | |
| CN110408620B (en) | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof | |
| CN112501257B (en) | Visualization sensor based on nucleic acid self-assembly enzyme-catalysis-free circRNA living cell imaging | |
| Dun-Ming et al. | Application of aptamers in food safety | |
| Fareh et al. | Single-molecule pull-down for investigating protein–nucleic acid interactions | |
| CN112877333A (en) | Aptamer for specifically recognizing integrin beta 3 subunit protein and application thereof | |
| CN106011142B (en) | A kind of sequence and application of the oligonucleotides aglucon P7-26 of specific recognition PSA albumen | |
| George et al. | Optimized proximity ligation assay (PLA) for detection of RNA-protein complex interactions in cell lines | |
| CN111662909B (en) | Cardiac troponin I specific nucleic acid aptamer and application thereof | |
| JP2021193934A (en) | Improved in situ hybridization reaction using short-chain hairpin DNA | |
| CN110564731B (en) | Aptamer and detection kit for detecting human drug-resistant hepatoma cell strain HepG2/ADM | |
| CN114107307B (en) | Method for screening PD-L1 DNA nucleic acid aptamer in vitro and application thereof | |
| CN114317546B (en) | Aptamer for detecting EVD68 virus, kit and application | |
| CN114381460B (en) | Aptamer for detecting mumps virus, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |