CN110408620A - A kind of nucleic acid aptamer, its preparation method, its derivative and its application - Google Patents
A kind of nucleic acid aptamer, its preparation method, its derivative and its application Download PDFInfo
- Publication number
- CN110408620A CN110408620A CN201910759904.5A CN201910759904A CN110408620A CN 110408620 A CN110408620 A CN 110408620A CN 201910759904 A CN201910759904 A CN 201910759904A CN 110408620 A CN110408620 A CN 110408620A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- acid aptamer
- aptamer
- sequence
- jhit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Urology & Nephrology (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of nucleic acid aptamer, its preparation method, its derivative and its application, the sequence of nucleic acid aptamer is 5 '-GACCCTGACTNACACGGTG-3 '；N is random sequence；The preparation method of nucleic acid aptamer: it truncates step: the aptamer JHIT for targeting human liver cancer cell HepG2 is carried out to the truncation of nucleotide from 5 ' ends and 3 ' ends；The sequence of aptamer JHIT is 5 '-AGAGACCCTGACTNACACGGTGGCTTCTT-3 '；N is random sequence；Prediction steps: prediction is to contain secondary structure through truncated aptamer JHIT, selects most short sequence, obtains nucleic acid aptamer；The application of nucleic acid aptamer is by nucleic acid aptamer hepatocellular carcinoma H22 for identification；Nucleic acid aptamer easily carries out structure -- and activity relationship research can be used as the Clinics and Practices that subsequent hepatocellular carcinoma is carried out instead of the targeted probes of specific antibody.
Description
Technical field
The present invention relates to a kind of nucleic acid aptamer, its preparation method, its derivative and its applications, belong to molecular biotechnology
Field.
Background technique
Oligonucleotide aptamer (aptamer) be also aptamer, aptamers or aptamer, is with index concentration aglucon
Phyletic evolution (systematic evolution of ligands by exponential enrichment, SELE X) skill
Art, obtained by in-vitro screening, amplification and enrichment, energy and small-molecule substance, polypeptide, protein, organelle, nucleic acid and cell
Single stranded DNA/RN A the oligonucleotides combined with target substances high-affinity, high specifics such as tissues, the structure with targeted integration
Basis is to can be folded into unique second level or tertiary structure because of it to have very high affinity and specificity to target.Adaptation
The effect of son is similar to antibody, all to be related to the application field of antibody, can nearly all be replaced with oligonucleotide aptamer.Due to
Aptamer it is specific-binding, therefore can be used for screening and identifying target substance, have in fields such as drug screening, analysis detections
It is widely applied.
For liver cancer, since showing for patient symptom is later, most liver cancer patients have been advanced stage when diagnosing, even if early stage is sent out
Existing, Postoperative recurrent rate is also very high, seriously threatens the health of our people, and hepatoma-targeting agent is multiple for advanced liver cancer, postoperative tumour
The specific diagnosis of hair, treatment all have significance, and aptamer can be used for the determination of liver cancer target, and it is special to further increase it
Property and affinity be then conducive to accelerate diagnosis speed, improve accuracy.
Summary of the invention
For overcome the deficiencies in the prior art, the first purpose of this invention is to provide a kind of nucleic acid aptamer, the core
The structure of sour aptamer is optimized, and affinity and specificity greatly improve.
Second object of the present invention is to provide the preparation method of above-mentioned nucleic acid aptamer.
Third object of the present invention provides the derivative of above-mentioned nucleic acid aptamer, which has and nucleic acid aptamer
Same or similar function.
Fourth object of the present invention is to provide the application of above-mentioned nucleic acid aptamer.
Realize that the first purpose of this invention can reach by adopting the following technical scheme that:
A kind of nucleic acid aptamer, the sequence of nucleic acid aptamer are 5 '-GACCCTGACTNACACGGTG- 3 '；N is stochastic ordering
Column；As shown in SEQ ID NO.1.
Further, random sequence N is GCGAACCCAATCGCACCACATCTCAACATGT GG, such as SEQ ID NO.2
It is shown.
Further, the Kd value of nucleic acid aptamer is 12.18 ± 4.93nM.
Further, nucleic acid aptamer includes secondary structure.
Further, secondary structure is loop-stem structure.
Further, random sequence is contained in loop-stem structure.
Realize that second object of the present invention can reach by adopting the following technical scheme that: a kind of nucleic acid aptamer obtains
The method of obtaining, comprising:
It truncates step: the aptamer JHIT for targeting human liver cancer cell HepG2 is subjected to cutting for nucleotide from 5 ' ends and 3 ' ends
It is short；The sequence of aptamer JHIT is 5 '-AGAGACCCTGACTNACACGGTGGCT TCTT-3 '；N is random sequence, such as SEQ
Shown in ID NO.3；
Prediction steps: prediction is to contain secondary structure through truncated aptamer JHIT, selects most short sequence, and it is suitable to obtain nucleic acid
Gamete.
Further, it truncates in step, aptamer JHIT is obtained by Cell-SELEX technology screening.
Further, in prediction steps, by least one of RNAstructure-6.1 and mfold Prediction program into
Row prediction.
Further, in prediction steps, secondary structure is stem-loop structure.
Realize that third object of the present invention can reach by adopting the following technical scheme that:
A kind of derivative of nucleic acid aptamer, derivative is by carrying out nucleotide substitution to nucleic acid aptamer or modifying
It arrives；The sequence of nucleic acid aptamer is 5 '-GACCCTGACTNACACGGTG-3 '；N is random sequence.
Further, it is modified at least one of phosphorylation, methylation, amination, sulfhydrylation and isotopologue, but not
It is limited to modification mode listed above；Modification group is biotin group, radioactive substance, therapeutic substance, digoxin, fluorescence
At least one of group, nano luminescent material and enzyme label, but it is not limited to modification group listed above.
Realize that fourth object of the present invention can reach by adopting the following technical scheme that:
A kind of application of nucleic acid aptamer, by nucleic acid aptamer hepatocellular carcinoma H22 for identification；The sequence of nucleic acid aptamer
It is classified as 5 '-GACCCTGACTNACACGGTG-3 '；N is random sequence.
Formulation Design Principle of the invention is as follows: thinking through research, conventional method screens aptamer, what screening process generated
Overall length aptamer includes being used for the immobilized primer sequence of PCR amplification, but the not institute of aptamer in two ends of nucleotide
It is all the required structure for forming targeting by nucleotide, however, can be embodied higher if the nucleotide chain of aptamer is shorter
Affinity and specificity, good synthesis benefit；Based on the above, overall length aptamer is carried out truncation optimization first by the present invention, but
Retain similar secondary structure, to obtain completely new nucleic acid aptamer.
Compared with prior art, the beneficial effects of the present invention are:
1, the relative molecular mass of nucleic acid aptamer of the present invention is smaller, can 1 order of magnitude lower than monoclonal antibody, penetrate
Organizational capacity is strong, removed from blood it is fast, into tissue after can be obtained on earlier time point compared with high s/n ratio, it is higher than antibody
More than 200 times；
2, nucleic acid aptamer of the present invention has very strong affinity and specificity, dissociation constant one to target molecule or target protein
As be nmol/L-pmol/L；
3, nucleic acid aptamer stability of the present invention is good, can long-term preservation or transport at pH4.0-9.0 and < 35 DEG C；
4, nucleic acid aptamer of the present invention can overall length synthesis, method is simple, reproducible, and between-lot difference is minimum；
5, nucleic acid aptamer of the present invention easily carries out structure -- and single complexing is modified or are coupled to activity relationship research, site-specific
Molecule, photoactivation probe, radionuclide, toxin and pharmacokinetics modification；It can be used as and visited instead of the targeting of specific antibody
Needle carries out the Clinics and Practices of subsequent hepatocellular carcinoma, is equivalent to " antibody " for finding an anti-human liver cancer cell, in the future can be with
Detection, targeted therapeutic carrier for liver cancer；
6, the target molecule of nucleic acid aptamer of the present invention is more extensive, or even including cell, and can not need to know in advance
Road target is screened in living cells；Therefore nucleic acid aptamer has the shortcomings that the effect of class antibody and can overcome antibody, studies
As a result it is easy to clinical expansion.
Detailed description of the invention
Fig. 1 is embodiment 1RNAstructure-6.1 and mfold Prediction program prediction diagram；
Fig. 2 is the comparison of 2 cell combination situation of embodiment；
Fig. 3 is the comparison of 2 cell combination situation of embodiment；
Fig. 4 is the graph of relation of embodiment 3 fluorescence intensity and aptamer concentration；
Fig. 5 is 4 specific binding capacity fluorescence of embodiment diagram.
Specific embodiment
In the following, being described further in conjunction with attached drawing and specific embodiment to the present invention:
A kind of nucleic acid aptamer, the sequence of nucleic acid aptamer are 5 '-GACCCTGACTNACACGGTG- 3 '；N is GCGAA
CCCAATCGCACCACATCTCAACATGTGG；1 2.18 ± 4.93nM of nucleic acid aptamer；Nucleic acid aptamer includes stem ring knot
Structure, random sequence N are contained in loop-stem structure.
Above-mentioned nucleic acid aptamer is prepared by the following:
It truncates step: the aptamer JHIT of targeting human liver cancer cell HepG2 is obtained by Cell-SELEX technology screening, it will
Aptamer JHIT carries out the truncation of nucleotide from 5 ' ends and 3 ' ends；The sequence of aptamer JHIT is 5 '-
AGAGACCCTGACTNACACGGTGGCTTCTT-3'；N is random sequence；
Prediction steps: it is through truncated aptamer J HIT by the prediction of RNAstructure-6.1 and mfold Prediction program
Containing stem-loop structure, most short sequence is selected, nucleic acid aptamer is obtained.
We carry out JHIT2 second level using two kinds of nucleic acid secondary structure prediction programs of RNAstructure-6.1, mfold
The prediction of structure based on being formed by secondary structure by intermediate random sequence, carries out nucleotide from 5 ' ends and 3 ' ends respectively
It truncates, then carries out the prediction of corresponding secondary structure with two kinds of softwares, determine most short after comparison and be able to maintain its predominant secondary knot
The sequence of structure.Show that the intermediate random sequence in JHIT2 sequence forms master according to two kinds of nucleic acid secondary structure prediction procedure results
The second level stem-loop structure wanted, it means that this stem-loop structure is particularly important to targeting combination, and subtle difference leads to spy
Anisotropic and affinity large change.We carry out certain amount nucleotide from 5 ' ends and 3 ' ends respectively based on this structure
Truncation optimization, the result of comprehensive two kinds of secondary structure prediction programs obtains truncating the nucleic acid aptamer after optimization, can finally protect
It is constant to hold its secondary structure, is further continued for truncating, apparent variation will occur for secondary structure.Therefore, we determined that with most short and
It is able to maintain the sequence of its predominant secondary structure.
The relative molecular mass of nucleic acid aptamer about 15000,1 order of magnitude lower than monoclonal antibody (about 150000), because
It is strong that this penetrates organizational capacity, removes from blood fast.
The derivative of nucleic acid aptamer can achieve to be known with the same or similar progress liver cancer cells Hep G2 of nucleic acid aptamer
Other function；Derivative to nucleic acid aptamer by carrying out nucleotide substitution or modifying to obtain；Be modified to phosphorylation, methylation,
At least one of amination, sulfhydrylation and isotopologue, but it is not limited to modification mode listed above；Modification group is biology
At least one in plain group, radioactive substance, therapeutic substance, digoxin, fluorophor, nano luminescent material and enzyme label
Kind, but it is not limited to modification group listed above.
The application of nucleic acid aptamer and its derivative, for by nucleic acid aptamer or derivatives thereof liver cancer cells for identification
HepG2。
Embodiment 1:
Nucleic acid aptamer is obtained by the following method:
It truncates step: the aptamer JHIT of targeting human liver cancer cell HepG2 is obtained by Cell-SELEX technology screening, it will
Aptamer JHIT carries out the truncation of nucleotide from 5 ' ends and 3 ' ends；The sequence of aptamer JHIT is 5 '-AGAGACCCTGACTGCG
AACCCAATCGCACCACATCTCAACATGTGG ACACGGTGGCTTCTT-3'；As shown in SEQ ID NO.4；
Prediction steps: it is through truncated aptamer J HIT by the prediction of RNAstructure-6.1 and mfold Prediction program
Containing stem-loop structure, as shown in Figure 1, the prediction of the first behavior mfold illustrates, the second behavior RNAstructure- in Fig. 1
6.1 prediction diagram, the column of left-to-right number the first to eight, which are followed successively by, is truncated to 61,55,54,53,52,51,50,49 nucleotide
When the secondary structure of aptamer select most short sequence, obtaining nucleic acid aptamer JHIT2e sequence is 5 '-
GACCCTGACTGCGAACCCAATCGCACCACA TCTCAACATGTGGACACGGTG-3'；As shown in SEQ ID NO.5；.
Embodiment 2:
The aptamer JHIT2e after optimization is truncated to the targeting of liver cancer cells by flow cytometry comparative analysis:
HepG2 cell, L02 cell are moderately digested with no enzyme cell dissociation buffer, is allowed to just off culture bottle, training is abandoned in centrifugation
Support base, cell count 2.5 × 105It is a, it is washed twice with the washing buffer of 500 μ L, one group of HepG2 cell, L02 cell
It is middle that concentration containing FAM-JHIT2e is added for the 2 00 μ L of binding buffer of 200nM, in one group of HepG2 cell, L02 cell
The 200 μ L of bindi ng buffer that concentration containing FAM-JHIT is 200nM is added, is incubated for 30 minutes at 4 DEG C.It uses later
Washing buffer cleaning discards unbonded aptamer twice, and the PBS for being eventually adding 300 μ L is resuspended.Use flow cytometer
Count 10,000 raji cell assay Raji fluorescence intensities.As a result as shown in Fig. 2, left-to-right to be followed successively by blank control, JHIT and HepG2 thin
Born of the same parents combine situation diagram, JHIT2e and HepG2 cell combination situation diagram, and nucleic acid aptamer JHIT2e has similar with JHIT
Up to the affinity of nanomolar range, nucleic acid aptamer JHIT2e and HepG2 cell combination degree is good；As shown in figure 3, the figure of left-to-right
Show and is followed successively by blank control, JHIT2e and L02 cell combination situation；JHIT2e and normal liver cell L02 have no obvious combination.
Embodiment 3:
The affine of the nucleic acid aptamer JHIT2e and HepG2 cell combination after truncating optimization is analyzed by Flow Cytometry
The variation of power:
HepG2 cell is moderately digested with no enzyme cell dissociation buffer, is allowed to just off culture bottle, culture medium is abandoned in centrifugation, carefully
Born of the same parents count 2.5 × 105It is a, 7 samples are set, be separately added into each sample the concentration of 2e containing FAM-JHIT be 0,2,5,10,
20, the 200 μ L of binding buffer of 50,100nM is incubated for 30 minutes at 4 DEG C.Two are cleaned with washing buffer later
Secondary to discard unbonded aptamer, the PBS for being eventually adding 300 μ L is resuspended, with 10,000 raji cell assay Raji of Flow cytometry
Fluorescence intensity；With saturation equation model average fluorescent strength and aptamer concentration relationship, as shown in Figure 4；Nucleic acid aptamer
JHIT2e has the affinity up to nanomolar range similar with JHIT, and has raising slightly, Kd value for 12.18 ±
4.93nM。
Embodiment 4:
JHIT2 is intuitively observed by confocal experiments and truncates the aptamer JHIT2e after optimization to HepG2 cell
Specific binding capacity:
By HepG2 cell, L02 cell, PC3 cell with 1 × 105Density be laid on the copolymerization coke ware of 20mm and cultivate for 24 hours,
After abandoning culture medium, the binding for being separately added into that the concentration of T2e containing FAM-JHI is 200nM twice is cleaned with washing buffer
Buffer 500 μ L, 4 DEG C of incubation 30min；Cleaned with washing buffer and discard unbonded aptamer twice, then plus
Enter the fixed 10min of 4wt% paraformaldehyde of 200 μ L, then is cleaned twice with washing buffer；It is added 200 μ L's later
DAPI cleans nuclear targeting 5-10min, PBS 2 times, and the anti-agent of quenching that 400 μ L are added is prevented being quenched, then burnt micro- with copolymerization
Mirror is observed.As a result as shown in figure 5, showing apparent fluorescence (FAM column) after FAM-JHIT2e and HepG2 cell incubation,
FAM-JHIT2e and L02, PC3 then have no apparent fluorescence after being incubated for.
For those skilled in the art, it can make other each according to the above description of the technical scheme and ideas
Kind is corresponding to be changed and deforms, and all these change and deform the protection model that all should belong to the claims in the present invention
Within enclosing.
Sequence table
<110>The Third Affiliated Hospital of Zhongshan University
<120>a kind of nucleic acid aptamer, its preparation method, its derivative and its application
<130> 2019
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (11)..(11)
<223>n=random sequence
<400> 1
gaccctgact nacacggtg 19
<210> 2
<211> 33
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gcgaacccaa tcgcaccaca tctcaacatg tgg 33
<210> 3
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (14)..(14)
<223>n=random sequence
<400> 3
agagaccctg actnacacgg tggcttctt 29
<210> 4
<211> 61
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
agagaccctg actgcgaacc caatcgcacc acatctcaac atgtggacac ggtggcttct 60
t 61
<210> 5
<211> 51
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gaccctgact gcgaacccaa tcgcaccaca tctcaacatg tggacacggt g 51
Claims (10)
1. a kind of nucleic acid aptamer, which is characterized in that the sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACACGGTG-
3'；The N is random sequence.
2. nucleic acid aptamer as described in claim 1, which is characterized in that the random sequence N is GCGAACCCAATCGCAC
CACATCTCAACATGTGG。
3. nucleic acid aptamer as described in claim 1, which is characterized in that the nucleic acid aptamer includes secondary structure.
4. nucleic acid aptamer as claimed in claim 3, which is characterized in that the secondary structure is loop-stem structure.
5. nucleic acid aptamer as claimed in claim 4, which is characterized in that the random sequence is contained in loop-stem structure.
6. a kind of preparation method of nucleic acid aptamer characterized by comprising
It truncates step: the aptamer JHIT for targeting human liver cancer cell HepG2 is carried out to the truncation of nucleotide from 5 ' ends and 3 ' ends；Institute
The sequence for stating aptamer JHIT is 5 '-AGAGACCCTGACTNACACGGTGGCTTCTT-3 '；The N is random sequence；
Prediction steps: prediction is to contain secondary structure through truncated aptamer JHIT, selects most short sequence, obtains nucleic acid adaptation
Son.
7. the preparation method of nucleic acid aptamer as claimed in claim 6, which is characterized in that in the prediction steps, pass through
At least one of RNAstructure-6.1 and mfold Prediction program is predicted.
8. a kind of derivative of nucleic acid aptamer, which is characterized in that the derivative is by carrying out nucleotide to nucleic acid aptamer
Replace or modification obtains；The sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACACGGTG-3 '；The N is stochastic ordering
Column.
9. the derivative of nucleic acid aptamer as claimed in claim 8, which is characterized in that it is described be modified to phosphorylation, methylation,
At least one of amination, sulfhydrylation and isotopologue；The modification group is biotin group, radioactive substance, treatment
Property substance, digoxin, fluorophor, nano luminescent material and enzyme label at least one of.
10. a kind of application of nucleic acid aptamer, which is characterized in that by nucleic acid aptamer hepatocellular carcinoma H22 for identification；
The sequence of the nucleic acid aptamer is 5 '-GACCCTGACTNACACGGTG-3 '；The N is random sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910759904.5A CN110408620B (en) | 2019-08-16 | 2019-08-16 | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910759904.5A CN110408620B (en) | 2019-08-16 | 2019-08-16 | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110408620A true CN110408620A (en) | 2019-11-05 |
| CN110408620B CN110408620B (en) | 2023-03-21 |
Family
ID=68367557
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910759904.5A Active CN110408620B (en) | 2019-08-16 | 2019-08-16 | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110408620B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115927343A (en) * | 2021-12-24 | 2023-04-07 | 三峡大学 | Aptamer Aptamer-Wu of targeted activated hepatic stellate cell and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011160738A (en) * | 2010-02-10 | 2011-08-25 | Kanazawa Univ | DNA APTAMER HAVING SPECIFIC BONDABILITY TO HUMAN HEPATOCELLULAR LIVER CARCINOMA CELL LINE HepG2 |
| CN102226185A (en) * | 2011-05-09 | 2011-10-26 | 华中科技大学同济医学院附属同济医院 | RNA aptamer targeting liver cells and nucleotide sequence thereof |
| CN102498211A (en) * | 2009-06-01 | 2012-06-13 | 成均馆大学校产学协力团 | Nucleic acid aptamer specifically binding to pancreatic cancer cells or tissues and use thereof |
| CN103374573A (en) * | 2012-04-28 | 2013-10-30 | 复旦大学附属华山医院 | Hepatoma cell aptamer sequence and application thereof |
| CN105385691A (en) * | 2015-12-28 | 2016-03-09 | 湖南大学 | Nucleic acid adapter used for detecting human high-metastasis colon cancer cell strain LoVo and detection kit |
| CN108239646A (en) * | 2018-01-26 | 2018-07-03 | 青岛大学 | Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer |
| CN109337909A (en) * | 2018-11-12 | 2019-02-15 | 湖南大学 | It is a kind of detect liver cancer drug-resistant cell strain aptamer and its application |
-
2019
- 2019-08-16 CN CN201910759904.5A patent/CN110408620B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102498211A (en) * | 2009-06-01 | 2012-06-13 | 成均馆大学校产学协力团 | Nucleic acid aptamer specifically binding to pancreatic cancer cells or tissues and use thereof |
| JP2011160738A (en) * | 2010-02-10 | 2011-08-25 | Kanazawa Univ | DNA APTAMER HAVING SPECIFIC BONDABILITY TO HUMAN HEPATOCELLULAR LIVER CARCINOMA CELL LINE HepG2 |
| CN102226185A (en) * | 2011-05-09 | 2011-10-26 | 华中科技大学同济医学院附属同济医院 | RNA aptamer targeting liver cells and nucleotide sequence thereof |
| CN103374573A (en) * | 2012-04-28 | 2013-10-30 | 复旦大学附属华山医院 | Hepatoma cell aptamer sequence and application thereof |
| CN105385691A (en) * | 2015-12-28 | 2016-03-09 | 湖南大学 | Nucleic acid adapter used for detecting human high-metastasis colon cancer cell strain LoVo and detection kit |
| CN108239646A (en) * | 2018-01-26 | 2018-07-03 | 青岛大学 | Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer |
| CN109337909A (en) * | 2018-11-12 | 2019-02-15 | 湖南大学 | It is a kind of detect liver cancer drug-resistant cell strain aptamer and its application |
Non-Patent Citations (1)
| Title |
|---|
| 刘品多;屈锋;: "全细胞的核酸适配体筛选的研究进展" * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115927343A (en) * | 2021-12-24 | 2023-04-07 | 三峡大学 | Aptamer Aptamer-Wu of targeted activated hepatic stellate cell and application thereof |
| CN115927343B (en) * | 2021-12-24 | 2024-03-12 | 三峡大学 | Aptamer Aptamer-Wu of targeted activated hepatic stellate cells and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110408620B (en) | 2023-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108034658B (en) | Nucleic acid aptamer for detecting human uveal melanoma cells | |
| Liu et al. | An aptamer-based probe for molecular subtyping of breast cancer | |
| CN101812528B (en) | Switch mode aptamer probe and application thereof in tumor living cell and vital detection | |
| CN102498211B (en) | Nucleic acid aptamer specifically binding to pancreatic cancer cells or tissues and use thereof | |
| JP2006501802A (en) | Method for preparing glucose oxidase enzyme having one or more desired properties and glucose oxidase enzyme having desired properties | |
| CN102839181B (en) | Nucleic acid aptamer sequence of gastric cancer cells, and uses thereof | |
| CN103205431B (en) | Nucleic acid aptamer and derivatives thereof, screening method of nucleic acid aptamer, application of nucleic acid aptamer and derivatives in detecting human biliary duct carcinoma cell line | |
| CN105985962B (en) | The aptamer of the selectively targeted inflammatory synovial cell of rheumatoid arthrosis and its application | |
| CN105385691B (en) | For detecting the aptamer and detection kit of people's height transfer colon cancer cell line LoVo | |
| CN105506136B (en) | A method of microRNA is detected based on rolling circle amplification and up-conversion | |
| CN104651501A (en) | Cracking activation type nucleic acid adaptor diagnosis and treatment probe and application thereof | |
| CN102766693B (en) | Nucleic acid aptamer for detecting human hepatoma cell line SMMC-7721 as well as screening method and application thereof | |
| KR20150139582A (en) | Rna microchip detection using nanoparticle-assisted signal amplification | |
| CN108430336A (en) | Circulating cells, the internal collection of protein and nucleic acid and Local Quantitative and signature analysis | |
| CN110408620A (en) | A kind of nucleic acid aptamer, its preparation method, its derivative and its application | |
| CN108531474A (en) | Method for enriching and capturing low-abundance target nucleic acid in feces | |
| CN103374573B (en) | Liver cancer cell nucleic acid aptamer sequence and uses thereof | |
| CN103374572B (en) | A kind of sequence of aptamer of liver cancer cell and application | |
| JPWO2019240073A1 (en) | Quantitative PCR probe | |
| WO2005028647A1 (en) | Nucleic acid probe, nucleic acid chip, method of detecting target nucleic acid, method of screening drug, apparatus for detecting target nucleic acid and gene diagnosis method | |
| CN108239646A (en) | Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer | |
| CA2353920A1 (en) | Test system for detecting different markers, and production and use thereof | |
| CN107858356B (en) | Aptamer for targeting highly metastatic human osteosarcoma cells and application thereof | |
| CN108866066A (en) | A kind of aptamer detecting human fibrosarcoma cell and its application in preparation detection preparation | |
| Lou et al. | Laboratory test for diagnosis of parasitic diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |