CN106011142B - A kind of sequence and application of the oligonucleotides aglucon P7-26 of specific recognition PSA albumen - Google Patents
A kind of sequence and application of the oligonucleotides aglucon P7-26 of specific recognition PSA albumen Download PDFInfo
- Publication number
- CN106011142B CN106011142B CN201510140664.2A CN201510140664A CN106011142B CN 106011142 B CN106011142 B CN 106011142B CN 201510140664 A CN201510140664 A CN 201510140664A CN 106011142 B CN106011142 B CN 106011142B
- Authority
- CN
- China
- Prior art keywords
- sequence
- specific recognition
- psa
- albumen
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses the sequences and application of a kind of oligonucleotides aglucon P7-26 for the specific recognition PSA albumen for belonging to molecular biosciences medicine technology field.The present invention designs the sequence of P7-26 specificity, and using 5 ' ends or 3 ', terminal modified, label (such as isotope, biotin or digoxin) method detection P7-26 being capable of specific recognition PSA albumen.As the component part of kit, perhaps Testing index for the auxiliary diagnosis of prostate cancer, targeted therapy or carries out prostate cancer disease generation, development, the relevant basic research of process etc. to P7-26.Method of the invention is simple, rapidly, sensitive, auxiliary diagnosis, knubble biological targeted therapy suitable for clinical prostate cancer sample, has extensive clinical application and base application prospect.
Description
Invention field:
The present invention relates to after the sequence and modification of the oligonucleotides aglucon P7-26 of specific recognition PSA albumen, and modification
Application of the P7-26 in terms of identifying PSA albumen.The application that the present invention relates to P7-26 in terms of biological medicine.P7-26 is as examination
The component part of agent box perhaps Testing index for prostate cancer auxiliary diagnosis or carry out prostate cancer disease generation, hair
Exhibition, the relevant basic research of process etc..P7-26 is as the application in terms of vehicle delivery drug targeting prostate gland cancer cell.
Background technique:
The aglucon phyletic evolution technology of index concentration, abbreviation SELEX (Systematic Evolution of Ligands
By EXponential Enrichment) technology is the high-throughput biological libraries sieve for the nearly more than ten years rising and being developed rapidly
Selecting technology.Using the random oligonucleotide library (library ssDNA and the library RNA) of large capacity, in conjunction with PCR Amplification Technologies,
With the oligonucleotides of exponential enrichment and target molecule specific bond, by in-vitro screening repeatedly, amplification, the few core finally obtained
Thuja acid aglucon (aptamer) is in the combination of high specific and high-affinity based on space structure and target molecule.Since aptamer has
Accurately identify, non-immunogenicity, easily external synthesis and modification, also known as " artificial substituting antibody ", preclinical medicine,
Clinical diagnosis and new drug development etc. have broad application prospects.The especially composition target SELEX technology of rising in recent years,
To carry out unknown target molecule screening, and by introducing abatement screening step, specific recognition two can be obtained
There are the aptamer of molecule for difference in the compound target of group, and can be studied in turn difference target molecule using the aglucon, this
Just new approach is opened for exploitation novel molecular probe and identification biomarker, especially tumor markers molecule.
Prostate cancer is to threaten one of the important malignant tumour of men's health, seriously threatens the health of male.It is preceding in the U.S.
The disease incidence of column gland cancer comes the 1st of male malignancy, and case fatality rate is 11%, is only second to lung cancer, is listed in tumprigenicity death
The 2nd, in the world, the disease incidence of prostate cancer comes the 3rd of male malignancy.Due to the serious prestige of prostate cancer
The health of male is coerced, early discovery, early diagnosis, early treatment are people's issues that need special attentions.It clinically needs to be tried with some diagnosis
The generation to predict prostate cancer is tested, the early diagnosis to prostate cancer is improved and avoids unnecessary pathology biopsy
It looks into.Prostate-specific antigen (prostate-specific antigen, PSA) is detected as examining for prostate cancer in serum
It is disconnected to provide good platform.The PSA of different existence forms has become the preferred marker of prostate cancer, quilt in serum in recent years
It is widely used in clinical detection.
The present invention is that an oligonucleotides aglucon P7-26 is obtained by SELEX technology.Identified, P7-26 can be special
Identify PSA albumen, without combining other albumen, without combination, having not yet to see can be special for control nucleic acid sequence and above-mentioned albumen
In conjunction with the correlative study report of the aptamer of PSA albumen.
Summary of the invention:
Present invention aims at the sequence for the oligonucleotides aglucon P7-26 for proposing specific recognition PSA albumen and its application necks
Domain, the component part before perhaps Testing index is for the auxiliary diagnosis or progress of prostate cancer including P7-26 as kit
The generation of column gland cancer disease, development, the relevant basic research of process etc..P7-26 is thin as vehicle delivery drug targeting prostate cancer
Application in terms of born of the same parents.
The invention is realized by the following technical scheme:
P7-26 sequence is synthesized by Invitrogen company first, and 5 ' ends or 3 ' are terminal modified, label (such as biotin or
Person's isotope), then carry out application study: EMSA or ELISA method detection P7-26 identification PSA albumen.
The invention has the advantages that
1) compared with the antibody of protide, single-stranded oligonucleotides is more stable；Aptamer can be synthesized directly in vitro, be marked
Note, therefore the secondary antibody of label is not needed, so that operation is more simple, rapid；The synthesis cost of aptamer is compared with Antibody preparation cost
Low, the period is short.
2) the invention demonstrates that P7-26 being capable of specific recognition PSA albumen.Therefore, P7-26 sequence is cured in clinical medicine and basis
Wide application value and vast market prospect are all had in tumor research related fields.
Detailed description of the invention:
Fig. 1 EMSA experiment confirms that the target protein that P7-26 is combined is PSA albumen.
Fig. 2 ELISA experiment confirms that the target protein that P7-26 is combined is PSA albumen.
The measurement of Fig. 3 P7-26 and the protein bound equilibrium dissociation constant of PSA (KD value)
Specific embodiment:
The present invention is further described to the identification of PSA albumen below by P7-26.
The invention is realized by the following technical scheme:
1. further describing this hair to the specific recognition of PSA albumen by the P7-26 of isotope and biotin labeling
It is bright.
1.1 synthesis P7-26 (SEQ ID No.1 in sequence table), GP30 (SEQ ID No.2 in sequence table) and, by setting
Changing reaction makes the 5 ' of P7-26 and GP30 to hold the upper γ -32P-ATP of label.
γ -32P-P7-26:
5’-GCAATGGTACGGTACTTCCTATGGCGATGTGTTGGCTGTGTGTGGGGTGCAAAAGTGCACGCTAC
TTTG
CTAA-3’
γ -32P-GP30:
5’-GCAATGGTACGGTACTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAGTGCACGCTAC
TTTG
CTAA-3’
Note: N represent A, T, G, C any one.
1.2.. P7-26 and GP30 sequence is synthesized, in 5 ' end labels Bio (completion of Invitrogen company).
Bio-P7-26:
5’-GCAATGGTACGGTACTTCCTATGGCGATGTGTTGGCTGTGTGTGGGGTGCAAAAGTGCACGCTAC
TTTG
CTAA-3’
Bio-GP30:
5’-GCAATGGTACGGTACTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAGTGCACGCTAC
TTTG
CTAA-3’
Note: N represent A, T, G, C any one.
1.2 EMSA identify γ-32Specific recognition of the P7-26 of P-ATP label to PSA albumen
2.1 by certain density γ-32The P7-26 and GP30 of p-ATP label are dissolved in the buffer of suitable volumes (1
×PBS-1mmolMgCl2), it is immediately placed on after i00 DEG C of denaturation 5min and is fully cooled on ice；
2.2 by the γ-after denaturation treatment32The P7-26 and GP30 and PSA albumen of p-ATP label are incubated for altogether at 37 DEG C
40min；
10 × DNA sample-loading buffer, 6% natural PAGE glue is added in the common incubation system of 2.3 aptamer and PSA albumen
Electrophoretic separation；
2.4 unload glue, tabletting, and figure is stayed in scanning.
The P7-26 specific recognition PSA albumen of 3.ELISA method identification biotin labeling
3.1 a certain amount of PSA albumen are melted into the carbonate buffer solution of pH 9.7, are added to enzyme-linked item according to 100 holes μ l/
In, 4 DEG C of coating proteins are stayed overnight；
3.2 abandon coating buffer, and the maleic acid confining liquid of 100 μ l albumen containing 1%casein is added in every hole, and room temperature closes 60min；
The Bio-P7-26 of various concentration and Bio-GP30 are dissolved in the buffer of suitable volumes (1 × PBS- by 3.3
1mmolMgCl2), it is immediately placed on after 100 DEG C of denaturation 5min and is fully cooled on ice；
3.4 the library Bio-P7-26 and Bio-GP30 after denaturation treatment is added in enzyme-linked item, make nucleic acid sequence with
Coated albumen is incubated for 37 DEG C of 2h jointly；
3.5 discard liquid in hole, and every hole is washed with the cleaning solution of 350 μ l, wash repeatedly 3 times, and last time is wanted after washing
Liquid in hole is dried completely；
The HRP enzyme that 100 μ l have been diluted according to 1: 100 is added in 3.6 every holes, is incubated at room temperature 40min, discards liquid in hole, wash
Plate 5 times, method is same as above；
100 μ l TMB chromogenic substrates are added in 3.7 every holes, and 37 DEG C are protected from light colour developing, when there is obvious color change, add 10 μ l whole
Only liquid, enzyme-linked instrument reading.
4, the measurement of the protein bound equilibrium dissociation constant of P7-26 and PSA (KD value)
By the γ-of various concentration32P-ATP-ssDNA and PSA albumen mixes in incubation buffer, is incubated in 37 DEG C
Appropriate 10 × DNA sample-loading buffer is added by volume in 40min, and 6% natural PAGE glue electrophoretic separation unloads glue, tabletting, scanning is stayed
Figure.The gray value that retardance band is obtained by software scans is selected using 4 Software on Drawing binding curve of Graphpad Prism
The equilibrium dissociation constant KD value of function Y=Bmax/ (Kd+X) calculating aptamers and target cell
Experimental result:
EMSA method and ELISA method prove P7-26 specific bond PSA albumen
By the available conclusion of Fig. 1: EMSA experiments have shown that P7-26 specific recognition PSA albumen, and with reference protein albumen without
In conjunction with.
By the available conclusion of Fig. 2: ELISA experiments have shown that P7-26 can specific bond PSA albumen, and control sequence with
PSA albumen is without combination.
By the available conclusion of Fig. 3: P7-26 and the protein bound equilibrium dissociation constant KD value of PSA, about 2.403 scholars
1.592μmol/L
In short, P7-26 can specific recognition PSA albumen, have extensive clinical value.
Claims (4)
1. the sequence of the oligonucleotides aglucon P7-26 of specific recognition PSA albumen a kind of, which is characterized in that the nucleotides sequence
Column are as shown in SEQ ID No.1 in sequence table.
2. oligonucleotides aptamers P7-26 according to claim 1, which can be iii vitro chemical synthesis,
It is also possible to prepare by PCR or other molecular biology methods.
3. oligonucleotides aptamers P7-26 according to claim 1, the 5 ' ends or 3 ' ends of the aptamers can through FITC,
Biotin, digoxigenin labeled.
4. oligonucleotides aptamers P7-26 according to claim 1, which detects clinical tumor mark in preparation
The application of object or the reagent in pharmaceutical carrier bio-guide therapy field, using SEQ in the nucleotide sequence such as sequence table
Shown in ID No.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510140664.2A CN106011142B (en) | 2015-03-26 | 2015-03-26 | A kind of sequence and application of the oligonucleotides aglucon P7-26 of specific recognition PSA albumen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510140664.2A CN106011142B (en) | 2015-03-26 | 2015-03-26 | A kind of sequence and application of the oligonucleotides aglucon P7-26 of specific recognition PSA albumen |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106011142A CN106011142A (en) | 2016-10-12 |
| CN106011142B true CN106011142B (en) | 2019-03-29 |
Family
ID=57082336
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510140664.2A Active CN106011142B (en) | 2015-03-26 | 2015-03-26 | A kind of sequence and application of the oligonucleotides aglucon P7-26 of specific recognition PSA albumen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106011142B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108956991B (en) * | 2018-07-25 | 2021-04-27 | 南通大学 | Fluorescence resonance energy transfer biosensor and application thereof |
| CN115948407B (en) * | 2022-10-10 | 2023-12-19 | 四川省农业科学院植物保护研究所 | Pseudomonas syringae kiwi fruit pathogenic variant aptamer, screening method and application |
| CN115747221B (en) * | 2022-12-27 | 2023-11-21 | 中国人民解放军军事科学院军事医学研究院 | HCG-52 and its application in specific recognition of human chorionic gonadotrophin |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004065404A1 (en) * | 2003-01-16 | 2004-08-05 | University Of Florida Research Foundation, Inc. | Novel application of biosensors for diagnosis and treatment of disease |
| WO2007137117A2 (en) * | 2006-05-17 | 2007-11-29 | Massachusetts Institute Of Technology | Aptamer-directed drug delivery |
-
2015
- 2015-03-26 CN CN201510140664.2A patent/CN106011142B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004065404A1 (en) * | 2003-01-16 | 2004-08-05 | University Of Florida Research Foundation, Inc. | Novel application of biosensors for diagnosis and treatment of disease |
| WO2007137117A2 (en) * | 2006-05-17 | 2007-11-29 | Massachusetts Institute Of Technology | Aptamer-directed drug delivery |
Non-Patent Citations (5)
| Title |
|---|
| A novel aptamer-functionalized MoS2 nanosheet fluorescent biosensor for sensitive detection of prostate specific antigen;Rong-Mei Kong 等;《Anal Bioanal Chem》;20141101;第407卷;第369-377页 * |
| M.Souada 等.Label-free electrochemical detection of prostate-specific antigen based on nucleic acid aptamer.《Biosensors and Bioelectronics》.2014,第68卷第49-54页. * |
| Nasa Savory 等.Selection of DNA aptamer against prostate specific antigen using a genetic algorithm and application to sensing.《Biosensors and Bioelectronics》.2010,第26卷第1386-1391页. * |
| Selection of RNA aptamers specific to active prostate-specific antigen;Sujin Jeong 等;《Biotechnol Lett》;20091127;第32卷;第379-385页 * |
| Zhanguang Chen 等.An aptamer based resonance light scattering assay of prostate specific antigen.《Biosensors and Bioelectronics》.2012,第36卷第35-40页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106011142A (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240003892A1 (en) | Heterogeneous single cell profiling using molecular barcoding | |
| Brody et al. | High-content affinity-based proteomics: unlocking protein biomarker discovery | |
| WO2021138676A1 (en) | In situ rna analysis using probe pair ligation | |
| ES2448426T3 (en) | Use of aptamers in proteomics | |
| US9983203B2 (en) | Method for protein analysis | |
| US8785132B2 (en) | Aptamer sandwich assays | |
| CN108614102A (en) | Multiple assay based on aptamer | |
| WO2023215552A1 (en) | Molecular barcode readers for analyte detection | |
| CN105675870B (en) | A kind of kit for being used to detect circulating tumor cell invasiveness | |
| CN106011142B (en) | A kind of sequence and application of the oligonucleotides aglucon P7-26 of specific recognition PSA albumen | |
| US11028427B2 (en) | Systems and methods for proteomic activity analysis using DNA-encoded probes | |
| CN109504775A (en) | A kind of quick detection kit of excretion body lung tumors marker LSM2 | |
| CN104508486B (en) | For determining the method for breast cancer associatcd disease state and for the array in this method | |
| CN109385469A (en) | A kind of high sensitivity double-strand Circulating tumor DNA detection method and kit | |
| Kim et al. | Aptamers generated by Cell SELEX for biomarker discovery | |
| CN109837281B (en) | Aptamer specifically binding to S100P protein and screening, identification and application thereof | |
| CN111944821B (en) | Tissue sample rapid screening of colon cancer aptamer and application of tissue sample rapid screening in detection preparation | |
| CN111944820B (en) | Rapid screening of tissue samples of bladder cancer aptamer and application of rapid screening in detection preparation | |
| CN112877333A (en) | Aptamer for specifically recognizing integrin beta 3 subunit protein and application thereof | |
| CN102296119B (en) | Detection method and kit for milk globulin mRNA in circulatory blood | |
| JP5835778B2 (en) | PSA-binding aptamer and PSA detection kit | |
| US20130035630A1 (en) | Aptamer for the Capture, Diagnosis, Enumeration, and Eradication of Circulating Tumor Cells | |
| KR20160050727A (en) | DNA Aptamer Specifically Binding to LCN2 (Lipocalin 2) protein and Its Use | |
| CN110408620B (en) | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof | |
| CN113564172A (en) | Liquid biopsy tumor cell DNA aptamer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Shao Ningsheng Inventor after: Li Hui Inventor after: Li Shaohua Inventor after: Huang Aixue Inventor after: Ding Hongmei Inventor after: Fan Chunhai Inventor after: Li Jie Inventor after: Dong Jie Inventor after: Zhao Qiang Inventor before: Shao Ningsheng Inventor before: Li Hui Inventor before: Li Shaohua Inventor before: Huang Aixue Inventor before: Ding Hongmei Inventor before: Fan Chunhai Inventor before: Li Jie Inventor before: Dong Jie Inventor before: Zhao Qiang |
|
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: No. 27 Taiping Road, Haidian District, Beijing Co-patentee after: Shanghai Inst. of Applied Physics Chinese Academy of Sciences Patentee after: Academy of military medicine of the PLA Academy of Military Sciences Address before: 100850 No. 27 Taiping Road, Beijing, Haidian District Co-patentee before: Shanghai Inst. of Applied Physics Chinese Academy of Sciences Patentee before: Institute of Basic Medical Sciences |