CN106011142A

CN106011142A - Sequence of aptamer P7-26 for specific recognition of PSA protein and application

Info

Publication number: CN106011142A
Application number: CN201510140664.2A
Authority: CN
Inventors: 邵宁生; 李慧; 李少华; 黄皑雪; 丁红梅; 梵春海; 李洁; 董洁; 赵强
Original assignee: Institute of Basic Medical Sciences of AMMS; Shanghai Institute of Applied Physics of CAS
Current assignee: Shanghai Institute of Technical Physics of CAS; Academy of Military Medical Sciences AMMS of PLA
Priority date: 2015-03-26
Filing date: 2015-03-26
Publication date: 2016-10-12
Anticipated expiration: 2035-03-26
Also published as: CN106011142B

Abstract

Belonging to the technical field of molecular biomedicine, the invention discloses a sequence of an aptamer P7-26 for specific recognition of PSA protein and application. The invention designs a P7-26 specific sequence, a 5' end or 3' end modification and labelling (like isotope, biotin or digoxin, etc.) method is employed for detection of P7-26 and can specifically recognize PSA protein. As a component or detection index of a kit, P7-26 can be used for auxiliary diagnosis and targeted therapy of prostate cancer, or for the fundamental research on the occurrence, development and progress of prostate cancer. The method is simple, rapid and sensitive, is suitable for auxiliary diagnosis of clinical prostate cancer specimens and targeted biotherapy of tumors, and has wide clinical application and basic application prospects.

Description

The sequence of the oligonucleotide aglucon P7-26 of a kind of specific recognition PSA albumen and application

Invention field:

The present invention relates to the P7-26 after sequence and the modification of the oligonucleotide aglucon P7-26 of specific recognition PSA albumen, and modification Application in terms of identifying PSA albumen.The present invention relates to P7-26 application in terms of biological medicine.P7-26 is as test kit Ingredient or Testing index, the auxiliary for carcinoma of prostate diagnoses or carries out prostate cancer disease generation, develops, enters The basic research etc. of Cheng Xiangguan.P7-26 is as the application in terms of vehicle delivery drug targeting prostate gland cancer cell.

Background technology:

The aglucon phyletic evolution technology of index concentration, is called for short SELEX (Systematic Evolution of Ligands by EXponential Enrichment) technology is the high flux biological libraries triage techniques rising and rapidly be development the nearly more than ten years. Apply jumbo random oligonucleotide library (ssDNA library and RNA library), in conjunction with PCR Amplification Technologies, with Exponential enrichment and the oligonucleotide of target molecule specific bond, through in-vitro screening repeatedly, amplification, the final oligonucleoside obtained Acid aglucon (aptamer) is the combination of high specific and high-affinity based on space structure and target molecule.Owing to aptamer has The advantages such as accurately identifications, non-immunogenicity, easy external synthesis and modification, are also called " artificial substituting antibody ", preclinical medicine, Clinical diagnosis has broad application prospects with aspects such as new drug developments.The especially composition target SELEX technology of rising in recent years, Make that unknown target molecule is carried out screening to be possibly realized, and by introducing abatement screening step, it is possible to obtain specific recognition two groups In compound target there is the aptamer of molecule in difference, and this aglucon can be utilized to study difference target molecule in turn, and this is just Exploitation novel molecular probe and qualification biomarker, especially tumor markers molecule open new approach.

Carcinoma of prostate is one of important malignant tumor threatening men's health, the health of serious threat male.In the U.S., prostate The sickness rate of cancer comes the 1st of male malignancy, and case fatality rate is 11%, is only second to pulmonary carcinoma, is listed in tumprigenicity death 2nd, in the world, the sickness rate of carcinoma of prostate comes the 3rd of male malignancy.Due to the serious prestige of carcinoma of prostate The health of side of body male, early discovery, early diagnosis, early treatment are people's issues that need special attention.Need clinically with some diagnosis examinations Test the generation predicting carcinoma of prostate, improve the early diagnosis to carcinoma of prostate and avoid unnecessary pathology biopsy. In serum, the diagnosis being detected as carcinoma of prostate of prostate specific antigen (prostate-specific antigen, PSA) provides very Good platform.In serum, the PSA of different existence forms has become the first-selected mark of carcinoma of prostate in recent years, is widely used in Clinical detection.

The present invention is to obtain an oligonucleotide aglucon P7-26 by SELEX technology.Identified, P7-26 can specific recognition PSA albumen, and do not combine other albumen, comparison nucleotide sequence and above-mentioned albumen are all without combining, and having not yet to see can specific bond The correlational study report of the aptamer of PSA albumen.

Summary of the invention:

Present invention aim at proposing sequence and the application thereof of the oligonucleotide aglucon P7-26 of specific recognition PSA albumen, bag Include P7-26 diagnose as the ingredient of test kit or Testing index, the auxiliary for carcinoma of prostate or carry out carcinoma of prostate The basic research etc. that disease generation, development, process are correlated with.P7-26 is as vehicle delivery drug targeting prostate gland cancer cell aspect Application.

The present invention is achieved through the following technical solutions:

First synthesized P7-26 sequence by Invitrogen company, and 5 ' ends or 3 ' terminal modified, labelling (such as biotin or Person's isotope), then carry out applied research: EMSA or ELISA method detection P7-26 and identify PSA albumen.

The invention have the advantages that

1) compared with the antibody of protide, the oligonucleotide of strand is more stable；Aptamer can direct external synthesis, labelling, therefore Need not the two of labelling resist so that operate the simplest, rapidly；The synthesis cost of aptamer is low compared with antibody preparation cost, Cycle is short.

2) the invention demonstrates that P7-26 can specific recognition PSA albumen.Therefore, P7-26 sequence is in clinical medicine and preclinical medicine Tumor research association area is respectively provided be widely applied and is worth and wide market prospect.

Accompanying drawing illustrates:

Fig. 1 EMSA experiment confirms that the target protein that P7-26 is combined is PSA albumen.

Fig. 2 ELISA experiment confirms that the target protein that P7-26 is combined is PSA albumen.

The mensuration of the protein bound equilibrium dissociation constant of Fig. 3 P7-26 Yu PSA (KD value)

Detailed description of the invention:

Below by P7-26, the identification of PSA albumen is further described the present invention.

The present invention is achieved through the following technical solutions:

1. by isotope and biotin labeled P7-26, the specific recognition of PSA albumen is further described the present invention.

1.1 synthesis P7-26 (SEQ ID No.1 in sequence table), GP30 (SEQ ID No.2 in sequence table) and, pass through Displacement reaction makes γ-32P-ATP on 5 ' the end labellings of P7-26 and GP30.

γ-32P-P7-26:

5’-GCAATGGTACGGTACTTCCTATGGCGATGTGTTGGCTGTGTGTGGGGTGCAAAAGTGCACGCTACTTTG

CTAA-3’

γ-32P-GP30:

5’-GCAATGGTACGGTACTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAGTGCACGCTACTTTG

CTAA-3’

Note: N represent A, T, G, C any one.

1.2.. synthesis P7-26 and GP30 sequence, all at 5 ' ends labelling Bio (Invitrogen company completes).

Bio-P7-26:

5’-GCAATGGTACGGTACTTCCTATGGCGATGTGTTGGCTGTGTGTGGGGTGCAAAAGTGCACGCTACTTTG

CTAA-3’

Bio-GP30:

5’-GCAATGGTACGGTACTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAGTGCACGCTACTTTG

CTAA-3’

Note: N represent A, T, G, C any one.

1.2 EMSA qualification γ-³²The P7-26 of the P-ATP labelling specific recognition to PSA albumen

2.1 by certain density γ-³²P7-26 and GP30 of p-ATP labelling be dissolved in the buffer of suitable volumes (1 × PBS-1mmolMgCl₂), it is immediately placed on the most sufficiently cool after i00 DEG C of degeneration 5min；

2.2 by the γ after degenerative treatments-³²P7-26 and GP30 and the PSA albumen of p-ATP labelling hatches 40min altogether at 37 DEG C；

The common incubation system of 2.3 aptamer Yu PSA albumen adds 10 × DNA sample-loading buffer, 6% natural PAGE glue electrophoretic separation；

2.4 unload glue, tabletting, and figure is stayed in scanning.

3.ELISA method identifies biotin labeled P7-26 specific recognition PSA albumen

3.1 a certain amount of PSA albumen are melted in the carbonate buffer solution of pH 9.7, join enzyme according to 100 μ l/ holes In bracing, 4 DEG C of coating proteins are overnight；

3.2 abandon and are coated liquid, and every hole adds the 100 μ l maleic acid confining liquid containing 1%casein albumen, and room temperature closes 60min；

Bio-P7-26 and Bio-GP30 of variable concentrations is dissolved in (1 × PBS-1mmolMgCl in the buffer of suitable volumes by 3.3₂), It is immediately placed on the most sufficiently cool after 100 DEG C of degeneration 5min；

Bio-P7-26 and Bio-GP30 library after degenerative treatments is added in enzyme bracing by 3.4, makes nucleotide sequence and coated egg Bai Gongtong hatches 37 DEG C of 2h；

3.5 discard liquid in hole, and every hole cleaning mixture of 350 μ l washs, repeated washing 3 times, will be in hole after last washing Liquid dries completely；

3.6 every holes add 100 μ l according to 1: the 100 HRP enzyme diluted, incubated at room 40min, discard liquid in hole, wash plate 5 Secondary, method is ibid；

3.7 every holes add 100 μ l TMB chromogenic substrates, 37 DEG C of lucifuge colour developings, when there being obvious color to change, add 10 μ l and terminate Liquid, enzyme connection instrument reading.

4, the mensuration of the protein bound equilibrium dissociation constant of P7-26 Yu PSA (KD value)

By the γ of variable concentrations-³²P-ATP-ssDNA Yu PSA albumen mixes in incubation buffer, hatches 40min in 37 DEG C, By volume adding appropriate 10 × DNA sample-loading buffer, 6% natural PAGE glue electrophoretic separation, unload glue, tabletting, figure is stayed in scanning. Obtained the gray value of retardance band by software scans, use Graphpad Prism 4 Software on Drawing binding curve, select letter Number Y=Bmax/ (Kd+X) calculates the equilibrium dissociation constant KD value of aptamers and target cell

Experimental result:

EMSA method and ELISA method all prove P7-26 specific bond PSA albumen

Can be concluded that EMSA tests by Fig. 1 and prove P7-26 specific recognition PSA albumen, and and reference protein Albumen is without combining.

By Fig. 2 can be concluded that ELISA experiment prove P7-26 can specific bond PSA albumen, and compare sequence Row and PSA albumen are without combining.

P7-26 Yu PSA protein bound equilibrium dissociation constant KD value can be concluded that by Fig. 3, about 2.403 Scholar 1.592 μm ol/L

In a word, P7-26 can specific recognition PSA albumen, there is extensive clinical value.

Claims

1. the sequence of the oligonucleotide aglucon P7-26 of a specific recognition PSA albumen, it is characterised in that SEQ in described nucleotide sequence such as sequence table Shown in ID No.1.

2. according to method described in claim 1, oligonucleotide aptamers P7-26 can be iii vitro chemical synthesis, it is also possible to be by PCR or other Prepared by molecular biology method.

3., according to method described in claim 1,5 ' ends or the 3 ' ends of oligonucleotide aptamers P7-26 can be through isotope, biotin, digoxin etc. Labelling.

4. according to method described in claim 1, oligonucleotide aptamers P7-26 in tumor research field, the discriminating of clinical tumor tissue slice specimen, swollen Application in tumor bio-guide treatment field.