CN101988061A - Breast cancer detecting marker as well as detecting method, kit and biological chip thereof - Google Patents

Abstract

The invention relates to a breast cancer detecting marker by utilizing 16 specific tiny ribonucleic acids steadily existing in blood serum and blood plasma of a human body as well as a detecting method, a kit and a biological chip thereof, and the detecting marker can be used in the aspects of diagnosis and differential diagnosis of breast cancer, occurrence and recurrence forecast as well as efficacy assessment of disease complications, screening and therapeutic evaluation of medicinal active ingredients and the like, and has the advantages of wide detection pedigree, high sensitivity and low detection cost, the materials are conveniently taken, the samples are easy to store and the like. The method can be widely used in related work such as breast cancer census, the defects of low specificity and low sensitivity caused by insuperable individual difference of a single marker can be improved and the clinical detectable rate of the breast cancer is notably improved, and is an effective mean of early breast cancer diagnosis.

Description

Breast cancer detection marker and detection method thereof, test kit and biochip

Technical field

The invention belongs to biological technical field, relate to separation, the qualitative and quantitative analysis of miRNA molecule in the human serum, also relate to the various clinical indication of mammary cancer simultaneously.Specifically, the present invention is that a kind of specific miRNA of stable existence in the breast cancer disease human serum that utilizes is as the certification mark thing of mammary cancer and method, related kit and the biochip that detects this marker, variation by miRNA in the breast cancer disease human serum, in in-vitro diagnosis mammary cancer, judge the mammary cancer pathogenic process, generation and the probability of breast cancer relapse and the prognosis of mammary cancer of prediction mammary cancer complication, and analyze drug effect and curative effect.

Background technology

Mammary cancer has become the highest malignant tumour of global women's sickness rate, and the whole world has 1,200,000 women to suffer from breast cancer every year approximately, and 500,000 people die from mammary cancer.Only the mammary gland patient of about 1-2% is the male sex.China in the past the breast cancer incidence in 10 years explode 47%, have 20 every year surplus ten thousand mammary cancer new cases.

Mammary cancer is result of treatment one of malignant cancer preferably, but prerequisite is to find, reach early treatment early.At present early diagnosing mammary cancer (minimum cancer and T0 phase) is not having under the obvious body surface feature situation rate of examining out not high.

The main diagnostic method of mammary cancer comprises at present: breast molybdenum target shooting, CT, nucleus magnetic resonance and living tissue pathologic finding.Simultaneously auxiliary detection means also comprises the mensuration of special chemical ingredients in the immunological response, body of cancer and enzyme reaction etc.In the blood as CAi5-3 antigen, carcinomebryonic antigen (CEA), lactotropin detections such as (PRL) can provide reference to the diagnosis of mammary cancer, but these check that false positives and false negative are all higher, specificity is not strong.

Although increasing disease markers has been found and has been applied to the monitoring of generaI investigation, diagnosis and the curative effect of clinical disease, their clinical application effect also exists obvious deficiency.For example, tumor marker, serum lactic dehydrogenase, carcinomebryonic antigen etc. have been widely used in clinical, but these disease markers also can not satisfy the needs to early diagnosis of cancer far away, its major cause has two aspects: the sensitivity and the specificity of (1) above-mentioned disease markers are relatively low, the index that their detected result can't be made a definite diagnosis as disease; (2) early diagnostic rate of disease should present positive correlation with the effect of treatment, and above-mentioned any disease markers also is difficult to satisfy this requirement of disease early diagnosis.With the cancer is example, tumour differentiation classification specificity is strong excessively, the whole susceptibility of tumour is lower, the censorship sample is difficult to take repeatedly, sample is preserved defectives such as requirement condition height owing to exist, cost an arm and a leg simultaneously, therefore under existence conditions, be difficult to the existing tumor marker of wide popularization and application.And some traditional medicine means detect as histocyte and to exist its inherent defective, and the position of drawing materials is improper, histocyte sample material deficiency or people will cause mistaken diagnosis for lacking experience etc.Though other technology for example iconography has been widely used in the inspection and the diagnosis of disease, it still exists significant limitation on disease degree qualitative.Therefore at present be necessary very much to seek the novel, sensitive of the above-mentioned defective that can remedy existing marker and use disease detection marker easily.

MiRNA, English microRNA by name is the non-coding strand micro ribonucleic acid molecule that a class is about 19 to 23 Nucleotide.They are high conservative on evolving, and with many normal physiological activity of animal, closely related as biont growth, tissue differentiation, natural death of cerebral cells and energy metabolism etc., also exist closely simultaneously and get in touch with the generation of numerous disease and development.The nearest expression level of discovering several miRNAs in lymphocytic leukemia and the Burkitt lymphoma all has downward modulation (Lawrie CH in various degree, Gal S, Dunlop HM et al.Detection of elevated levels of tumor-associated microRNAs in serum of patients with diffuse large B-cell lymphoma.Br J Haematol 2008; 141:672-675); When analyzing the miRNA expression of comparing in people's lung cancer, the breast cancer tissue, discovery has the expression level of some tissue specificity miRNAs with respect to healthy tissues variation (Garofalo M to take place, Quintavalle C, Di Leva G et al.MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer.Oncogene 2008).There are some researches prove that also miRNA has influenced the generation and the development of cardiovascular disordeies such as myocardial hypertrophy, heart failure, atherosclerosis, and close association (Tryndyak VP is arranged with metabolic diseases such as type ii diabetes, Ross SA, Beland FA, Pogribny IP.Down-regulation of the microRNAs miR-34a, miR-127, and miR-200b in rat liver during hepatocarcinogenesis induced by a methyl-deficient diet.Mol Carcinog.2008 Oct 21).Exist positive connection between these experimental result prompting miRNA expression and specific variations and disease generation and the development.

Owing to play vital role beyond imagination in the expression regulation of miRNA after genetic transcription, therefore the cognation below it exists with disease: at first, the variation of miRNA may be the cause of disease, this is because the supressor of disease and the promotion factor all may be the target sites of miRNA, when disorderly expression has taken place earlier miRNA itself, promote the miRNA expression amount of the factor to reduce such as the original disease that suppresses, the miRNA expression amount that perhaps suppresses the disease supressor has raise, its net result all can cause the whole disorderly of downstream series of genes change of Expression and some path, and then the generation that induces an illness; Secondly, the variation of miRNA also may be the result of disease, this is because when disease (as cancer) takes place, can cause the losing of chromosome segment, the sudden change of gene or the violent amplification of chromosome segment, if miRNA just in time is positioned at this varied sections, its expression amount will take place to change extremely significantly so.Therefore, the miRNA molecule can be used as the new disease markers of a class fully in theory, and its specific variations is inevitable to be associated with disease generation development.MiRNA can also by miRNA that suppresses to raise in the lysis or the miRNA of crossing down-regulated expression, might greatly be alleviated the generation and the development of disease as the potential drug target simultaneously.

Domestic existing at present with the correlative study of miRNA as disease markers, as Chinese patent application CN100999765A and CN101298630A, they all choose account for the 4th of malignant tumour sickness rate colorectal carcinoma as research object, find after deliberation, during the colon benign polypus develops into malignant tumour, some miRNA molecules all exist specific variations, and have set up a kind of more responsive, more accurate method of making a definite diagnosis colorectal carcinoma in early days by the specific variations of measuring miRNA in view of the above.Yet because drawing materials of tissue sample is not easy to make the widespread use clinically of this method to be restricted.

Summary of the invention

For overcoming above-mentioned defective, the applicant will study sight and invest more easily acquisition, even the blood that just can collect in the routine physical examination.Because blood can be circulated to whole body institute in a organized way, and to cell delivery nutrition and remove refuse, so blood can reflect the physiological and pathological situation of whole machine body, and its detected result has directive significance to HUMAN HEALTH.Exist multiple protein in the known blood serum, as total protein, albumin, sphaeroprotein etc., multiple lipid is as HDL cholesterol, triglyceride etc., multiple saccharic, pigment, ionogen and inorganic salt, plurality of enzymes, as amylase, alkaline phosphatase, acid phosphatase, the plain lipase of courage, zymohexase etc., also compiled multiple signaling molecule simultaneously from body tissue's organ, as cytokine, hormone etc.At present, the diagnosis of disease only is confined to above-mentioned biochemical indicator in the blood serum, the still report of serum-free/blood plasma miRNA.Thinking in people's traditional concept does not have ribonucleic acid molecule in the blood serum, though have also can be degraded to small molecule segment very soon by rnase and detect less than.But, because being 19 to 23 nucleotide units, the miRNA molecule forms, have structural singularity and relative stability, and they very likely are present in the blood serum.One of the present application people Zhang Chenyu professor's early-stage Study is verified, stably have miRNA in the blood serum, and each disease there is its specific variation collection of illustrative plates (Chen et al:Characterization of microRNAs in serum:a novel class of biomarkers for diagnosis of cancer and other diseases.Cell Res.2008 Oct; 18 (10): 997).

For seeking the breast cancer detection marker and it accurately being detected, apply for everybody based on available research achievements, carried out the research of the following aspects:

(1) specific variations of blood serum miRNA in the research mammary cancer pathogenic process;

(2) by being used to detect the biochip of blood serum miRNA and the variation that sequencing technologies is measured mammary cancer blood serum miRNA;

What (3) will screen expresses the big class blood serum miRNA molecular application of difference degree in blood serum miRNA detection technique under mammary cancer and normal physiological state, prepare the biochip and the diagnostic kit that are applied to fields such as breast cancer diagnosis.

By research to the dependency of blood serum miRNA and mammary cancer, the applicant has proposed specific miRNA with stable existence in the blood serum as the breast cancer detection marker, set up the method for the specific miRNA of stable existence in a kind of vitro detection blood serum, carry out the early diagnosis of mammary cancer by the specific variations that detects specific miRNA, disease is identified and course of disease monitoring, recurrence and prognosis, the prediction that complication takes place can further be carried out drug effect simultaneously and judge, medicine guide, individualized treatment, the effective components of Chinese medicinal screening, plant researchs such as heap sort.

Purpose of the present invention at first provides a kind of breast cancer detection marker, described marker comprise following in human serum/blood plasma any one or more than one (for example 2,3,4,5,6,7,8,9,10,11,12,13,14,15 or 16 kind) in the ripe body of stable existence and detectable miRNA (Mature microRNA), preferred arbitrarily two or more:

MiR-22, miR-23a, miR-25, miR-92a, miR-10a, miR-199b-3p, miR-206, miR-375, miR-378, miR-151-3p, miR-423-3p, miR-409-3p, miR-483-5p, miR-486-5p, miR-629 and miR-1307.

Above-mentioned blood serum can derive from human body live body, tissue, organ and/or corpse.

Another object of the present invention provides the method that detects above-mentioned breast cancer marker thing, can further estimate the state of human body mammary cancer by this method.

Above-mentioned detection method is selected from inverse transcription polymerase chain reaction method (RT-PCR), real time fluorescent quantitative poly chain reaction method (Real-time PCR), Northern blot hybridization method (Northern blotting), rnase protection analysis method (RNase protection assay), Solexa sequencing technologies (Solexa sequencing technology) or biochip method.

Above-mentioned RT-PCR method is a preferred method, comprises the steps:

1) extraction experimenter's the total RNA of blood serum (for example extracting by Trizol reagent) obtains the cDNA sample by the RNA reverse transcription reaction; Perhaps carry out reverse transcription reaction as damping fluid and prepare the cDNA sample with experimenter's blood serum;

2) carry out the PCR reaction with miRNA design primer;

3) carry out the agarose gel electrophoresis of PCR product;

4) EB dyeing back observations under ultraviolet lamp;

Above-mentioned Real-time PCR method is another preferred method, may further comprise the steps:

1) extraction experimenter's the total RNA of blood serum (as extracting by Trizol reagent) obtains the cDNA sample by the RNA reverse transcription reaction; Perhaps collect experimenter's blood serum sample, carry out reverse transcription reaction with blood serum as damping fluid and prepare the cDNA sample;

2) design primer with miRNA;

3) add fluorescent probe and carry out the PCR reaction;

4) detection and comparison blood serum sample are with respect to the variation of the amount of miRNA in normal serum/blood plasma.

Above-mentioned Northern blotting method may further comprise the steps:

1) extracts the total RNA of experimenter's blood serum (as extracting) by Trizol reagent;

2) carry out sex change PAGE electrophoresis and film shift experiment;

3) preparation isotopic labeling miRNA probe;

4) carry out the film hybridization;

5) isotropic substance signal detection is as phosphorus screen scanning detecting result.

Above-mentioned RNase protection assay method comprises the steps:

1) carries out the synthetic of antisense RNA probes, isotopic labeling and purifying;

2) extract the total RNA of experimenter's blood serum (as extracting) by Trizol reagent;

3) RNA after will extracting is dissolved in the hybridization buffer and adds antisense RNA probes and carries out hybridization;

4) adding the RNase Digestive system reacts;

5) carry out electrophoresis and radioautograph;

6) analytical results.

Above-mentioned Solexa sequencing technology method comprises the steps:

1) extracts the total RNA of experimenter's blood serum (as extracting) by Trizol reagent;

2) carry out the PAGE electrophoresis and reclaim 17-27nt RNA molecule;

3) adaptor prime enzyme being associated in 3 ' and 5 ' of small RNA molecular holds;

4) carry out RT-PCR reaction back and checking order;

5) data analysis and processing.

Above-mentioned biochip method comprises the steps:

1) with the ripe body storehouse dot matrix of whole more than the 1000 kinds of miRNAs of human body and prepare biochip;

2) extract the total RNA of experimenter's blood serum;

3) separate miRNA by post;

4) utilize T4 RNA ligase enzyme to carry out the miRNA fluorescent mark;

5) carry out hybridization with biochip;

6) Data Detection and analysis.

Employed blood serum derives from experimenter's live body, tissue, organ and/or corpse in the aforesaid method.

The present invention can analyze the variation tendency and the variable quantity of miRNA in patient with breast cancer's blood serum by aforesaid method, and the dependency of they and mammary cancer.Therefore, more than detect the method for 16 kinds of specific miRNAs in experimenter's blood serum, can further estimate the state of human body mammary cancer, and then the method for a kind of prediction, diagnosis, discriminating and/or evaluating breast cancer can be provided for people, mainly 16 kinds of specific miRNAs are that so-called breast cancer detection marker is realized to this method in experimenter's blood serum by detecting.

Another object of the present invention provides above-mentioned breast cancer marker thing in the reagent of preparation, prediction, diagnosis, discriminating and/or evaluating breast cancer or the application in the instrument, comprises preparation reagent corresponding box and biochip.

The invention provides a kind of miRNA probe combinations that is used to detect the breast cancer marker thing, also promptly predict, the miRNA probe combinations of diagnosis and/or evaluating breast cancer, described probe combinations comprise in the probe shown in the following nucleotide sequence any one or more than one, preferred arbitrarily two or more:

MiR-22, miR-23a, miR-25, miR-92a, miR-10a, miR-199b-3p, miR-206, miR-375, miR-378, miR-151-3p, miR-423-3p, miR-409-3p, miR-483-5p, miR-486-5p, miR-629 and miR-1307.

miRNA?	Probe sequence	Sequence numbering
			has-miR-22?	ACAGTTCTTCAACTGGCAGCTT	SEQ?ID?NO.1
has-miR-23a?	GGAAATCCCTGGCAATGTGAT	SEQ?ID?NO.2
			has-miR-25?	TCAGACCGAGACAAGTGCAATG	SEQ?ID?NO.3
has-miR-92a?	ACAGGCCGGGACAAGTGCAATA	SEQ?ID?NO.4
			has-miR-10a?	CACAAATTCGGATCTACAGGGTA	SEQ?ID?NO.5
has-miR-199b-3p?	TAACCAATGTGCAGACTACTGT	SEQ?ID?NO.6
			has-miR-206?	CCACACACTTCCTTACATTCCA	SEQ?ID?NO.7
has-miR-375?	TCACGCGAGCCGAACGAACAAA	SEQ?ID?NO.8
			has-miR-378?	CCTTCTGACTCCAAGTCCAGT	SEQ?ID?NO.9
has-miR-151-3p?	CCTCAAGGAGCTTCAGTCTAG	SEQ?ID?NO.10
			has-miR-423-3p?	ACTGAGGGGCCTCAGACCGAGCT	SEQ?ID?NO.11
has-miR-409-3p?	AGGGGTTCACCGAGCGGCATTC	SEQ?ID?NO.12
			has-miR-483-5p?	CTCCCTTCTTTCCTCCCGTCTT	SEQ?ID?NO.13

has-miR-486-5p?	CTCGGGGCAGCTCAGTACACGGA	SEQ?ID?NO.14
			has-miR-629?	AGTTCTCCCAACGTAAACCCA	SEQ?ID?NO.15
has-miR-1307?	CACGACCGACGCCACGCCGAGT	SEQ?ID?NO.16

The present invention also provides a kind of test kit that is used to detect the breast cancer marker thing, also promptly predicts, diagnoses, the test kit of discriminating and/or evaluating breast cancer, and this test kit comprises the instrument that detects above-mentioned marker.Preferably, wherein said instrument comprises the above-mentioned miRNA probe combinations that is used to detect the breast cancer marker thing; More preferably, described instrument also comprises archaeal dna polymerase (being used for catalytic dna synthetic enzyme in the PCR reaction), deoxyribonucleotide mixture (dNTP mixture).

The miRNA primer of the specific variations relevant with mammary cancer that screen or its corresponding probe sequence collected in the PCR test kit (RT-PCR or Real-time PCR) can prepare the breast cancer diagnosis test kit.

The present invention also provides a kind of biochip that is used to detect the breast cancer marker thing, also promptly predicts, diagnoses, the biochip of discriminating and/or evaluating breast cancer, and this biochip comprises the element that detects above-mentioned marker.Preferably, wherein said element comprises the above-mentioned combination that is used to detect the miRNA probe any one or more than one of breast cancer marker thing.

With the reverse complementary sequence of the miRNA of the specific variations relevant that screen with mammary cancer as probe points at chip, just made specially blood serum miRNA detection of biological chip at mammary cancer.

Particularly, in above-mentioned any containing in above a kind of combination, method, test kit or the biochip to 16 kinds of miRNA markers, described evaluation experimenter's breast cancer status is for measuring the breast cancer status after the experimenter gives determinand, the activity that prevents and/or treats mammary cancer that specifically is used to screen determinand (medicine that is used for the treatment of mammary cancer); Described evaluation experimenter's breast cancer status is diagnosis and/or differential diagnosis experimenter's disease; Described evaluation experimenter's breast cancer status is for estimating the validity that experimenter's disease is treated; Described evaluation experimenter's breast cancer status predicts that for mammary cancer is taken place the experimenter described generation mammary cancer is specially the generation of mammary cancer complication and/or the recurrence of mammary cancer.

It is also more loaded down with trivial details and coarse at present disease to be carried out the traditional biological chemistry and the Protocols in Molecular Biology of clinical diagnosis.The new technique that might be used for medical diagnosis on disease that development in recent years is got up has gene chip and protein (antibody) chip technology etc.The measured mRNA level of gene chip changes the change that can not reflect real protein level fully.Because proteinic biological activity and post transcriptional modificaiton such as glycosylation, phosphorylation etc. are closely related.And for numerous disease detected, biochip technology can't detect marker molecules in body fluid and the blood.Protein (antibody) chip technology and proteomic techniques also have its limitation.Particularly contain ten hundreds of albumen and polypeptide fragments in the blood serum in the human body, their concentration distribution are wide, clearly Bao Dao albumen seldom, quantification just still less.In the huge protein group of this quantity, look for the protein that close association is arranged with specified disease, and understand its effect in lesion tissue and remain an extremely large order, and lacking perfect antibody resource will be a bottleneck problem of restriction antibody chip technical development.Blood serum miRNA detection technique, biochip and diagnostic kit based on the blood serum miRNA are combined as a whole the peculiar property and the conventional molecular Biological Detection technology of blood serum miRNA dexterously, they analyze the composition of miRNA in the mammary cancer blood serum in high-throughput ground apace, and clinical applicability is extremely strong.Because the physiological status variation of organ-tissue can cause the change that the blood serum miRNA is formed, so the blood serum miRNA can be used as " disease fingerprint ", the early diagnosis of realization mammary cancer.

In sum, the present invention has following advantage:

The specific blood serum miRNA that (1) will filter out is as novel breast cancer marker thing, have the pedigree of detecting wide, highly sensitive, detect cost low, draw materials conveniently, sample advantages such as (blood serum-20 ℃ deposit get final product) easy to store, this method can be widely used in related works such as general investigation of desease, becomes the effective means of early diagnosis disease.

(2) the blood serum miRNA with low specificity and the muting sensitivity that the improvement individual difference that single marker was difficult to overcome is brought, significantly improves the early stage diagnosis and treatment of the clinical recall rate and the realization disease of disease as new disease markers.

(3) advantage of blood serum miRNA detection technique is, its detection be a series of disease-related marker, thereby can overcome difference (being age, sex, race, diet and environment etc.) between the individual patient, and this single just disease markers a major obstacle can't going beyond.

In a word, the present invention can further be applied to make a definite diagnosis in early days mammary cancer, this new blood serum breast cancer marker thing not only provides basic substance for people fully understand the mechanism of mammary cancer on molecular level, has also quickened clinical disease diagnosis and has learned and therapeutic progress.Superiority based on the blood serum miRNA, believe in the near future, will become the part of routine physical examination to the blood serum miRNA diagnostic techniques of seriously disease such as cancer, and the relevant gene therapy of miRNA also can use widely, conquers these diseases and is no longer a dream.

Description of drawings

Fig. 1 shows the RT-PCR result of direct detected part miRNA in the normal human serum.

Fig. 2 shows and extracts in the normal human serum RNA and detect the wherein RT-PCR result of miRNA.

Fig. 3 shows the miRNA RT-PCR result of direct detected partially stabilized expression in mouse, rat, tire ox, calf and the horse serum respectively.

Fig. 4 A to 4B shows miRNA and the differential expression normal people in diabetes and the osteosarcoma patients serum/blood plasma.

Embodiment

Below, describe embodiments of the invention in conjunction with the accompanying drawings in detail.Be understandable that specific implementations described here represents that by way of example it is not as limitation of the present invention.Under the situation that does not deviate from the scope of the invention, principal character of the present invention can be used for various embodiments.One skilled in the art will appreciate that maybe and can confirm that only use normal experiment, many equivalents can both be applied in the particular step described herein.These equivalent places of being considered to and are covered by claim within the scope of the present invention.

The RT-PCR of miRNA experiment in embodiment 1 blood serum

Use the various miRNAs of stable existence in RT-PCR scientific discovery and reference and the animal serum/blood plasma, and its expression amount is quite abundant.Concrete steps are:

(1) collection mouse, rat, normal people and some patient's blood serum;

(2) preparation cDNA sample.This operation has two kinds of schemes, a kind of scheme is for directly to carry out reverse transcription reaction with 10 μ l blood serum, another kind of is to use Trizol reagent (Invitrogen company) to extract the total RNA of blood serum (the 10ml blood serum is the RNA about the about 10 μ g of energy enrichment usually) earlier, obtains cDNA by the RNA reverse transcription reaction then.The reaction system of reverse transcription comprises 4 μ l, 5 * AMV buffer, 2 μ l 10mMeach dNTP mixture (Takara company), 0.5 μ l RNase Inhibitor (Takara company), 2 μ l AMV (Takara company) and 1.5 μ l gene specific reverse primer miscellanys.Reactions steps is 16 ℃ hatched 15 minutes, and 42 ℃ were reacted 1 hour, and hatched 5 minutes for 85 ℃;

(3) PCR and electrophoresis observation.CDNA is diluted by 1/50, get the cDNA after 1 μ l dilutes, add 0.3 μ l Taq enzyme (Takara company), 0.2 μ l 10 μ M forward primers, the general reverse primer of 0.2 μ l, 10 μ M, 1.2 μ l 25mM MgCl2,1.6 μ l 2.5mM each dNTP mixture (Takara company), 2 μ l, 10 * PCR buffer, 13.5 μ lH20,20 μ l systems are carried out PCR.The reaction conditions of PCR is: carried out 1 circulation → 95 ℃, 15 seconds in 95 ℃, 5 minutes, carried out 40 circulations in 60 ℃, 1 minute.The PCR product is got 10 μ l and is carried out 3% agarose gel electrophoresis, and EB dyeing back is observed under ultraviolet lamp.

Concrete experimental result is seen Fig. 1.Fig. 1 is to be research object with the serum of taking from the normal people, serum is directly carried out the experimental result of RT-PCR.Select for use the ripe body of whole more than the 1000 kinds of miRNAs of people to carry out the PCR reaction, Fig. 1 is 12 kinds of miRNAs wherein.They are respectively the specific miRNA miR-181a of hemocyte, miR-181b, miR-223, miR-142-3p, miR-142-5p, miR-150, miRNA miR-1, miR-133a, miR-206 from cardiac muscle and skeletal muscle, from miRNA miR-9, the miR-124a of cerebral tissue, and from the miRNA miR-122a of liver.Above-mentioned as can be seen from the results four kinds of tissue-derived miRNAs can both detect in blood, be not that the ripe body of whole more than 1000 kinds of miRNAs all has high abundance to express in blood serum, some miRNA is very micro-, even can not normally detect.

In order further to verify these miRNAs of stable existence in the blood serum, extract the RNA in the normal human serum earlier, select for use the ripe body of whole more than the 1000 kinds of miRNAs of people to carry out the PCR experiment then, the result is as shown in Figure 2.The result of Fig. 2 and the result of Fig. 1 are very identical, and the PCR product is single, show that these two kinds of experimental techniques can both detect the expression and the abundance of human serum miRNA, prove stably to have multiple tissue-derived miRNA in human serum.

In Fig. 1 and Fig. 2, U6 is that molecular weight is the snRNA of 100bp, internal reference molecule as the miRNA experiment, the specific miRNA miR-181a of hemocyte (181a) represented respectively in remaining 12 code name, miR-181b (181b), miR-223 (223), miR-142-3p (142-3p), miR-142-5p (142-5p), miR-150 (150), miRNA miR-1 (1) from cardiac muscle and skeletal muscle, miR-133a (133a), miR-206 (206), miRNA miR-9 (9) from cerebral tissue, miR-124a (124a), and from the miRNA miR-122a (122a) of liver.

In addition, use the same method and detected the expression and the abundance of more than 1000 kind of miRNA in mouse, rat, tire ox, calf and the horse serum, the same miRNA of different tissue sources of finding has stably express in mouse, rat, tire ox, calf and horse serum, the result as shown in Figure 3.

The real-time PCR of miRNA experiment in embodiment 2 blood serum

In order to study the special variation of blood serum miRNA in the breast cancer disease process, carried out the quantitative PCR experiment of blood serum miRNA.Quantitative PCR experiment principle and experimental procedure are the same with RT-PCR, and unique not being both added fluorescence dye EVA GREEN in PCR.What instrument used is ABI Prism 7300 quantitative real time PCR Instruments, and reaction conditions is to carry out 1 circulation → 95 ℃, 15 seconds in 95 ℃, 5 minutes, carries out 40 circulations in 60 ℃, 1 minute.Data processing method is a Δ Δ CT method, and CT is made as the cycle number of reacting when reaching thresholding, and then each miRNA can be represented with equation 2-Δ CT with respect to the expression amount of standard confidential reference items, wherein Δ CT=CT sample-CT confidential reference items.Patients serum/plasma sample and normal human serum/plasma sample are directly carried out reverse transcription reaction, react the wherein amount of contained miRNA by quantitative PCR.

Choose osteosarcoma and diabetic serum sample, the ripe body of whole more than 1000 kinds of miRNAs of choosing simultaneously carries out the PCR experiment.The result is shown in Fig. 4 A and Fig. 4 B.The amount of miRNA has the mediation of going up downward modulation respectively with respect to the ratio of normal people's amount in osteosarcoma and the diabetic serum, and same tissue-derived miRNA intensity of variation difference in various disease, show that the blood serum miRNA has specific variations in various disease, they can be used as the marker of the new medical diagnosis on disease of a class.

Embodiment 3 is used for the blood serum miRNA chip of diagnosing mammary cancer

The chip operation flow process is:

(1) extract total RNA in the blood serum, the denaturing formaldehyde gel electrophoresis detects the quality of total RNA;

(2) separation of miRNA: get 50-100 μ g total RNA Ambion ' s miRNA Isolation Kit (Cat#.1560) and separate miRNA;

(3) fluorescent mark of miRNA sample: utilize T4 RNA ligase enzyme marking method to carry out fluorescent mark, and then, be used for chip hybridization after drying up with the dehydrated alcohol precipitation;

(4) hybridization and cleaning: RNA is dissolved in (15% methane amide in the 16 μ L hybridization solutions; 0.2%SDS; 3 * SSC; 50 * Denhardt ' s solution), spend the night in 42 ℃ of hybridization.After hybridization finishes, contain 0.2%SDS earlier about 42 ℃, washed in the liquid of 2 * SSC 4 minutes, then room temperature was washed 4 minutes in 0.2 * SSC liquid, promptly can be used for scanning after slide dries;

(5) chip scanning: chip scans with LuxScan 10K/A two channels laser scanner;

(6) data extract and analysis: adopt the LuxScan3.0 image analysis software that chip image is analyzed, picture signal is converted into numerary signal, analyze with SAM at last and select difference expression gene.

The class blood serum miRNA probe that the differential expression degree under mammary cancer and normal physiological state of quantitative PCR technique and biochip technology double verification is big is used to prepare biochip, and method is the same.This chip is compared with traditional die, and manufacture craft and operating process do not have significant improvement, but this chip has been simplified probe library, will significantly reduce the cost of manufacture and the production time of chip thus, is easy to preparation.The specific aim and the practicality of chip have also been increased simultaneously.With the practice of this chip input, only need patient's blood serum and just can find disease in early days without any need for other tissue, help to instruct and diagnose and treat.

Embodiment 4 is used for the minuteness ribonucleic acid reagent kit of breast cancer diagnosis and prediction

Be used for the diagnosis of mammary cancer, the generation of disease complication and the prediction of recurrence, therapeutic evaluation, and the manufacture craft and the operating process of the minuteness ribonucleic acid reagent kit of the screening of active constituents of medicine, evaluating drug effect are based on solexa sequencing technologies and biochip technology.

Present embodiment at first adopts the solexa sequencing technologies to detect the expression of mammary cancer patient and normal control women blood serum miRNA, and all detect the comfortable hospital of sample standard deviation and are diagnosed as patient with breast cancer and equity age and other normal people of homogeny (contrast).The expression of breast cancer disease human serum miRNA changes as shown in table 1.By table 1 as seen, the breast cancer disease philtrum has the expression of 16 kinds of microRNA and healthy physiognomy than considerable change takes place, and simultaneously, the mammary cancer that shifts takes place and the variation tendency that the breast cancer disease human serum miRNA of transfer takes place is consistent substantially.

In sum, we have filtered out 16 kinds of blood serum miRNAs that can carry out the breast cancer diagnosis assessment.The blood serum miRNA that more than can be used for breast cancer diagnosis and assessment can be prepared into chip, simultaneously, also can adopt the fluorescence real-time quantitative PCR method, detect the above blood serum miRNA, as test kit, be used for the diagnosis of mammary cancer.Test kit comprises reagent such as a collection of blood serum miRNA primer, Taq enzyme, dNTP.

Above chip and test kit can be used to diagnose and/or differentiate the curative effect of mammary cancer and assessment breast cancer treatment medicine, the activity that can be used for screening the breast cancer treatment medicine simultaneously; Also can carry out the prediction of mammary cancer complication and breast cancer relapse.

The expression of table 1 breast cancer disease human serum miRNA changes

8?	has-miR-375?	24?	82?	75?
					9?	has-miR-378?	149?	14?	16?
10?	has-miR-151-3p?	18?	163?	81?
					11?	has-miR-423-3p?	26?	82?	102?
12?	has-miR-409-3p?	7?	53?	33?
					13?	has-miR-483-5p?	513?	19?	39?
14?	has-miR-486-5p?	9509?	22851?	22885?
					15?	has-miR-629?	3?	22?	34?
16?	has-miR-1307?	26?	44?	55?

 

Claims (14)

1. breast cancer detection marker, it is characterized in that described marker comprise following in human serum/blood plasma in stable existence and the ripe body of detectable miRNA any one or more than one:

MiR-22, miR-23a, miR-25, miR-92a, miR-10a, miR-199b-3p, miR-206, miR-375, miR-378, miR-151-3p, miR-423-3p, miR-409-3p, miR-483-5p, miR-486-5p, miR-629 or miR-1307.

2. breast cancer detection marker according to claim 1 is characterized in that, described marker comprise following in human serum/blood plasma in the ripe body of stable existence and detectable miRNA any two or more:

MiR-22, miR-23a, miR-25, miR-92a, miR-10a, miR-199b-3p, miR-206, miR-375, miR-378, miR-151-3p, miR-423-3p, miR-409-3p, miR-483-5p, miR-486-5p, miR-629 and miR-1307.

3. breast cancer detection marker according to claim 1 and 2 is characterized in that described blood serum derives from human body live body, tissue, organ and/or corpse.

4. the detection method of any described certification mark thing of claim 1 to 3 is characterized in that being selected from RT-PCR method, real time fluorescent quantitative poly chain reaction method, Northern blot hybridization method, rnase protection analysis method, Solexa sequencing technologies or biochip method.

5. according to the described detection method of claim 4, it is characterized in that described RT-PCR method may further comprise the steps:

1) extraction experimenter's the total RNA of blood serum obtains the cDNA sample by the RNA reverse transcription reaction; Perhaps collect experimenter's blood serum sample, carry out reverse transcription reaction with blood serum as damping fluid and prepare the cDNA sample;

2) carry out the PCR reaction with miRNA design primer;

3) carry out the agarose gel electrophoresis of PCR product;

4) EB dyeing back observations under ultraviolet lamp.

6. according to the described detection method of claim 4, it is characterized in that described Real-time PCR method may further comprise the steps:

1) extraction experimenter's the total RNA of blood serum obtains the cDNA sample by the RNA reverse transcription reaction; Perhaps collect experimenter's blood serum sample, carry out reverse transcription reaction with blood serum as damping fluid and prepare the cDNA sample;

2) design primer with miRNA;

3) add fluorescent probe and carry out the PCR reaction;

4) detection and comparison blood serum sample are with respect to the variation of the amount of miRNA in normal serum/blood plasma.

7. the method for a prediction, diagnosis and/or evaluating breast cancer, it is characterized in that described method comprise detect in stable existence in following human serum/blood plasma and the detectable miRNA maturation body any one or more than one:

MiR-22, miR-23a, miR-25, miR-92a, miR-10a, miR-199b-3p, miR-206, miR-375, miR-378, miR-151-3p, miR-423-3p, miR-409-3p, miR-483-5p, miR-486-5p, miR-629 or miR-1307.

8. claim 1 or 2 described certification mark things are in preparation prediction, diagnosis, discriminating and/or the reagent of evaluating breast cancer or the application in the instrument.

9. a miRNA probe combinations that is used to detect the breast cancer detection marker is characterized in that, described combination comprise in the following probe sequence any one or more than one:

miRNA Probe sequence Sequence numbering

has-miR-22 ACAGTTCTTCAACTGGCAGCTT SEQ?ID?NO.1 has-miR-23a GGAAATCCCTGGCAATGTGAT SEQ?ID?NO.2 has-miR-25 TCAGACCGAGACAAGTGCAATG SEQ?ID?NO.3 has-miR-92a ACAGGCCGGGACAAGTGCAATA SEQ?ID?NO.4 has-miR-10a CACAAATTCGGATCTACAGGGTA SEQ?ID?NO.5 has-miR-199b- 3p TAACCAATGTGCAGACTACTGT SEQ?ID?NO.6 has-miR-206 CCACACACTTCCTTACATTCCA SEQ?ID?NO.7 has-miR-375 TCACGCGAGCCGAACGAACAAA SEQ?ID?NO.8 has-miR-378 CCTTCTGACTCCAAGTCCAGT SEQ?ID?NO.9 has-miR-151-3p CCTCAAGGAGCTTCAGTCTAG SEQ?ID?NO.10 has-miR-423-3p ACTGAGGGGCCTCAGACCGAGCT SEQ?ID?NO.11 has-miR-409-3p AGGGGTTCACCGAGCGGCATTC SEQ?ID?NO.12 has-miR-483-5p CTCCCTTCTTTCCTCCCGTCTT SEQ?ID?NO.13 has-miR-486-5p CTCGGGGCAGCTCAGTACACGGA SEQ?ID?NO.14 has-miR-629 AGTTCTCCCAACGTAAACCCA SEQ?ID?NO.15 has-miR-1307 CACGACCGACGCCACGCCGAGT SEQ?ID?NO.16

10. a test kit that is used to detect the breast cancer marker thing is characterized in that, described test kit comprises the instrument that test right requires 1 or 2 described markers.

11. test kit according to claim 10 is characterized in that described instrument comprises the described probe combinations of claim 9.

12. test kit according to claim 11 is characterized in that described instrument also comprises archaeal dna polymerase and/or deoxyribonucleotide mixture.

13. a biochip that is used to detect mammary cancer is characterized in that described biochip comprises the element that test right requires each described marker in 1 or 2.

14. biochip according to claim 13 is characterized in that the element of described biochip comprises the described probe combinations of claim 9.

Images