WO2022243836A1 - Diagnostic biomarker for inflammatory myopathy - Google Patents

Diagnostic biomarker for inflammatory myopathy Download PDF

Info

Publication number
WO2022243836A1
WO2022243836A1 PCT/IB2022/054525 IB2022054525W WO2022243836A1 WO 2022243836 A1 WO2022243836 A1 WO 2022243836A1 IB 2022054525 W IB2022054525 W IB 2022054525W WO 2022243836 A1 WO2022243836 A1 WO 2022243836A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
myositis
ratio
plasma
indicates
Prior art date
Application number
PCT/IB2022/054525
Other languages
French (fr)
Inventor
Miriam CAPRI
Cristina MORSIANI
Giovanna CENACCHI
roberta costa
Rita RINALDI
Original Assignee
Alma Mater Studiorum - Universita' Di Bologna
Irccs Azienda Ospedaliero - Universitaria Di Bologna
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alma Mater Studiorum - Universita' Di Bologna, Irccs Azienda Ospedaliero - Universitaria Di Bologna filed Critical Alma Mater Studiorum - Universita' Di Bologna
Publication of WO2022243836A1 publication Critical patent/WO2022243836A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/165—Mathematical modelling, e.g. logarithm, ratio
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to a diagnostic method for establishing whether an individual suffers from an inflammatory myopathy, and a kit for implementing said method.
  • Idiopathic inflammatory myopathies also known as myositis
  • myositis are a group of rare diseases (an incidence of 5-10 cases/year/million inhabitants and a prevalence of 50-100 cases/million inhabitants) characterised by muscle pain and weakness associated with lymphocyte infiltration in the muscle tissue.
  • the cause of said diseases is not yet fully understood; numerous findings suggest an autoimmune component and a probable genetic predisposition, which may be overlaid with environmental, infectious or toxic factors.
  • IIMs comprise dermatomyositis (DM), polymyositis (PM), necrotising myopathy (NM) and inclusion body myositis (IBM).
  • DM dermatomyositis
  • PM polymyositis
  • NM necrotising myopathy
  • IBM inclusion body myositis
  • the common feature of said conditions is the presence of muscle pain and weakness, increased creatine kinase, the presence of electromyographic signs of muscle damage with spontaneous activity, and alterations in the muscle signal on magnetic resonance. They are distinguished from one another on the basis of clinical factors (extent and distribution of weakness, involvement of other organs/tissues) and laboratory findings (presence of autoantibodies), response to treatment, and specific histopathological aspects [1, 2, 3]
  • the diagnosis is based on Bohan and Peter’s criteria (1975) [4], reviewed in the new 2017 EULAR/ACR classification [5, 6], which use muscle biopsy as the crucial method in the diagnostic process because it not only defines the diagnosis, distinguishing between myositis and hereditary myopathies, but also differentiates between the various clinical/pathological syndromes.
  • DM the alterations are mainly found in the endomysial and perimysial capillary structures, leading to immune complex deposition in the endothelium, which gives rise to complement activation and therefore cell lysis [7] and perifascicular atrophy.
  • the cell infiltrate consists of macrophages and CD8+ cytotoxic lymphocytes, which can surround and invade non-necrotic muscle fibres.
  • MHC-I major histocompatibility complex
  • IBM which is considered to be the most frequent acquired myopathy over the age of 50, is also diagnosed on the basis of clinical and histopathological criteria [2, 9]
  • the muscle biopsy exhibits inflammatory aspects similar to those of PM, which are associated with degenerative aspects.
  • the degenerative component is represented by the presence of rimmed vacuoles and intracellular deposit of b-amyloid and various proteins such as p-tau, presenilin 1, apolipoprotein, g-tubulin, clusterin, a-synuclein and gelsolin [10]
  • This form in particular represents a challenge, due to the complexity of its pathogenetic mechanism and the absence of a specific treatment.
  • miRs are critical regulators of cytokine-mediated inflammation and myoblast (satellite cell) differentiation (MiRs-1, 133a, 133b and 206) [12]
  • miRs-1, 133a, 133b and 206 Some recent findings in the literature indicate alterations in the expression of miRs in the biopsies of myositis patients, with consequent inhibition of myogenic differentiation and therefore a regenerative deficiency, the biological substrate of muscle weakness.
  • miRs circulating in myositis patients [13, 14, 15] has already been investigated to further understanding of the pathogenetic mechanism, suggesting that their identification may be useful for diagnosis.
  • a diagnostic method based on circulating miRs has now been found which provides a rapid, easily analysis method in support of clinical findings.
  • an index based on the ratio between miR-206 and miR-409-3p measured in plasma has been identified, which discriminates between myositis patients and non-myositis patients (i.e. patients suffering from other muscle disorders involving similar clinical symptoms).
  • the object of the invention is therefore an in vitro method for diagnosis of inflammatory myopathies in an individual which comprises: a) determination of the ratio between the amounts of miR-206 and miR-409- 3p measured in a plasma sample from the individual; b) comparison of the miR-206/miR-409-3p ratio determined in step a), with a threshold value discriminating between myositis patients and non-myositis patients.
  • the discriminant threshold value can be obtained from statistical analysis of a population of individuals with a positive or negative diagnosis of myositis, for example by means of an ROC curve .
  • the amount of miR-206 and miR-409-3p can be determined by known methods, such as quantitative RT-PCR on total RNA extracted from plasma, using an exogenous spike-in as normalizer.
  • a second aspect of the invention relates to a kit for diagnosis of inflammatory myopathies which comprises reagents for extracting RNA from plasma, oligonucleotides complementary to miR-206 and miR-409-3p, and reagents for quantitative RT-PCR.
  • a further aspect of the invention relates to use of the miR-206/miR-409-3p ratio as biomarker for inflammatory myopathies.
  • the method forming the object of the invention is more advantageous than the existing methods, which are complex and non-specific, because after formulation of a diagnostic suspicion, numerous tests are usually conducted, including electromyography, biochemical blood tests, magnetic resonance and muscle biopsy, a method which is still considered the gold standard.
  • the procedure therefore involves high costs and lengthy diagnosis times, thus preventing rapid application of a specific, effective treatment protocol, which represents a major advantage for the patient.
  • the method according to the invention which can be implemented at the beginning of the diagnostic process, enables myositis to be identified or ruled out rapidly, thereby accelerating the diagnosis and consequently the start of treatment.
  • the method according to the invention also provides a considerable cost saving, because the current diagnostic process is expensive in view of the multiple tests required.
  • blood was drawn into a test tube with EDTA anticoagulant for harvesting of whole blood and subsequent plasma separation.
  • the samples were processed within 2 hours of drawing, and centrifuged at 2000xg for 20 minutes at 4°C.
  • the plasma harvested was aliquoted and stored at -80°C.
  • the miR-409-3p and miR-206 sequences are shown below: hsa-miR-409-3p: GAAUGUUGCUCGGUGAACCCCU (SEQ ID 1) hsa-miR-206: UGGAAUGUAAGGAAGUGUGUGG (SEQ ID 2).
  • the relative expression of the two miRs was used to obtain an index based on the ratio of the two miRs with miR-206 as numerator and miR-409-3p as denominator (mir-206/miR-409-3p), which significantly discriminates between myositis patients, non myositis patients and controls.
  • the value of the miR-206/miR-409-3p ratio was measured in the plasma of the subjects in the various study groups: 10 myositis patients, 5 non-myositis patients (suffering from other muscle disorders) and 30 control subjects. The data are displayed as boxplots (with median value). The difference between groups was evaluated with the non- parametric Kruskal-Wallis test, and the differences are considered significant when p value ⁇ 0.05 (* p ⁇ 0.05; ** p ⁇ 0.01).
  • the analysis was conducted to establish the quality of the proposed diagnostic index in discriminating between myositis and non-myositis patients.
  • the analysis was conducted on the values of the ratio between the two miRs (miR-206/miR-409-3p) measured on 10 myositis and 5 non-myositis patients.
  • the area under the curve was equal to 1, the maximum value, identifying a threshold value of 1.94 with 100% sensitivity and specificity in discriminating between the two groups.
  • the ratio of the two miRs differed significantly between the study groups, especially between the myositis and non-myositis patients, and between them and the control group, as shown in Figure 1.
  • the data were used to analyse the ROC curve in order to identify the specificity and sensitivity of the index identified (ratio between the two miRs, namely miR-206/miR- 409-3p) as diagnostic biomarker to distinguish between myositis and non-myositis patients.
  • the analysis results are set out in Figure 2.
  • the area under the curve (AUC) proved to be equal to 1, the maximum value obtainable, and the threshold value of the index was identified as 1.94, with 100% sensitivity and 100% specificity of the marker, which was able to discriminate between myositis and non-myositis patients.
  • a further bootstrapping data analysis was conducted (to evaluate the possible effect of chance by resampling the samples), as shown in Figure 3.
  • the discriminant threshold value was confirmed to be 1.95, and a range of values outside which there is high confidence in the discriminant value was defined, a “grey” area ranging between 4.11 and 0.96 being demarcated around the threshold value.
  • the patient will be classed as a myositis patient, and below the value of 0.96 will be classed as a non-myositis patient.
  • the value lies between 1.95 and 4.11 the patient may suffer from myositis, but a further check will be required in order to make the diagnosis correctly.
  • values ranging between 0.96 and 1.95 may indicate a non-myositis patient, but further confirmation of the data is required.
  • Table 1 Patients recruited to study with corresponding values of miRs shown as relative expression and diagnostic index obtained as ratio between the two miRs
  • miRNA may be associated with polymyositis/dermatomyositis. Inflamm Regen. 2018 Jan 8;38:1. doi: 10.1186/s41232-017-0058-l.

Abstract

Disclosed is a diagnostic method for inflammatory myopathies which uses as biomarker the ratio between the amounts of miR-206 and miR-409-3p present in plasma.

Description

DIAGNOSTIC BIOMARKER FOR INFLAMMATORY MYOPATHY
The present invention relates to a diagnostic method for establishing whether an individual suffers from an inflammatory myopathy, and a kit for implementing said method.
State of the art
Idiopathic inflammatory myopathies (IIMs), also known as myositis, are a group of rare diseases (an incidence of 5-10 cases/year/million inhabitants and a prevalence of 50-100 cases/million inhabitants) characterised by muscle pain and weakness associated with lymphocyte infiltration in the muscle tissue. The cause of said diseases is not yet fully understood; numerous findings suggest an autoimmune component and a probable genetic predisposition, which may be overlaid with environmental, infectious or toxic factors.
IIMs comprise dermatomyositis (DM), polymyositis (PM), necrotising myopathy (NM) and inclusion body myositis (IBM). The common feature of said conditions is the presence of muscle pain and weakness, increased creatine kinase, the presence of electromyographic signs of muscle damage with spontaneous activity, and alterations in the muscle signal on magnetic resonance. They are distinguished from one another on the basis of clinical factors (extent and distribution of weakness, involvement of other organs/tissues) and laboratory findings (presence of autoantibodies), response to treatment, and specific histopathological aspects [1, 2, 3]
The diagnosis is based on Bohan and Peter’s criteria (1975) [4], reviewed in the new 2017 EULAR/ACR classification [5, 6], which use muscle biopsy as the crucial method in the diagnostic process because it not only defines the diagnosis, distinguishing between myositis and hereditary myopathies, but also differentiates between the various clinical/pathological syndromes. In DM, the alterations are mainly found in the endomysial and perimysial capillary structures, leading to immune complex deposition in the endothelium, which gives rise to complement activation and therefore cell lysis [7] and perifascicular atrophy. In PM, the cell infiltrate consists of macrophages and CD8+ cytotoxic lymphocytes, which can surround and invade non-necrotic muscle fibres. A crucial role in the interaction between muscle fibre and immune cells appears to be played by the major histocompatibility complex (MHC-I), which is upregulated by muscle fibre under pro-inflammatory conditions [8] IBM, which is considered to be the most frequent acquired myopathy over the age of 50, is also diagnosed on the basis of clinical and histopathological criteria [2, 9] The muscle biopsy exhibits inflammatory aspects similar to those of PM, which are associated with degenerative aspects. The degenerative component is represented by the presence of rimmed vacuoles and intracellular deposit of b-amyloid and various proteins such as p-tau, presenilin 1, apolipoprotein, g-tubulin, clusterin, a-synuclein and gelsolin [10] This form in particular represents a challenge, due to the complexity of its pathogenetic mechanism and the absence of a specific treatment.
The identification of new biological molecular markers could improve both diagnostic efficiency and the development of new therapeutic approaches. The state of the art regarding the pathogenesis of myositis confirms the idea that there is a common chronic antigen-stimulated inflammatory component giving rise to progressive deterioration of the muscle weakness. In-depth analysis of pathways and critical molecules in the relationship between inflammation and degeneration may hold the key to understanding the progression of the disease. In particular, microRNAs (miRs) [11] are critical regulators of cytokine-mediated inflammation and myoblast (satellite cell) differentiation (MiRs-1, 133a, 133b and 206) [12] Some recent findings in the literature indicate alterations in the expression of miRs in the biopsies of myositis patients, with consequent inhibition of myogenic differentiation and therefore a regenerative deficiency, the biological substrate of muscle weakness. In addition, altered expression of miRs circulating in myositis patients [13, 14, 15] has already been investigated to further understanding of the pathogenetic mechanism, suggesting that their identification may be useful for diagnosis.
Description of the invention
A diagnostic method based on circulating miRs has now been found which provides a rapid, easily analysis method in support of clinical findings. In particular, an index based on the ratio between miR-206 and miR-409-3p measured in plasma has been identified, which discriminates between myositis patients and non-myositis patients (i.e. patients suffering from other muscle disorders involving similar clinical symptoms).
In a first aspect thereof, the object of the invention is therefore an in vitro method for diagnosis of inflammatory myopathies in an individual which comprises: a) determination of the ratio between the amounts of miR-206 and miR-409- 3p measured in a plasma sample from the individual; b) comparison of the miR-206/miR-409-3p ratio determined in step a), with a threshold value discriminating between myositis patients and non-myositis patients.
The discriminant threshold value can be obtained from statistical analysis of a population of individuals with a positive or negative diagnosis of myositis, for example by means of an ROC curve .
The amount of miR-206 and miR-409-3p can be determined by known methods, such as quantitative RT-PCR on total RNA extracted from plasma, using an exogenous spike-in as normalizer.
A second aspect of the invention relates to a kit for diagnosis of inflammatory myopathies which comprises reagents for extracting RNA from plasma, oligonucleotides complementary to miR-206 and miR-409-3p, and reagents for quantitative RT-PCR.
A further aspect of the invention relates to use of the miR-206/miR-409-3p ratio as biomarker for inflammatory myopathies.
The method forming the object of the invention is more advantageous than the existing methods, which are complex and non-specific, because after formulation of a diagnostic suspicion, numerous tests are usually conducted, including electromyography, biochemical blood tests, magnetic resonance and muscle biopsy, a method which is still considered the gold standard. The procedure therefore involves high costs and lengthy diagnosis times, thus preventing rapid application of a specific, effective treatment protocol, which represents a major advantage for the patient.
The method according to the invention, which can be implemented at the beginning of the diagnostic process, enables myositis to be identified or ruled out rapidly, thereby accelerating the diagnosis and consequently the start of treatment.
The method according to the invention also provides a considerable cost saving, because the current diagnostic process is expensive in view of the multiple tests required.
Detailed description of the invention
Patients suffering from suspected inflammatory myopathy were recruited, after approval of the study by the local Ethics Committee.
For each patient, blood was drawn into a test tube with EDTA anticoagulant for harvesting of whole blood and subsequent plasma separation. The samples were processed within 2 hours of drawing, and centrifuged at 2000xg for 20 minutes at 4°C. The plasma harvested was aliquoted and stored at -80°C.
Analysis of the miRs was conducted on the plasma samples, with a first stage of RNA extraction. From 100 pi of plasma, total RNA was extracted with the Total RNA Purification kit (NorgenBiotek Corp.). RNA was then used to analyse the miRs, applying Taqman technology (Thermo Fisher Scientific), which involves miR-specific reverse transcription and subsequent amplification in quantitative or real-time reverse transcription PCR (RT-qPCR).
Relative expression was calculated using cel-miR-39 (synthetic spike-in introduced during the stage of RNA extraction from the plasma sample) as reference miR, calculating delta Ct (ACt = CtmiR x- Ctcei-miR-39) and subsequently 2~ACt according to the standard procedures. The miR-409-3p and miR-206 sequences are shown below: hsa-miR-409-3p: GAAUGUUGCUCGGUGAACCCCU (SEQ ID 1) hsa-miR-206: UGGAAUGUAAGGAAGUGUGUGG (SEQ ID 2).
The relative expression of the two miRs was used to obtain an index based on the ratio of the two miRs with miR-206 as numerator and miR-409-3p as denominator (mir-206/miR-409-3p), which significantly discriminates between myositis patients, non myositis patients and controls.
Description of figures
Figure 1. Index analysed in the three study groups.
The value of the miR-206/miR-409-3p ratio was measured in the plasma of the subjects in the various study groups: 10 myositis patients, 5 non-myositis patients (suffering from other muscle disorders) and 30 control subjects. The data are displayed as boxplots (with median value). The difference between groups was evaluated with the non- parametric Kruskal-Wallis test, and the differences are considered significant when p value < 0.05 (* p < 0.05; ** p < 0.01).
Figure 2: Analysis of ROC curve
The analysis was conducted to establish the quality of the proposed diagnostic index in discriminating between myositis and non-myositis patients. The analysis was conducted on the values of the ratio between the two miRs (miR-206/miR-409-3p) measured on 10 myositis and 5 non-myositis patients. The area under the curve was equal to 1, the maximum value, identifying a threshold value of 1.94 with 100% sensitivity and specificity in discriminating between the two groups.
Figure 3. Bootstrap data analysis
Bootstrapping was conducted to define the values outside which there is a high level of confidence in the discriminant value, whereas for the values around that threshold (1.95) a more cautious evaluation of discrimination is required, in particular in the range of values between 0.96 and 4.11. Experimental part
10 myositis and 5 non-myositis patients were analysed in the study, which also used a control group of 30 healthy volunteers aged between 50 and 80 years. Both miRs were measured for each of said subjects, reported as relative expression from which the value of the ratio between said two miRs was then obtained, which identifies the diagnostic index proposed by us, as shown in Table 1.
The ratio of the two miRs differed significantly between the study groups, especially between the myositis and non-myositis patients, and between them and the control group, as shown in Figure 1.
The data were used to analyse the ROC curve in order to identify the specificity and sensitivity of the index identified (ratio between the two miRs, namely miR-206/miR- 409-3p) as diagnostic biomarker to distinguish between myositis and non-myositis patients. The analysis results are set out in Figure 2. The area under the curve (AUC) proved to be equal to 1, the maximum value obtainable, and the threshold value of the index was identified as 1.94, with 100% sensitivity and 100% specificity of the marker, which was able to discriminate between myositis and non-myositis patients.
A further bootstrapping data analysis was conducted (to evaluate the possible effect of chance by resampling the samples), as shown in Figure 3. The discriminant threshold value was confirmed to be 1.95, and a range of values outside which there is high confidence in the discriminant value was defined, a “grey” area ranging between 4.11 and 0.96 being demarcated around the threshold value. In practice, for an index with a value above 4.11, the patient will be classed as a myositis patient, and below the value of 0.96 will be classed as a non-myositis patient. When the value lies between 1.95 and 4.11 the patient may suffer from myositis, but a further check will be required in order to make the diagnosis correctly. Similarly, values ranging between 0.96 and 1.95 may indicate a non-myositis patient, but further confirmation of the data is required. Table 1. Patients recruited to study with corresponding values of miRs shown as relative expression and diagnostic index obtained as ratio between the two miRs
Figure imgf000008_0001
Figure imgf000009_0002
Figure imgf000009_0001
References
1. Tanboon J, Nishino I. Classification of idiopathic inflammatory myopathies: pathology perspectives. Curr Opin Neurol. 2019 Oct;32(5):704-714. doi:
10.1097/WCO.0000000000000740.
2. Carstens P, Schmidt J. Diagnosis, pathogenesis and treatment of myositis: recent advances. ClinExpImmunol. 2014 Mar; 175(3):349-58. doi: 10.1111/cei.12194.
3. Damoiseaux J, Vulsteke JB, Tseng CW, Platteel ACM, Piette Y, Shovman O, Bonroy C, Hamann D, De Langhe E, Musset L, Chen YH, Shoenfeld Y, Allenbach Y, Bossuyt X. Autoantibodies in idiopathic inflammatory myopathies: Clinical associations and laboratory evaluation by mono- and multispecific immunoassays. Autoimmun Rev. 2019 Mar;18(3):293-305. doi: 10.1016/j.autrev.2018.10.004.
4. Bohan A, Peter JB. Polymyositis and dermatomvositis (second of two parts). N Engl J Med. 1975 Feb 20;292(8):403-7. doi: 10.1056/NEJM197502202920807.
5. Lundberg IE, Tjarnlund A, Bottai M, et al. 2017 European League Against Rheumatism/American College of Rheumatology classification criteria for adult and juvenile idiopathic inflammatory myopathies and their major subgroups. Ann Rheum Dis. 2017;76(12): 1955-1964. doi:10.1136/annrheumdis-2017-211468
6. Leclair V, Lundberg IE. New Myositis Classification Criteria-What We Have Learned Since Bohan and Peter. Curr Rheumatol Rep. 2018 Mar 17;20(4): 18. doi: 10.1007/s 11926-018-0726-4.
7. Kissel JT, Mendell JR, Rammohan KW. Microvascular deposition of complement membrane attack complex in dermatomyositis. N.Engl.J.Med. 1986; 314:329-
34.doi: 10.1056/NEJM198602063140601.
8. Salaroli R, Baldin E, Papa V, Rinaldi R, Tarantino L, De Giorgi LB, Fusconi M, MalavoltaN, Meliconi R, D’ Alessandro R, Cenacchi G. Validity of internal expression of the major histocompatibility complex class I in the diagnosis of inflammatory myopathies. J ClinPathol.2012 Jan;65(l): 14-94. doi: 10.1136/jclinpath-2011-200138.
9. Machado P, Brady S, Hanna MG. Update in inclusion body myositis. CurrOpinRheumatol . 2013 Nov;25(6):763-71.doi: 10.1097/01. bor.0000434671.77891.9a.
10. Askanas V, Engel WK, Nogalska A. Pathogenic considerations in sporadic inclusion body myositis, a degenerative muscle disease associated with aging and abnormalities of myoproteostasis. JNeuropatholExp Neurol. 2012 Aug;71(8):680-93. doi: 10.1097/NEN.0b013e31826183c8.
11. Olivieri F, Rippo MR, Monsurro V, Salvioli S, Capri M, Procopio AD, Franceschi C. MicroRNAs linking inflamm-aging, cellular senescence and cancer. Ageing Res Rev. 2013 Sep; 12(4): 1056-68.doi: 10.1016/j.arr.2013.05.001.
12. Georgantas RW Streicher K. Greenberg SA. Greenlees L. Zhu W Brohawn P Higgs BW Czapi a M. Morehouse C Amato A. Richman L. Jallal B. Yao Y. Ranade K. Inhibition of myogenic MicroRNAs-1, 133, and 206 by inflammatory cytokines links inflammation and muscle degeneration in adult inflammatory myopathies. Arthritis Rheumatol. 2014 Apr;66(4): 1022-33. doi: 10.1002/art.38292.
13. Shimada S, Jinnin M, Ogata A, Makino T, Kajihara I, Makino K, Honda N, Nakayama W, Inoue K, Fukushima S, Ihn H. Serum miR-21 levels in patients with dermatomyositis. ClinExpRheumatol. 2013 Jan-Feb;31(1): 161-2.
14. Hirai T, Ikeda K, Tsushima H, Fujishiro M, Hayakawa K, Yoshida Y, Morimoto S, Yamaji K, Takasaki Y, Takamori K, Tamura N, Sekigawa I. Circulating plasma microRNA profiling in patients with polymyositis/dermatomyositis before and after treatment: miRNA may be associated with polymyositis/dermatomyositis. Inflamm Regen. 2018 Jan 8;38:1. doi: 10.1186/s41232-017-0058-l.
15. Ye L, Zuo Y, Yang H, Li W, Peng Q, Lu X, Wang G, Shu X. Specific Autoantibodies and Clinical Phenotypes Correlate with the Aberrant Expression of Immune-Related MicroRNAs in Dermatomyositis. J Immunol Res. 2019 Feb 19;2019:2927061. doi: 10.1155/2019/2927061.

Claims

1. An in vitro method for diagnosing inflammatory myopathies in a subject that includes: a) determination of the ratio between the amounts of miR-206 and miR-409- 3p measured in a plasma sample of the subject; b) comparison of the miR-206/miR-409-3p ratio determined in step a) with a discriminant threshold value between myositis and non-myositis subjects.
2. A method according to claim 1, wherein the discriminant threshold value is obtained from statistical analysis of a population of subjects with a positive or negative diagnosis of myositis.
3. A method according to claim 2, wherein said statistical analysis is carried out by means of the ROC curve.
4. A method according to claims 2 and 3, wherein the discriminant threshold value is selected from 0.96; 1.95 and 4.11, wherein:
- a miR-206/miR-409-3p ratio in the subject under examination greater than 4.11 indicates the presence of myositis;
- a miR-206/miR-409-3p ratio in the subject under examination ranging between 1.95 and 4.11 indicates a high risk of the presence of myositis;
- a miR-206/miR-409-3p ratio in the subject under examination ranging between 0.96 and 1.95 indicates a low risk of the presence of myositis;
- a miR-206/miR-409-3p ratio in the subject under examination of less than 0.96 indicates the absence of myositis.
5. A method according to any one of claims 1 to 4 wherein the amount of miR-206 and miR-409-3p is determined by quantitative RT-PCR on total RNA extracted from plasma.
6. Method according to claim 5, wherein said RT-PCR is carried out with an exogenous spike-in as normalizer.
7. A kit for the diagnosis of inflammatory myopathies that includes reagents for extraction of RNA from plasma, oligonucleotides complementary to miR-206 and miR-409-3p, and reagents for quantitative RT-PCR.
8. Use of the miR-206/miR-409-3p ratio as a biomarker for inflammatory myopathies.
PCT/IB2022/054525 2021-05-17 2022-05-16 Diagnostic biomarker for inflammatory myopathy WO2022243836A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IT102021000012572A IT202100012572A1 (en) 2021-05-17 2021-05-17 DIAGNOSTIC BIOMARKER OF INFLAMMATORY MYOPATHY
IT102021000012572 2021-05-17

Publications (1)

Publication Number Publication Date
WO2022243836A1 true WO2022243836A1 (en) 2022-11-24

Family

ID=77519488

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2022/054525 WO2022243836A1 (en) 2021-05-17 2022-05-16 Diagnostic biomarker for inflammatory myopathy

Country Status (2)

Country Link
IT (1) IT202100012572A1 (en)
WO (1) WO2022243836A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101988061A (en) * 2009-07-30 2011-03-23 江苏命码生物科技有限公司 Breast cancer detecting marker as well as detecting method, kit and biological chip thereof
US20150275299A1 (en) * 2012-07-25 2015-10-01 Rush University Medical Center miRNAs as Novel Therapeutic Targets and Diagnostic Biomarkers for Parkinsons Disease

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101988061A (en) * 2009-07-30 2011-03-23 江苏命码生物科技有限公司 Breast cancer detecting marker as well as detecting method, kit and biological chip thereof
US20150275299A1 (en) * 2012-07-25 2015-10-01 Rush University Medical Center miRNAs as Novel Therapeutic Targets and Diagnostic Biomarkers for Parkinsons Disease

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HIRAI TAKUYA ET AL: "Circulating plasma microRNA profiling in patients with polymyositis/dermatomyositis before and after treatment: miRNA may be associated with polymyositis/dermatomyositis", vol. 38, no. 1, 8 January 2018 (2018-01-08), pages 1 - 9, XP055885798, Retrieved from the Internet <URL:http://link.springer.com/content/pdf/10.1186/s41232-017-0058-1.pdf> DOI: 10.1186/s41232-017-0058-1 *
LU XIN ET AL: "Discovery of new biomarkers of idiopathic inflammatory myopathy", CLINICA CHIMICA ACTA, ELSEVIER BV, AMSTERDAM, NL, vol. 444, 11 February 2015 (2015-02-11), pages 117 - 125, XP029149586, ISSN: 0009-8981, DOI: 10.1016/J.CCA.2015.02.007 *
PARKES JOANNA E. ET AL: "MicroRNA and mRNA profiling in the idiopathic inflammatory myopathies", vol. 4, no. 1, 10 June 2020 (2020-06-10), XP055885785, Retrieved from the Internet <URL:https://link.springer.com/article/10.1186/s41927-020-00125-8/fulltext.html> DOI: 10.1186/s41927-020-00125-8 *
PARKES JOANNA: "An Investigation of Mechanisms Involved in the Pathogenesis and Progression of the Idiopathic Inflammatory Myopathies", 31 December 2018 (2018-12-31), XP055885812, Retrieved from the Internet <URL:https://www.research.manchester.ac.uk/portal/files/156331220/FULL_TEXT.PDF> [retrieved on 20220201] *

Also Published As

Publication number Publication date
IT202100012572A1 (en) 2022-11-17

Similar Documents

Publication Publication Date Title
US20180258488A1 (en) Methods of detecting diseases or conditions using phagocytic cells
JP2021074011A (en) Methods for detecting signatures of disease or conditions in bodily fluids
US9732388B2 (en) Nucleic acid markers for rapid diagnosis of kawasaki disease and kit for detection of the nucleic acid markers
EP3115467B1 (en) Method for assisting detection of pancreatic cancer
CN106868106B (en) Prenatal diagnostic methods using digital PCR
AU2009200813A1 (en) Methods and compositions for analysis of urine samples in the diagnosis and treatment of kidney diseases
WO2015123565A1 (en) Methods for diagnosing igg4-related disease
US11840742B2 (en) Method for detecting active tuberculosis
EP2142675A2 (en) Diagnostic of immune graft tolerance
CN110373457B (en) mRNA marker for ulcerative colitis diagnosis and application thereof
US20190390275A1 (en) Chronic kidney disease diagnostic
CN109811051B (en) miR-548o-3p molecular marker derived from plasma exosomes and tuberculosis detection kit thereof
WO2022243836A1 (en) Diagnostic biomarker for inflammatory myopathy
CN111944894B (en) Molecular marker for prenatal noninvasive diagnosis of cleft lip and palate, neural tube malformation and congenital heart disease and application thereof
US7811752B2 (en) Plasma or serum marker and process for detection of cancer
CN111944893A (en) MiRNA molecular marker related to prenatal noninvasive diagnosis of cleft lip and palate and application thereof
CN109825596B (en) Internal reference miRNA of esophageal cancer sample and application thereof
JP7473941B2 (en) Method and kit for assisting in the diagnosis of mesothelioma
CN108220427B (en) Plasma microRNA marker for differential diagnosis of BHD syndrome and primary spontaneous pneumothorax and application
WO2023120524A1 (en) Method for screening tuberculosis-infected sample and probe set to be used therefor
EP3699300A1 (en) Seminal mirnas as non-invasive biomarkers for the diagnosis and/or prognosis of prostate cancer
KIDNEY U. RENAL TRANSPLANTATION. EXPERIMENTAL, IMMUNE-TOLERANCE OF ALLOGENIC AND XENOGENIC TRANSPLANTS
CN117512110A (en) Application of PD-L1 as molecular marker in preparation of auxiliary diagnostic kit for myeloproliferative neoplasm
AU2020243564A1 (en) Method for predicting proangiogenic potential of extracellular vesicles (EVS)
CN117802239A (en) Prostate cancer diagnosis marker and method for constructing prostate cancer risk prediction model and nomogram based on same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22748064

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE