CN115948407A - Pseudomonas syringae kiwi fruit pathogenic variety aptamer, screening method and application - Google Patents

Abstract

The invention discloses a pseudomonas syringae kiwi fruit pathogenic variant aptamer which is characterized in that the aptamer is an aptamer of Seq1245, the nucleotide sequence of the aptamer is shown as SEQ ID NO.1, the PSA aptamer screened by a SELEX method is used for constructing a DNA molecular beacon, and the PSA aptamer is used for detecting PSA-based kiwi fruit canker by a Fluorescence Resonance Energy Transfer (FRET) method.

Description

Pseudomonas syringae kiwi fruit pathogenic variety aptamer, screening method and application

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to an aptamer of pseudomonas syringae kiwi fruit pathogenic variety, a screening method and application.

Background

Pseudomonas syringae kiwi pathogenic variant (Pseudomonas syringaepraepv. Actinidiae, PSA) is a pathogenic bacterium causing kiwifruit canker. Kiwifruit canker is one of the most devastating diseases in the Kiwifruit planting process. The disease was first reported in japan in 1980, and then in the united states, korea, new zealand, france, spain, italy, iran, etc. there were reports related to the disease. When the canker disease caused by kiwifruit canker occurs, the whole kiwifruit tree withers to death, which causes the destruction of the orchard, no particle harvest and serious damage to the yield and quality.

In order to reduce the occurrence of kiwifruit canker and loss of orchards, the detection of PSA causing kiwifruit canker is an indispensable means. The traditional pathogenic bacteria detection method depends on means such as symptom observation, colony counting and the like, is greatly influenced by external environment and individual operators, and once the disease symptoms are found by naked eyes, the disease is very serious and is difficult to control. However, the existing PSA detection methods still have the disadvantages of low accuracy, low sensitivity, and slow detection speed, so that a PSA detection method capable of overcoming the disadvantages is needed.

The aptamer is a short oligonucleotide sequence or a short polypeptide which can be obtained by screening through an in vitro screening technology (ligand phylogeny technology of exponential enrichment, SELEX) and has strong affinity and high specificity on a specific target substance. The aptamer has wide target molecule range, can recognize targets such as ions, inorganic and organic micromolecules, proteins, living cells and the like, has good recognition capability on the proteins, and has high affinity and specificity which can be compared with antibodies.

Based on this, the present application proposes a method for detecting PSA using a nucleic acid aptamer.

Disclosure of Invention

In order to solve the technical problems, the invention provides an aptamer of pseudomonas syringae kiwi fruit pathogenic variety, a screening method and application thereof.

In order to achieve the technical effects, the invention is realized by the following technical scheme: an aptamer of Pseudomonas syringae kiwi fruit pathogenic variant is the aptamer of Seq1245, and the nucleotide sequence of the aptamer is shown as SEQ ID NO.1;

a screening method of pseudomonas syringae kiwi fruit pathogenic variant aptamers specifically comprises the steps of taking kiwi fruit ulcer bacteria as a target, screening candidate aptamers combined with the target from a single-stranded DNA library by adopting a SELEX method, and screening aptamers with high affinity and high specificity with the kiwi fruit ulcer bacteria from the candidate aptamers;

a method for detecting kiwi fruit canker PSA by using the aptamer specifically comprises the following steps:

s1, screening by the method to obtain an aptamer with high affinity and high specificity, and designing a DNA molecular beacon according to the aptamer, wherein the method specifically comprises the following steps: an aptamer for introducing a fluorescent group, a quenching group and PSA through reasonable modification of DNA at a proper position;

s2, opening a stem area and an annular area after the PSA aptamer is combined with a target object on bacteria, and rapidly generating fluorescence;

further, designing a DNA molecular beacon comprising a circular region, a stem region, a fluorescent group, a quenching group and a PSA aptamer in S1;

the invention has the beneficial effects that:

according to the invention, the PSA aptamer screened by the SELEX method is used for constructing the DNA molecular beacon, and the PSA-based kiwifruit canker is detected by a Fluorescence Resonance Energy Transfer (FRET) method.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a schematic representation of the molecular beacon design of the present invention;

FIG. 2 is a graph showing fluorescence intensity analysis of three DNA sequences bound to Actinidia kiwii canker in example 1 of the present invention, wherein (a) is blank control, (b) is Seq4201, (c) is Seq1245, and (d) is Seq 1864;

FIG. 3 is a graph of affinity profiling of Seq1245 binding to Actinidia kiwii;

FIG. 4 is a diagram showing the analysis of the specificity evaluation of Actinidia deliciosa in example 1 of the present invention.

FIG. 5 is a flow chart of SELEX aptamer screening of pathogenic variants of Actinidia chinensis planch of Pseudomonas fragrans of the present invention;

FIG. 6 is a graph showing the result of electrophoresis of the PCR product in example 2;

FIG. 7 is a diagram showing the results of PCR detection and analysis of purification and recovery in example 2.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

The embodiment provides a screening method of pseudomonas syringae kiwi fruit pathogenic variant aptamers, which specifically comprises the steps of taking kiwi fruit ulcer bacteria as a target, screening candidate aptamers combined with the target from a single-stranded DNA library by adopting a SELEX method, and screening aptamers with high affinity and high specificity with the kiwi fruit ulcer bacteria from the candidate aptamers;

the embodiment also provides experimental verification of the aptamer screening method, which comprises the following steps:

in the experiment, an LB culture medium is used for culturing the bacterial suspension of the kiwifruit canker, then the bacterial suspension is reacted with FAM modified DNA, the fluorescence intensity of a candidate aptamer combined with the kiwifruit canker is measured by a fluorescence analysis method, a DNA sequence with the highest fluorescence intensity and the highest affinity is screened out, and the dissociation constant (K) of the screened sequence is further carried out _d ) And (4) determining and verifying the specificity. Finally obtaining an aptamer Seq1245 which can be specifically combined with the kiwifruit canker, and K of the aptamer Seq1245 _d The value was 721.05. + -. 207.55nM.

The method specifically comprises the following steps:

1. candidate aptamer-based screening

FAM modified candidate aptamers Seq4201, seq 1864, seq1245 (1. Mu.M) and 10 ⁸ cfu/mL kiwifruit canker reaction, after incubation for 1.5h at 25 ℃ and 200r/min in a shaking table, centrifuging for 3min at 3800r/min in a high-speed centrifuge, sucking out the supernatant by a pipette gun, discarding, washing 3 times with 1 xPBTM buffer solution, suspending in 500 μ L buffer solution, taking the bacterial suspension without aptamer as a blank control, and measuring the maximum fluorescence intensity of the sample by using a FL-7000 type fluorescence spectrophotometer.

The fluorescence intensity of the three candidate aptamers after reaction with the kiwifruit canker is measured, the maximum fluorescence intensity of the combination of Seq4201 and the kiwifruit canker is 27.67, the fluorescence intensity of Seq4201 is 349.9, and the maximum fluorescence intensity of Seq 1864 is 34.10. It can be seen that the affinity of Seq1245 to the kiwifruit canker fungi is significantly higher than that of the other two candidate sequences, the binding force of Seq1245 to the kiwifruit canker fungi is the best, and the sequence is selected for further experiments to determine the affinity of Seq1245 to the kiwifruit canker fungi.

2. Determination of dissociation constant (Kd)

Taking Seq1245 solution (0-400 nM) with different concentration gradients and quantitative kiwi canker (10) ⁸ cfu/mL), incubating at 25 deg.C for 1.5h at 200r/min in a shaker, centrifuging at 3800r/min for 3min, removing supernatant by pipette gun, washing with 1 XPBSM buffer solution for 3 times, resuspending in 500. Mu.L buffer solution, and measuring fluorescence intensity with FL-7000 type fluorescence spectrophotometer. From the measured fluorescence intensity, using the formula: y = B _max ×X/(K _d + X) calculation of K _d Value (wherein, B _max Maximum fluorescence intensity in the system, X is aptamer concentration, Y is fluorescence intensity).

As can be seen from FIG. 3, when the concentration of the aptamer Seq1245 solution is in the range of 0-400nM, the dissociation constant K measured by the combination of Seq1245 and kiwifruit canker is K _d And the affinity is better if the density is not less than 721.5 +/-207.55 nM. Since the latter half of the curve only shows a gentle tendency and does not yet completely reach saturation, usually K _d The lower the value, the stronger the binding capacity to the target, and the later stage can increase the concentration gradient of Seq1245, optimize the reaction conditions, and further determine the affinity characteristics.

3. Specificity evaluation of Actinidia kolomikta canker

The specificity of Seq1245 with the highest affinity in the aptamer is verified by taking kiwi canker, soft rot fungi and brown spot fungi as targets. The solution of Seq1245 aptamer (1. Mu.M) was taken together with the strain concentration (10) ⁶ cfu/mL and 10 ⁸ cfu/mL) into 500 μ L solution, incubating Actinidia chinensis planch ulcer bacteria at 25 deg.C and 200r/min for 1.5 hr, and incubating Cortinellus arenaria and Phaeopus at 28 deg.C and 200r/min for 1.5 hr. The fluorescence intensity of the different strains after binding to Seq1245 was determined and the results are shown in FIG. 4.

The specificity of Seq1245 with the highest affinity in the aptamer is verified by taking kiwifruit canker fungus, soft rot fungus and brown spot fungus as targets. Fruit of Chinese wolfberryThe assay results showed that at an aptamer concentration of 1. Mu.M, the strain concentration (10) ⁶ cfu/mL and 10 ⁸ cfu/mL), the fluorescence intensity of the Seq1245 combined with the kiwifruit canker is higher than that of other strains, and under the condition that the concentration of other strains changes by 2 orders of magnitude, neither the soft rot fungi nor the brown spot fungi can be combined with the DNA sequence Seq1245, which shows that the Seq1245 aptamer sequence can be specifically combined with the kiwifruit canker.

Example 3

Based on the above examples, this example is a SELEX aptamer screening experiment for pathogenic variants of actinidia vanilloids;

1. target information and experimental procedures

1.1 target

And (3) positive screening of a target: actinidia canker

And (3) reverse screening of a target: soft rot fungus and brown spot fungus

1.2 Experimental procedures

As shown in fig. 5.

2. Library preparation

2.1 purpose of the experiment

Library with slow renaturation and good solubility

2.2 Experimental materials and reagents (from BBI if no special markers)

Preparing a buffer solution:

two buffers were prepared, one containing Bovine Serum Albumin (BSA) screening buffer (buffer A) and the other protein-free buffer without BSA (buffer B).

PBSTM(1×PBS pH 7.4,1mM MgCl2,0.05％Tween20)

PBSTMB(1X PBS pH 7.4,1mM MgCl2,0.05％(V/V)Tween20,2mg/mLBSA)。

2.3 Experimental methods

2.3.1 transfer the dry-loaded library into a 15mL centrifuge tube, transfer the dry-loaded library completely into a 15mL centrifuge tube with pipette buffer B (5 times 2mL each), and then vortex on a vortex mixer.

2.3.2, at room temperature, centrifuge at 3000CFR for 10min on a floating bowl centrifuge (swing bowl centrifuge).

2.3.3, carefully discard the supernatant using a 1mL pipette, leaving only about 100. Mu.L of supernatant in the tube (when the supernatant is discarded, ensure that the library is fully retained in the tube).

2.3.4, add 3mL of buffer B to a 15mL centrifuge tube and vortex on a vortex mixer.

2.3.5, placing a 15mL centrifuge tube in a water bath kettle at 95 ℃ and standing for 5min. Naturally cooling to room temperature (more than 30min is needed). (the purpose of this step is to allow the oligonucleotide to "anneal" to its lowest energy-consuming conformation, forming a stable spatial structure).

2.3.6, add 7mL buffer A. Then vortexed on a vortex mixer. Centrifugation was carried out at 3000CFR for 10min at room temperature on a float bowl centrifuge (bucket bowl centrifuge), the supernatant was carefully discarded using a 1mL pipette, and 100. Mu.L of the supernatant was retained in the tube. Buffer A was added to a total volume of 1.8mL. Finally, the microspheres containing the oligonucleotide library were quantitatively transferred to 2mL tubes.

3. Screening

3.1 negative selection (reverse target selection)

3.1.1, aspirate 250 μ L into a 1.5mL tube.

3.1.2, a 1.5mL tube containing 250. Mu.L of M-280 streptavidin magnetic particles was placed on a magnetic stand, and after standing for 1min, the supernatant was discarded.

3.1.3, 500. Mu.L of buffer A was added, and the magnetic particles were spin-washed. The supernatant was discarded. This was repeated two more washes (3 washes total).

3.1.4, the magnetic particles were resuspended in 50. Mu.L of buffer A and then added to the aptamer library together with the anti-sieve protein. Incubate evenly for 1 hour at room temperature with rotation.

3.1.5, remove the magnetic particles and any bound aptamers with a magnetic separator and transfer the non-adsorbed library to a 1.5mL centrifuge tube. The wash transfer was repeated until all the non-adsorbed libraries were transferred.

3.1.6, centrifuge at 3000g for 1min at room temperature.

3.2 coupling of target proteins to magnetic particles

3.2.1, 50. Mu.L of magnetic particles (0.5 mg) were placed in a 1.5mL tube and adsorbed on a magnetic rack for 1min.

3.2.2, removing the supernatant, adding 250 mu L of buffer solution B, washing by rotation, and adsorbing for 1min by a magnetic frame.

3.2.3, repeat 3.2 steps 2 times, add 100. Mu.L buffer B to spin again.

3.2.4, then 10-15. Mu.g of target protein was added and incubated at room temperature for 30min. (in the incubation, the coupling effect is good only by gently flicking the tube with a finger every minute)

3.2.5, adsorbing for 1min with a magnetic frame, removing the supernatant, re-spinning with 200. Mu.L buffer B, and washing repeatedly for 2 times (3 times in total).

3.2.6, add 100. Mu.L buffer A to spin again.

3.3 Positive selection

3.3.1, all the coupled proteins in the 3 steps are mixed and added into the micro library, and the micro library is incubated for 90min at room temperature in a rotating way. (if the effect of rotary incubation is not good, the effect will be good only by slightly flicking the sample tube with fingers every minute)

3.3.2, rotating and mixing evenly, respectively sucking 1/2 volume to 21.5 mL tubes, and adsorbing for 1-2min by a magnetic frame.

3.3.3, wash with 0.5-1.0mL Buffer-A per tube. (until the wash becomes clear, containing no unbound aptamer beads. Typically the total volume of the wash reaches 10mL.

3.3.4, mix the 2 tube beads, wash twice with Buffer-B, 500 μ L each.

3.3.35, and finally, re-spinning with 50. Mu.L of Buffer-B.

3.4 aptamer dissociation

3.4.1, to the 50. Mu.L bead, 1N NaOH was added in an amount of 50. Mu.L. Incubate at 65 ℃ for 30min. 2M Tris-Cl 40. Mu.L was added to neutralize the NaOH.

3.4.2, adsorb the magnetic particles using a magnetic rack, transfer the supernatant to a 1.5mL tube.

3.5 desalting the aptamer sample (Balanced Filter column)

3.5.1, open the filter. The mixture was placed in a 1.5mL centrifuge tube and centrifuged at 1500g for 1min at room temperature.

3.5.2, 300 μ LBuffer-B was added on top of the resin layer, 1500g was centrifuged for 1min, and the rinse was discarded.

3. Repeat 2-3 times, discard the washing liquid in each collecting pipe. The filter column was placed in a new 1.5mL tube.

3.5.4, adding the dissociation liquid to the top of the filter column, centrifuging at 1500g for 2min, and collecting a filtrate sample. (30. Mu.L-130. Mu.L of sample can be processed per column. The dissociation solution is divided into two portions, one for each column).

3.5.5, combining the 2 tubes of collected liquid into one tube.

3.6 specificity screening (Single protein screening separately)

3.6.1, divide the filtrate into 2 tubes (labeled 1, 2 in order), 15. Mu.L each. After addition of reagents as in the table below, vortex incubation was performed for 1h at room temperature.

3.6.2, 60 μ L of the magnetic particles were taken, washed with 500 μ L of Buffer-A, the washing was repeated 2 times, and finally the magnetic particles were resuspended with 30 μ L of Buffer-A.

3.6.3, add 5. Mu.L of magnetic particles to tube 2 (the remaining beads were stored at 4 ℃ C. And left to use).

3.6.4 vortex incubation of the reaction tubes (2 tubes) for 30min at room temperature

3.6.5, using the magnetic frame, separate 2 tubes of magnetic particles, with 150 u L Buffer-A washing 3 times. Finally, 100. Mu.L of Buffer-A is added to carry out the re-rotation.

3.6.6 mix well No. 2 tube, this time No.1 tube 150 u L, no. 2 tube 100 u L, no. 2 tube 10 u L used in the following PCR experiment, preparation of secondary library.

4PCR and gel electrophoresis analysis

4.1 symmetric PCR reaction

Using 100. Mu.L of 1 XPCR buffer (2.5 mM MgCl2,0.2mM dNTP, 0.4. Mu.M forward primer (CAGGGGACGCACCAAGG), 0.4. Mu.M reverse primer (ATCACGCAGCCAGGGTCATGG) and 1U TaqPolymer), the amplification conditions were: pre-denaturation at 94 deg.C for 1min under 94 deg.C, 30s, 50 deg.C, 30s, and 72 deg.C for 1min, and final extension at 72 deg.C for 3min. Typically 20 cycles are set.

4.2 asymmetric PCR reaction

Using 100. Mu.L of 1 XPCR buffer (2.5 mM MgCl2,0.2mM dNTP, forward primer (CAGGGGACGCACCAAGG), reverse primer (CGATGTCAGCACGCGGGTCATGG) and 1U Taq Polymerase), the amplification conditions were: pre-denaturation at 94 deg.C for 1min, circulation at 94 deg.C for 30s, 50 deg.C for 30s and 72 deg.C for 1min, and final extension at 72 deg.C for 3min.

4.3 Polyacrylamide electrophoretic analysis

8-10% Native polyacrylamide gel electrophoresis (Native polyacrylamide gel electrophoresis). If the polyacrylamide electrophoresis results are less than satisfactory, the final cycle number can be determined by PCR band definition with appropriate changes to the PCR cycle number (typically a gradient of 4 cycles).

4.4 glue recovery

ssDNA, concentrated using isopropanol, was used as a secondary pool for the next round of screening.

4.5 Pre-machine detection SSH library detection

5% agarose gel is prepared, agarose electrophoresis detection is carried out on PCR products, 5 and 10 mu L of PCR products are respectively taken for electrophoresis, and the results are as follows:

5. multiple rounds of repeat screening

5-6 steps are repeated for 10 rounds, and finally the initial solution of the 1 st round and the sample group and the magnetic bead control of the last round are taken for high-throughput sequencing.

6. High throughput sequencing sample preparation and library construction for screening of the resulting library

6.1 purpose of the experiment

Preparation of cell SELEX sequencing samples and banking

6.2 Experimental methods

The DNA of the aptamer is accurately quantified by using a Qubit2.0 DNA detection kit so as to determine the amount of DNA to be added in the PCR reaction. And introducing Illumina bridge PCR compatible primers for amplification, wherein the primers are shown as accessories X-AP-F and X-AP-R2.

The PCR system was performed as follows:

the prepared PCR system carries out PCR amplification according to the following reaction conditions:

6.3PCR assay results and purification recovery (as shown in FIG. 7)

6.3.1, adding magnetic beads with the volume of 0.6 time (0.8 time) into 25ul of PCR products, shaking for full suspension, placing on a magnetic rack for adsorption for 5min, and carefully sucking out the supernatant by using a pipette.

6.3.2, 30ul0.6 times (0.8 times) of magnetic bead washing liquid is added, the mixture is shaken and fully suspended, then the suspension is placed on a magnetic frame for adsorption for 5min, and the supernatant is carefully sucked out.

6.3.3, adding 90ul Washbuffer (or 70% ethanol), reversely placing on a magnetic rack, making the magnetic beads adsorbed on the other side of the PCR tube, and sucking out the supernatant after full adsorption.

6.3.4, placing the PCR tube or the 8-connection tube in an oven at 55 ℃ for 5min to completely volatilize the alcohol in the PCR tube or the 8-connection tube.

6.3.5, add 30ul of Elution Buffer to elute.

6.3.6, the PCR tube is placed on an adsorption rack for 5min, fully adsorbed, and the supernatant is removed to a clean 1.5mL centrifuge tube for quantitative use.

6.4 Key reagent for experiment

Example 3

The embodiment is a preferred implementation method for detecting the kiwifruit canker disease PSA by using the optimal aptamer screened in the embodiment 1, and specifically comprises the following steps:

step 1, screening by the method described in embodiment 1 to obtain aptamers with high affinity and high specificity, and designing a DNA molecular beacon according to the aptamers, specifically comprising: an aptamer for introducing a fluorescent group, a quenching group and PSA through reasonable modification of DNA at a proper position;

wherein, designing a DNA molecular beacon comprising a circular region, a stem region, a fluorescent group, a quenching group and a PSA aptamer;

step 2, after the PSA aptamer is combined with a target object on bacteria, the stem region and the annular region are opened to rapidly generate fluorescence;

when the molecular beacon is in a free state, the stem region is specifically combined to form a hairpin structure, so that the fluorescent group and the quenching group are close to each other; due to fluorescence resonance energy transfer, fluorescence generated by exciting the fluorescent group is absorbed by the quenching group, and the fluorescence is almost completely quenched, so that the fluorescence background is extremely low.

In conclusion, the PSA aptamers screened by the SELEX method are used for constructing the DNA molecular beacons, and the PSA-based kiwifruit canker is detected by a fluorescence resonance energy transfer method (FRET).

In the description herein, references to the description of "one embodiment," "an example," "a specific example" or the like are intended to mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

The preferred embodiments of the invention disclosed above are intended to be illustrative only. The preferred embodiments are not intended to be exhaustive or to limit the invention to the precise embodiments disclosed. Obviously, many modifications and variations are possible in light of the above teaching. The embodiments were chosen and described in order to best explain the principles of the invention and the practical application, to thereby enable others skilled in the art to best utilize the invention. The invention is limited only by the claims and their full scope and equivalents.

Accessories

SEQ ID NO.1

AACACGGCCAAGGTTCGGGCACCGAACGTTGTGCCTGTGGGC

X-AP-F：

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNCAGGGGACGCACCAAGG

X-AP-R2：

CAAGCAGAAGACGGCATACGAGATACCTTGCCGTGACTGGAGTTCCTTGGCACCCGAGAattccaACAGTGCAGCACGCGGGTCATGG。

Claims (6)

1. The Pseudomonas syringae kiwi fruit pathogenic variant aptamer is characterized in that the aptamer is an aptamer of Seq1245, and the nucleotide sequence of the aptamer is shown as SEQ ID No.1.

2. A screening method of pseudomonas syringae kiwi fruit pathogenic variety aptamer is characterized by specifically comprising the following steps: the kiwi canker is used as a target, a SELEX method is adopted to screen candidate aptamers combined with the target from a single-stranded DNA library, and then aptamers with high affinity and high specificity with the kiwi canker are screened from the candidate aptamers.

3. The method for detecting the PSA of the kiwifruit canker by adopting the aptamer of claim 1, is characterized by comprising the following steps:

s1, screening by the method to obtain an aptamer with high affinity and high specificity, and designing a DNA molecular beacon according to the aptamer, wherein the method specifically comprises the following steps: an aptamer for introducing a fluorescent group, a quenching group and PSA through reasonable modification of DNA at a proper position;

and S2, after the PSA aptamer is combined with a target object on the bacteria, the stem region and the annular region are opened, and fluorescence is rapidly generated.

4. The method for detecting PSA (prostate cancer disease) by using the aptamer of claim 1, according to claim 3, wherein a DNA molecular beacon comprising a circular region, a stem region, a fluorescent group, a quenching group and a PSA aptamer is designed in S1.

5. The use of the pseudomonas syringae kiwi fruit pathogenic variant aptamer of claim 1 in the control of kiwi fruit canker.

6. The use of the pseudomonas syringae kiwi var pathopoiesia aptamer of claim 1 in the detection of kiwi canker.

Images