CN103898203B

CN103898203B - The detection method of Cryptosporidum parvum and detection kit

Info

Publication number: CN103898203B
Application number: CN201210585063.9A
Authority: CN
Inventors: 何宏轩; 高姗姗; 王承民; 罗静
Original assignee: Institute of Zoology of CAS
Current assignee: Institute of Zoology of CAS
Priority date: 2012-12-28
Filing date: 2012-12-28
Publication date: 2016-09-28
Anticipated expiration: 2032-12-28
Also published as: CN103898203A

Abstract

The present invention provides detection method and the detection kit of a kind of Cryptosporidum parvum.Described detection method comprises the following steps: 1) immuno magnetic cell separation purification detected sample, prepares the suspension containing Cryptosporidum parvum；2) suspension containing Cryptosporidum parvum that fluorescence quantitative PCR detection step 1) prepares；Described detection kit includes the reaction system containing the biotinylation Cryptosporidum parvum coated strepavidin magnetic beads of Cp23 monoclonal antibody, the special forward primer of Cryptosporidum parvum, special downstream primer and Taqman fluorescent quantitation probe primer in described detection method.Cryptosporidum parvum detection method of the present invention, sensitivity has exceeded nearly 100 times than traditional method, considerably beyond traditional method.

Description

The detection method of Cryptosporidum parvum and detection kit

Technical field

The present invention relates to environmental monitoring and immunologic diagnosis field, relate to a kind of detection method and detection kit, especially relate to And the detection method of a kind of Cryptosporidum parvum and detection kit.

Background technology

Cryptosporidum parvum (Cryptosporidium Tyzzer, 1907) is widely present in animal, is also human body Important parasitic sporozoon, can cause Cryptosporidum parvum sick (Cryptosporidiosis).Parasitize the kind of human body mainly Cryptosporidum parvum (C.parvum), this worm is opportunistic protozoa, but is also a kind of important diarrhoea pathogenic.The clinic of this disease Symptom and the order of severity depend on immunologic function and the nutriture of host.After the infection of immunologic function normal person, mainly show For acute watery diarrhea, general without pus and blood, day defecation 2～more than 20 times, the child of severe infections may occur in which that ejection water sample rushes down, and arranges Just amount is many.Stomachache, abdominal distention, Nausea and vomiting, loss of appetite or anorexia, thirsty and heating the most more typically.The course of disease is different in size, short Person 1～2 days, elder's several years, occupy the majority for 20 days to about 2 months, by acute transfer to chronic, and then recurrent exerbation person many See.This disease research report abroad increases increasingly, domestic the most gradually attracts much attention.

At present Cryptosporidum parvum disease is detected in early days the method used main still direct smear or histotomy Find and make a definite diagnosis.The detection method of water sample is to carry out smear staining after Purification by filtration is enriched with.Although direct smear or histotomy Simple and quick, but rate of missed diagnosis is high；Tissue culture and animal invention are the most true and reliable, but operate loaded down with trivial details, the longest, and cost is high； ELISA method is easy, quickly, sensitivity still can, but due to the difference of individual immunity system, index can not truly reflect worm sometimes The situation of body-sensing dye, is likely to result in and fails to pinpoint a disease in diagnosis or mistaken diagnosis.PCR is as a kind of novel Protocols in Molecular Biology, since being born, by In its specificity, sensitivity, substantial amounts of purpose fragment can be obtained at short notice, make the important of current invention research One of means.But the PCR of routine easily causes pollution in operation, false positive is higher, is allowed in clinical diagnosis by some Limit.

In recent years, research report and the Patents of Cryptosporidum parvum it have been applied to.Such as, Application No. 200880126847 patent applications disclose a kind of method detecting Cryptosporidium and dedicated kit thereof；Application No. The patent application of 200710094101 discloses kit for quickly detecting cryptosporidium；Application No. 200510042527.1 special Profit application discloses Cryptosporidium viral capsid proteins antibody ELISA detection method and test kit；Application No. The patent application of 200810051728 disclose for the detection of Cryptosporidium kind and Lan Shi giardia lamblia multiple suspending chip and Its preparation method；The patent application of Application No. 03126895.1 discloses Cryptosporidium and the inspection of Cryptosporidium Species specific PCR Test agent box and detection method；The patent application of Application No. 200510009966 is hidden spore during disclosing drinking water treatment The on-line checking of worm and feedback method for treating；The patent application of Application No. 200610030137 discloses giardia cysts inside in water Detection method with Cryptosporidium；The patent application of Application No. 200910306998 discloses raising Cryptosporidium and Jia whip The filtration and concentration method of the caterpillar detection response rate.

Whether above-mentioned patent is many contains Cryptosporidium in detection water or in animal serum, tissue, Excreta, but does not has A kind of method Cryptosporidum parvum fast separating and purifying in water body example and fecal specimens and detection by quantitative can identified.

It is desirable to provide the detection method of a kind of Cryptosporidum parvum and detection kit, it is possible to water body example (including drinking water), fresh food and fecal specimens carry out quick diagnosis and detection.

Summary of the invention

Therefore, it is an object of the invention to for the deficiency that cannot detect Cryptosporidum parvum at present rapidly and sensitively, it is provided that The detection method of a kind of Cryptosporidum parvum and detection kit, it is possible to quickly and efficiently detection testing sample such as water body example, Cryptosporidum parvum in fresh food and fecal specimens.

Present invention employs separating and purifying technology-immuno magnetic cell separation technology (Immunomagneticbead- Basedseparation).Immunomagnetic beads (Immonumagnetic beads, IMB are called for short magnetic bead), is development in recent years A new immunological technique, the high degree of specificity of distinctive for solidified reagents advantage Yu immunological response is incorporated into one by it Body, based on immunology, penetrates into the every field such as pathology, physiology, pharmacology, microorganism, biochemistry and molecular genetics, its Obtain increasingly being widely applied at aspects such as immune detection, cell separation, biological macromolecule purifying and molecular biology.Magnetic The advantage of property microsphere is: (l) particle diameter is little；(2) suspension stability is good；(3) there is superparamagnetism；(4) easy and simple to handle；(5) have good The good thing compatibility；(6) magnetic particle has certain mechanical strength and chemical stability.Immuno magnetic cell separation technology (Immunomagnetic bead-based separation), IMS is a kind of immunology detection and isolation technics, and it is with height The magnetic microsphere of homogeneity is solid support, and immunity base (such as antibody, antigen etc.) is attached to magnetic carrier by functional group Upper formation immune magnetic microsphere, the immunological response of utilization level, under magneticaction, occur mechanics to move, from mixed solution Middle separation detection target substance.

Quantitative measurement technology-real-time fluorescence quantitative PCR (Real-time PCR), the method (Real-timePCR) and biography System method is different, its advantage: is single tube " locked in " operation, efficiently solves PCR pollution problem；Two is that automaticity is high； Three is that specificity is higher；Four is the real-time monitoring of PCR reaction.Efficiently solve traditional quantitative can only the limitation of end point determination, Achieve each intensity taking turns circulation all detection first order fluorescence signals, and record among computer software, by each sample The calculating of Ct value, obtains quantitative result according to standard curve；Five is absolute quantitation, owing to the logarithm of Ct value with starting template exists Linear relationship, available standard curve carries out absolute quantitation mensuration to unknown sample.Real-time round pcr from produce with Coming, development is perfect, the most highly developed.Labeling method, by the most single dye method, develops into The higher sonde method of specificity, such as Taqman, Molecular Beacon etc..SYBRGreen dye method oneself be more perfect inspection Survey system, and in reaction system, the concentration of SYBRGreen dyestuff also need not be adjusted optimizing, whole detection system is simple Easy, but carry out Real-timePCR with SYBRGreen dye method and there is also certain drawback, as result needs to melt Tracing analysis, when particularly carrying out multiple gene detection or primer poor quality, the original plan of its amplification can not intuitively reflect Real amplification efficiency, it is necessary to determine final inventive result through melting curve analysis.Fluorescence TaqMan technology is U.S. PE Company's exploitation, have been used to gene test at present.The method has the advantage that and carries out amplified production under stopped pipe state Detection, avoids amplified production and pollutes and the false positive that causes；Probe hybrid specificities is higher；Exist without restriction enzyme site；After PCR Without subsequent treatment, operate more simple and quick；Safety non-pollution.DNA sequencing shows that the method accuracy is the highest.Real- TimePCR, is one of best approach improving Cryptosporidum parvum diagnostic sensitivity.

Concrete for above-mentioned purpose, the technical scheme that the present invention provides is as follows:

On the one hand, the present invention provides the detection method of a kind of Cryptosporidum parvum, said method comprising the steps of:

1) by immuno magnetic cell separation purification detected sample, prepare isolated and purified after Cryptosporidum parvum suspension；

2) fluorescence quantitative PCR detection step 1) prepare isolated and purified after Cryptosporidum parvum suspension, it is preferable that described Quantitative fluorescent PCR is Taqman sonde method quantitative fluorescent PCR.

Preferably, described step 1) specifically includes following steps:

A1) detected sample is made Cryptosporidum parvum suspension；

B1) prepare containing the biotinylation Cryptosporidum parvum coated strepavidin magnetic beads of Cp23 monoclonal antibody The reaction system of (Streptavidin Particles Plus-DM)；

C1) by step a1) prepared Cryptosporidum parvum suspension adds step b1) in prepared reaction system, in room temperature Hatch；

D1) after hatching sample washing after, resuspended with sterilized water, prepare isolated and purified after Cryptosporidum parvum hang Liquid.

Preferably, in step b1) in, in reaction system, described biotinylation Cryptosporidum parvum Cp23 monoclonal anti The final concentration of 2-50ng/ml of body, the final concentration of 20 μ g/ml of described strepavidin magnetic beads.

Preferably, the final concentration of 20-50ng/ml of described biotinylation Cryptosporidum parvum Cp23 monoclonal antibody, institute State the preferred 20ng/ml of final concentration of biotinylation Cryptosporidum parvum Cp23 monoclonal antibody.

It is further preferred that described reaction system is by including biotinylation Cryptosporidum parvum Cp23 monoclonal antibody and chain The method hatching 15-60min in mycin magnetic bead addition fluidic cell pipe prepares.

Preferably, hatch 30-60min, most preferably hatch 30min.

Preferably, described step 2) specifically include following steps:

A2) extraction step 1) prepare isolated and purified after the genomic DNA of Cryptosporidum parvum suspension；

B2) Cryptosporidum parvum standard curve is formulated by Cryptosporidum parvum recombiant plasmid standard substance；

C2) drawn by the special forward primer of Cryptosporidum parvum, special downstream primer and Taqman fluorescent quantitation probe Thing, with step a2) prepared Cryptosporidum parvum DNA is that template carries out Taqman sonde method fluorescent quantitative PCR；

D2) by step c2) result of Taqman sonde method fluorescent quantitative PCR and step b2) prepared small hidden spore Sub-worm standard curve contrasts, and draws Cryptosporidum parvum number contained in testing sample.

Preferably, described step b2) comprise the following steps:

B21) Cryptosporidum parvum recombiant plasmid standard substance are prepared；

B22) drawn by the special forward primer of Cryptosporidum parvum, special downstream primer and Taqman fluorescent quantitation probe Thing, with step b21) prepared Cryptosporidum parvum recombiant plasmid standard substance are that template carries out Taqman sonde method fluorescent quantitation PCR expands, it is preferable that reaction system is:

Or preferably, reaction condition is: 95 DEG C of 30s, circulate for the first step；95 DEG C of 5s, 60 DEG C of 34s, second step 40 follows The Taqman sonde method fluorescent quantitative PCR of ring；

B23) with the logarithm of template copy numbers as X-axis, standard curve is drawn with Ct value for y-axis.

Preferably, described detected sample includes water body example, fecal specimens and fresh food, it is further preferred that described water Body sample is drinking water or sanitary sewage.

Preferably, when detected sample is feces, by including that fecal specimens adds the mixing of appropriate aquesterilisa makes excrement Just suspension the step through 80 mesh metallic sieves filtrations make Cryptosporidum parvum suspension.

Preferably, the sequence of the special forward primer of described Cryptosporidum parvum is the nucleotide shown in SEQ ID NO:1 Sequence；The sequence of the special downstream primer of described Cryptosporidum parvum is the nucleotide sequence shown in SEQ IDNO:2；Described micro- The sequence of little Cryptosporidium Taqman fluorescent quantitation probe primer is the nucleotide sequence shown in SEQ ID NO:3, and its two ends are divided One reporter fluorescence group of other labelling and a quenching fluorescence group.

Preferably, described detection method also includes, at d2) after step, to small hidden spore detection method sensitivity and spy The detection of the opposite sex, comprising:

D21) sensitivity Detection of Cryptosporidum parvum detection method；

D22) specific detection of Cryptosporidum parvum detection method.

Preferably, described step d21) specifically include following steps:

D211) testing sample being made Concentraton gradient is 10^-1-10⁶The small hidden spore suspension of individual/ml, it is further preferred that work as When testing sample is fecal specimens, make feces suspension and through 80 mesh metals by fecal specimens being added the mixing of appropriate aquesterilisa Screen filtration makes small hidden spore suspension；According still further to the isolated and purified detected sample of step 1), prepare isolated and purified after micro- Little Cryptosporidium suspension；

D212) extraction step d211) genomic DNA of prepared Cryptosporidum parvum suspension；

D213) by the special forward primer of Cryptosporidum parvum, special downstream primer and Taqman fluorescent quantitation probe Primer, with step d212) prepared Cryptosporidum parvum DNA is that template carries out Taqman sonde method fluorescent quantitative PCR；

D214) by step d213) result of Taqman sonde method fluorescent quantitative PCR to be to detect inspection of the present invention The sensitivity of survey method.

Preferably, described step d22) specifically include following steps:

D221) testing sample being made concentration is 10³The Cryptosporidum parvum suspension of individual/ml, described testing sample also wraps Include 10³The escherichia coli suspension of CFU/ml, it is preferable that when testing sample is fecal specimens, adds fecal specimens by including Feces suspension is made in appropriate aquesterilisa mixing and the step that filters through 80 mesh metallic sieves makes small hidden spore suspension or big Enterobacteria suspension.

According to the isolated and purified detected sample of step 1)；

D222) extraction step d221) suspension of prepared Cryptosporidum parvum and the genomic DNA of escherichia coli suspension, And extract 10 respectively³The small hidden spore suspension of individual/ml and 10³The genomic DNA of the escherichia coli suspension of CFU/ml is as the positive Control sample, sterilized water is as negative control sample；

D223) by the special forward primer of Cryptosporidum parvum, special downstream primer, with step d222) prepared micro- Little cryptosporidium dna is that template carries out PCR amplification；

D224) by colibacillary special forward primer, special downstream primer, with step d222) prepared large intestine bar Bacterium DNA is that template carries out PCR amplification；

D225) by step d223) and step d224) pcr amplification product carries out 1% agarose gel electrophoresis, to detect this The specificity of bright described detection method.

Preferably, described step d223) comprise the following steps:

D2231) by the special forward primer of Cryptosporidum parvum, special downstream primer, with step d222) prepared micro- Suspension genomic DNA, positive control sample and the negative control sample of little Cryptosporidium is template PCR amplifications, it is preferable that reaction System is:

D2232) by step c2241) prepare gained system reaction condition and be: 95 DEG C of 4min, circulate for the first step；95℃ 30s, 55 DEG C of 30s, 72 DEG C of 30s are second step 30 circulation；The PCR amplification of 72 DEG C of 10min.

Preferably, described step d224) comprise the following steps:

D2241) by colibacillary special forward primer, special downstream primer, with step c222) extraction step D222) colibacillary suspension genomic DNA, positive control sample and the negative control sample prepared is template PCR amplifications, instead The system is answered to be:

D2242) by step d2241) prepare gained system reaction condition and be: 94 DEG C of 5min, circulate for the first step；94℃ 30s, 55 DEG C of 30s, 72 DEG C of 45s are second step 30 circulation；The PCR amplification of 72 DEG C of 5min.

Preferably, the sequence of the special forward primer of described Cryptosporidum parvum is the nucleotide shown in SEQ ID NO:1 Sequence；Or the sequence of the special downstream primer of described Cryptosporidum parvum is the nucleotide sequence shown in SEQ IDNO:2；Or institute The sequence of the Taqman fluorescent quantitation probe primer of the Cryptosporidum parvum stated is the nucleotide sequence shown in SEQ ID NO:3, And its two ends one reporter fluorescence group of labelling and a quenching fluorescence group respectively；Or colibacillary special forward primer Sequence be the nucleotide sequence shown in SEQ ID NO:4；Or the sequence of the special downstream primer of described Cryptosporidum parvum is Nucleotide sequence shown in SEQ ID NO:5.

In detail, the detection method of the Cryptosporidum parvum of the present invention realizes specifically by following methods:

The above-mentioned steps 1 that the present invention provides) realized by step in detail below:

A. the preparation of sample

The preparation of the phosphate buffer (PBS) (pH=7.4) of A1.3% bovine serum albumin (BSA):

Potassium dihydrogen phosphate (KH₂PO₄): 0.27g；

Disodium hydrogen phosphate (Na₂HPO₄): 1.42g；

Sodium chloride (NaCl): 8g；

Potassium chloride (KCl): 0.2g；

Bovine serum albumin (BSA): 3g

Add deionized water about 800ml to be sufficiently stirred for dissolving, be subsequently adding concentrated hydrochloric acid and adjust pH to 7.4, last constant volume to 1L.High 4 DEG C of preservations after temperature autoclaving.

A2. take testing sample, be made into 1ml10⁸The liquid storage of the Cryptosporidum parvum suspension of individual/ml, then warp 3000r min-1 is centrifuged 10min, repeatedly rushes with the phosphate buffer (PBS) (pH=7.4) of 3ml3% bovine serum albumin (BSA) After washing, centrifugal supernatant of abandoning, reservation precipitation, it is preferable that when described testing sample is fecal specimens, filter through 80 mesh metallic sieves, It is centrifuged 10min through 3000r min-1；Abandon supernatant, retain precipitation, and make the liquid storage of Cryptosporidum parvum suspension.

A3. deposit is diluted resuspended with the phosphate buffer (PBS) (pH=7.4) of 3% bovine serum albumin (BSA), It is prepared as 10³The Cryptosporidum parvum suspension of individual/ml, is positioned over room temperature standby.

B. the set-up procedure of strepavidin magnetic beads

Strepavidin magnetic beads 3 is repeatedly rinsed with the phosphate buffer (PBS) (pH=7.4) of 3ml3% bovine serum albumin (BSA) Secondary.Use magnetic frame assists.It is positioned over room temperature standby.

C. immuno magnetic cell separation purge process

C1. take the fluidic cell pipe of 12mm × 75mm, add the phosphate buffer of 3ml3% bovine serum albumin (BSA) (PBS), after (pH=7.4), biotinylation Cryptosporidum parvum Cp23 monoclonal antibody is added so that it is final concentration of 20ng/ml, and Add ready final concentration of 20 μ g/ml strepavidin magnetic beads, incubated at room temperature 30min, slowly shake.

C2. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

C3. wash magnetic bead 3 times with the phosphate buffer (PBS) (pH=7.4) of 3ml3% bovine serum albumin (BSA), use magnetic Power frame assists, supernatant discarded.

C4. joining in system by the sample of purification to be separated, often pipe addition is 3ml.

C5. magnetic bead and biotinylated antibody complex are at room temperature hatched 30min with Cryptosporidium sample, slowly shake Swing.

C6. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

C7. with the phosphate buffer PBS(pH=7.4 of 3ml3% bovine serum albumin (BSA)) wash magnetic bead 3 times, use magnetic force Frame assists.

C8. by the Cryptosporidum parvum suspension sample 3000r min after isolated and purified^-1Centrifugal 10min, supernatant discarded.

C9. precipitation is resuspended with 200 μ l aquesterilisa, and be transferred in 2ml cryopreservation tube, multigelation (liquid nitrogen 5min, 65 DEG C Water-bath 5min) 3 times.Be positioned over-20 DEG C standby.

The above-mentioned steps 2 that the present invention provides) realized by step in detail below:

D. the preparation of Cryptosporidum parvum DNA profiling:

D1. from step A3, prepare 10³Extraction Cryptosporidum parvum DNA in the Cryptosporidum parvum suspension of individual/ml:

D1a. the Cryptosporidum parvum suspension that 200 μ l prepare from step A3 is transferred in 2ml cryopreservation tube, multigelation (liquid nitrogen 5min, 65 DEG C of water-bath 5min) 3 times.

D1b. by the Cryptosporidum parvum suspension after multigelation (by TIANGEN company genome DNA extracting reagent kit Description operate) extract Cryptosporidum parvum DNA.Be positioned over-20 DEG C standby.

E.Taqman sonde method quantitative fluorescent PCR Cryptosporidum parvum gene recombination plasmid standard substance

Preparation

E1.PCR amplifying target genes fragment

E1a. primer:

Special forward primer (P1): 5'-TTCCGTCAATTCCTTTAAG-3 ' '

Special downstream primer (P2): 5'-TACCGTCGTAGTCTTAAC-3 ' '

E1b.PCR reaction system:

E1c. reaction condition: 95 DEG C of 4min, circulates for the first step；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s are second step 30 Individual circulation；72 DEG C of 10min, amplified fragments 144bp(TTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCC AGAACCCAAAGACTTTGATTTCTCATAAGGTGCTGAAGGAGTAAGGAACAACCTCCAATCTCTAGTTGGCATAGTTT ATGGTTAAGACTACGACGGTA) (SEQ ID NO:6)

E1d.PCR product electrophoresis: amplified production carries out 1% agarose gel electrophoresis, electrophoresis time 30min.

E1e.PCR product glue reclaims purification (reclaiming the operation of test kit description by TIANGEN company agarose DNA glue)

E2. gene clone carrier builds: Peasy-T1 carrier and the connection of pcr amplification product

E2a. coupled reaction system is as follows:

E2b.25 DEG C connects 5-10min.Be positioned over 4 DEG C standby.

E2c. connect product and be directly used in conversion Trans1-T1 competent cell (by TransGenBiotech company Trans1-T1Phage Resistant Chemically Competent Cell description operates).And carry out recombiant plasmid Blue white macula screening.

E2d. plasmid (operating by TIANGEN company plasmid little extraction reagent kit description) is extracted by gained plasmid in-20 DEG C Save backup.

E3. the qualification of recombiant plasmid

E3a.PCR identifies: carry out PCR amplification after the plasmid of extraction is diluted 100 times as stated above as template.

E3b. check order qualification: using Peasy-T1 vector primer (M13R:5'-CAGGAAACAGCTATGACC-3') as surveying Sequence primer, send Hua Da gene technology company limited to carry out sequencing by the plasmid of extraction.

The foundation of F.Taqman sonde method quantitative fluorescent PCR standard curve

F1. the determination of template amount:

OD is measured after the positive recombiant plasmid identified is diluted 100 times₂₆₀Reading, calculates the copy number in 1 μ l.

1bp=330 dalton's molal weight (MW)=2904bp × 660 1OD₂₆₀=50μg/ml

Mass concentration=OD₂₆₀× 50 μ g/ml × extension rate

Molar concentration=mass concentration ÷ MW

Copy/μ l=molar concentration × 6.02 × 10²³(Avogadro constant number)

F2.Taqman sonde method fluorescence quantitative PCR detection:

F2a. fluorescent probe primer (P3):

5'FAM-TCAGCCTTGCGACCATACTCC-TAMRA3'

F2b.Taqman sonde method quantitative fluorescent PCR reaction system:

F2c.Taqman sonde method quantitative fluorescent PCR reaction condition: 95 DEG C of 30s, circulates for the first step；95 DEG C of 5s, 60 DEG C 34s, for second step 40 circulation.

F3. drafting and the sensitivity of standard curve is verified:

Positive Cryptosporidum parvum recombiant plasmid after identifying carries out 10 times of doubling dilutions, Concentraton gradient as standard substance It is 10⁸-10⁰Copy/μ l, is separately added into the Cryptosporidum parvum recombiant plasmid standard substance 1 μ l of variable concentrations in each reaction tube Under optimum reaction condition, use Agilent MxPro quantitative real time PCR Instrument as standard form, use above-mentioned Taqman sonde method glimmering Fluorescent Quantitative PCR method detects, reaction terminate after with the logarithm of initial template copy number as x-axis, with 10⁸-10³Copy/μ l is micro- Little Cryptosporidium recombiant plasmid standard substance Ct value draws standard curve (sample linear regression and expection concentration coefficient R for y-axis Value is more than 0.92).

G. testing sample Taqman sonde method fluorescence quantitative PCR detection:

G1. the preparation of testing sample DNA:

The Cryptosporidum parvum suspension prepared from step C is carried out multigelation, (by TIANGEN company genomic DNA Extract test kit description operation) extract Cryptosporidum parvum DNA.Be positioned over-20 DEG C standby.

G2. above-mentioned Taqman sonde method fluorescence quantifying PCR method is used to detect.

F. calculate:

The Ct value of sample is substituted into the linear regression equation of standard curve, calculates samples copy number, then be multiplied by dilution Multiple, again divided by 10, is the number of Cryptosporidum parvum in sample.

Further aspect, the present invention provides the detection kit of a kind of Cryptosporidum parvum, described test kit to include above-mentioned Invention detection method described in containing the biotinylation Cryptosporidum parvum coated strepavidin magnetic beads of Cp23 monoclonal antibody Reaction system, the special forward primer of Cryptosporidum parvum, special downstream primer and Taqman fluorescent quantitation probe primer.

Preferably, the concentration of the described biotinylation Cryptosporidum parvum coated strepavidin magnetic beads of Cp23 monoclonal antibody is 2-50ng/ml, the final concentration of 20 μ g/ml of described strepavidin magnetic beads.

Preferably, the final concentration of 20-50ng/ml of described biotinylation Cryptosporidum parvum Cp23 monoclonal antibody.

It is furthermore preferred that the final concentration of 20ng/ml of described biotinylation Cryptosporidum parvum Cp23 monoclonal antibody.

Preferably, described test kit also includes Cryptosporidum parvum recombiant plasmid standard substance, more preferably, described small hidden The Concentraton gradient of sporozoon recombiant plasmid standard substance is 10⁴-10⁸Copy/μ l.

It is highly preferred that described reaction system also includes immuno magnetic cell separation purification system buffer；More preferably, described examination Agent box also includes fluorescence quantitative PCR reaction solution.

In detail, test kit of the present invention includes:

Reagent A: strepavidin magnetic beads, 5ml.

Reagent B: biotinylated Cryptosporidum parvum Cp23 monoclonal antibody 1 μ g/ μ l, 20 μ l.

Reagent C: 10 × immuno magnetic cell separation purification system buffer, 100ml.

Reagent D: Cryptosporidum parvum recombiant plasmid standard substance: 6 pipe, often pipe 100 μ l, content respectively: 0 copy/μ l, 10⁴Copy/μ l, 10⁵Copy/μ l, 10⁶Copy/μ l, 10⁷Copy/μ l, 10⁸Copy/μ l.

Reagent E: the special forward primer of Cryptosporidum parvum and special downstream primer, totally 200 μ l.

The Taqman fluorescent quantitation probe primer of reagent F: Cryptosporidum parvum, 200ul.

Reagent G: fluorescence quantitative PCR reaction solution, 5ml.

Preferably, often pipe Taqman sonde method quantitative fluorescent PCR reaction system is 20 μ l: need 17.4 μ l reagent G(to comprise 2×Premix EX Taq10μl；50×ROX Reference Dye Ⅱ0.4μl；Sterilized water 7 μ l；), 0.8 μ l reagent E (bag Containing upstream specific primer P10.4 μ l；Downstream special primer P20.4 μ l), 0.8 μ l reagent F and 1 μ l Cryptosporidum parvum DNA mould Plate.

Preferably, described biotinylation Cryptosporidum parvum Cp23 monoclonal antibody is coated the final concentration of of strepavidin magnetic beads 20ng/ml；Or the sequence of the special forward primer 1 of described Cryptosporidum parvum is the nucleotide sequence shown in SEQ ID NO:1； The sequence of the special downstream primer of described Cryptosporidum parvum is the nucleotide sequence shown in SEQ ID NO:2；Described is small The sequence of the Taqman fluorescent quantitation probe primer of Cryptosporidium is the nucleotide sequence shown in SEQ ID NO:3 and two ends are divided One reporter fluorescence group of other labelling and a quenching fluorescence group.

To immuno magnetic cell separation purification system (IMS) principle such as Fig. 1, (operation principle of immunomagnetic beads is mainly the present invention The magnetic bead wrapped up by streptomycin is coupled in biotinylated Cryptosporidum parvum Cp23 monoclonal antibody by chemical bond, small Cryptosporidium surface antigen determinant antibodies on antibody, it is achieved thereby that with the connection of immunomagnetic beads, and then pass through magnetic The auxiliary of power frame reaches isolated and purified purpose), encountered in the application in Cryptosporidum parvum detects, some conditions are carried out Experimental study is repeated several times, from the result of Fig. 6-8, has found surprisingly that biotinylation Cryptosporidum parvum Cp23 monoclonal antibody Final concentration of 20-50ng/ml, coated strepavidin magnetic beads is 20 μ g/ml, the strepavidin magnetic beads being coated and small hidden spore When the reaction of worm suspension and immunomagnetic ca pture Cryptosporidum parvum time are 30min, testing result is relatively good, and biotinylation During the final concentration of 20ng/ml of Cryptosporidum parvum Cp23 monoclonal antibody, it is possible to reach the effect identical with 50ng/ml.And Along with the increase in response time, nonspecific reaction increases, and increases over time the coacervation between magnetic bead the most not Can ignore, after reaction 1h, have obvious agglomeration.Fig. 9 result shows that application test kit of the present invention can be from the small hidden spore of 3ml Separable in sub-worm suspension detect that, less than 10 Cryptosporidum parvums, its detection sensitivity can reach less than 4/ml.Figure 10 Result show apply test kit of the present invention can from the Cryptosporidum parvum fecal specimens that 3ml processed separable detect little In 100 Cryptosporidum parvums, its detection sensitivity can reach less than 34/ml.Figure 11 is visible at immuno magnetic cell separation purification Specificity verification in carry out immuno magnetic cell separation with positive control, negative control and testing sample respectively and purify, anti-through PCR Should, acquired results fits like a glove with expection, without non-specific amplification.

Immuno magnetic cell separation method of purification is magnetic separation technique based on antigen antibody reaction, its have simple, quick, without Particular device, separate the features such as product specificities is high, required time is short, the application of immunomagnetic beads in the last few years more and more extensively and Deeply, the most progressively replace some loaded down with trivial details separation methods, utilize the most isolated and purified institute of immuno magnetic cell separation purification process Needing microorganism, quickly, less than 1 time on working day, sensitivity has exceeded nearly 100 than traditional method to its isolated and purified speed Times, considerably beyond traditional method.

Standard curve of the present invention research shows, the Ct value of each template exists line with the logarithm of the starting copy number of this template Sexual relationship, starting copy number is the most, and Ct value is the least.The standard substance utilizing known starting copy number can make standard curve, wherein Abscissa represents the logarithm of starting copy number, and vertical coordinate represents Ct value, as long as obtaining the Ct value of unknown sample, and can be bent from standard The starting copy number of this sample is calculated on line.Therefore the quality of standard curve directly affects the accuracy of sample amounts.This The bright standard curve correlation coefficient obtained such as Fig. 4 is 0.998, and error is little.Permissible from the amplification curve of variable concentrations starting template Finding out, S curve baseline is smooth, and exponential region is obvious, and slope is relatively big, and platform area is compiled in together substantially, and these all illustrate in this condition The amplification of lower bolster is ideal.

In carrying out the detection of Taqman sonde method fluorescence quantifying PCR method, detection sensitivity the most so-called detection lower bound is led to Often there are 3 kinds of method for expressing；Absolute sense lower bound (the template starting copies minimum that can be detected with quantitatively arrive), relative detection low Limit (the minimum percentage composition of the exogenous gene that can be detected and quantitatively arrive), actually detected lower bound (actual detected DNA number Amount).This research use absolute sense lower bound measure the detection sensitivity of the method, by the small hidden spore to variable concentrations The detection of worm recombiant plasmid standard substance.The sensitivity of Taqman sonde method fluorescence quantitative PCR detection method is 100 times of regular-PCR, On the one hand trace it to its cause is the high sensitivity itself having due to Taqman sonde method fluorescence quantitative PCR detection method, on the other hand We have employed the target gene of high copy.Fig. 3, it is seen that under optimum reaction condition, 1 Cryptosporidum parvum (is about as much as The Cryptosporidum parvum standard substance plasmids of 10 copies) the Ct value about 32.5 of DNA extraction thing starting template, therefore reaction cycle Number 40(about 60～90min) can significantly meet lowest detection requirement, than regular-PCR complete primary first-order equation save general one little Time, and without electrophoresis, not only facilitate operation but also decrease pollution.Repeat in same specimen is tested the amplification curve of test It will be seen that in the early stage of amplification, particularly near fluorescence marginal value (threshold), curve co-insides is preferable；Figure 5 visible in Taqman sonde method quantitative fluorescent PCR specificity verification we respectively with positive control, negative control and to be measured Sample carries out the reaction of Taqman sonde method quantitative fluorescent PCR, and acquired results fits like a glove with expection, without non-specific amplification.

Additionally, the present invention compared with prior art has the further advantage that

1. immuno magnetic cell separation method of purification can efficiently separate Cryptosporidum parvum, its have required time short (less than Isolated and purified work just can be completed) in one working day.High specificity, the feature that sensitivity is high, is a kind of accurate and quick Microorganism isolation and purification method.

2.Taqman sonde method fluorescence quantifying PCR method is easy, quick, and whole invention (including sample-adding) can be little one and half Time interior complete, result reported automatically by computer, it is not necessary to follow-up work, decreases workload.

3. the Cryptosporidum parvum detection method of the present invention is proved by test, and its sensitivity exceeds than traditional method Nearly 100 times, considerably beyond traditional method.

Accompanying drawing explanation

Hereinafter, describe embodiment of the present invention in detail in conjunction with accompanying drawing, wherein:

Fig. 1 shows Magnetic activated cell sorting concrete operations flow process；In figure, 1 is biotinylated antibody, and 2 is strepto-biscuit porcelain Pearl, 3 is fluidic cell pipe, and 4 is magnetic frame；

Fig. 2 shows positive Cryptosporidum parvum recombiant plasmid sequencing result；

Fig. 3 shows that Cryptosporidum parvum recombiant plasmid standard substance dilute gradient 10⁸-10⁰The Taqman sonde method of copy/μ l Fluorescent quantitative PCR curve；

Fig. 4 shows that Cryptosporidum parvum recombiant plasmid standard substance dilute gradient 10⁸-10⁴The Taqman sonde method of copy/μ l Quantitative fluorescent PCR standard curve；

Fig. 5 shows Taqman sonde method quantitative fluorescent PCR specific detection；Scheming positives control sample is 10⁴Copy/μ l Cryptosporidum parvum recombiant plasmid standard substance, negative sample is 10³CFU/ml escherichia coli, Cryptosporidum parvum represents treats test sample Product are 10³Individual/ml Cryptosporidum parvum suspension DNA extraction thing, by the Ct value of Taqman sonde method quantitative fluorescent PCR according to mark Directrix curve, calculates the relation of Cryptosporidum parvum number and its DNA content；

Fig. 6 shows the biotinylation Cryptosporidum parvum of Taqman sonde method fluorescence quantitative PCR detection difference final concentration Cp23 monoclonal antibody is coated strepavidin magnetic beads, the response rate of immuno magnetic cell separation purification Cryptosporidum parvum；

Fig. 7 shows that Taqman sonde method fluorescence quantitative PCR detection difference is coated the time, and immuno magnetic cell separation purification is small hidden The sporozoan response rate；

Fig. 8 shows Taqman sonde method fluorescence quantitative PCR detection difference capture time, and immuno magnetic cell separation purification is small hidden The sporozoan response rate；

Fig. 9 shows that Taqman sonde method fluorescence quantitative PCR detection immuno magnetic cell separation purification contains Cryptosporidum parvum The sensitivity of water sample；In figure, sample is 10^-1-10⁶The water sample of individual/ml Cryptosporidum parvum is through immuno magnetic cell separation purification DNA extraction thing, by the Ct value reference standards curve of Taqman sonde method quantitative fluorescent PCR, detects immuno magnetic cell separation pure Change the sensitivity of Cryptosporidum parvum suspension sample；

Figure 10 shows that Taqman sonde method fluorescence quantitative PCR detection immuno magnetic cell separation purification contains Cryptosporidum parvum The sensitivity of fecal specimens；In figure, sample is 10^-1-10⁶Individual/g Cryptosporidum parvum fecal specimens is through immuno magnetic cell separation purification DNA extraction thing, by the Ct value reference standards curve of Taqman sonde method quantitative fluorescent PCR, detect immuno magnetic cell separation The sensitivity of purification Cryptosporidum parvum fecal specimens；

Figure 11 shows the specific detection of immuno magnetic cell separation purification system；Wherein, M is DL2000 labelling, and 1 is small hidden The negative control sample of sporozoon DNA, 2 is the negative control sample of e. coli dna, and 3 is that the Cryptosporidum parvum DNA positive is right Product in the same old way, 4 is e. coli dna positive control sample, and 5 is 10³Individual/ml Cryptosporidum parvum suspension is pure through immuno magnetic cell separation The DNA extracted after change, 6 is 10³The DNA that individual/g Cryptosporidum parvum fecal specimens extracts after purification through immuno magnetic cell separation, 7 are 10³The DNA that CFU/g escherichia coli suspension extracts after purification through immuno magnetic cell separation, 8 is 10³CFU/g escherichia coli fecal specimens Through the DNA that immuno magnetic cell separation extracts after purification；

Figure 12 shows to detect the detection number of Cryptosporidum parvum in 50 water samples；In figure, ▲ represent the use present invention Detection method detection water sample, ● represent and use IFA method detection water sample；

Figure 13 shows to detect the detection number of Cryptosporidum parvum in 50 fecal specimens；In figure, ▲ expression uses this Bright detection method detection fecal specimens, ● represent and use IFA method detection fecal specimens.

Detailed description of the invention

Unless specifically stated otherwise, in following example, fecal specimens used is the long pawl infecting or being uninfected by Cryptosporidum parvum Gerbil jird feces, gathers from Institute of Zoology, Academia Sinica's laboratory, and water body example is tap water sample and infects small hidden spore The sewage of sub-worm, gathers from Institute of Zoology, Academia Sinica's laboratory.

Unless specifically stated otherwise, reagent used in following example is analytical pure level reagent, and can be from regular distributor Available from.

Embodiment 1: prepared by the sample of Cryptosporidum parvum immuno magnetic cell separation purification system (IMS)

One, material: strepavidin magnetic beads (Streptavidin Particles Plus-DM) is purchased from BD company；Small hidden spore Sub-worm suspension is preserved by Institute of Zoology, Academia Sinica.

The preparation of other reagent:

The preparation of the phosphate buffer (PBS) (pH=7.4) containing 3% bovine serum albumin (BSA):

Potassium dihydrogen phosphate (KH₂PO₄): 0.27g；

Disodium hydrogen phosphate (Na₂HPO₄): 1.42g；

Sodium chloride (NaCl): 8g；

Potassium chloride (KCl): 0.2g；

Bovine serum albumin (BSA): 3g；

Add deionized water about 800 μ l to be sufficiently stirred for dissolving, be subsequently adding concentrated hydrochloric acid and adjust pH to 7.4, last constant volume to 1L.High Room temperature preservation after temperature autoclaving.

Two, the set-up procedure of magnetic bead

1. jiggle dress magnetic bead bottle, suspension magnetic bead, it is thus achieved that the suspension of uniformity.

The most as required, the phosphate buffer (PBS) (pH=7.4) of 3% bovine serum albumin (BSA) of transfer appropriate amount arrives In the fluidic cell pipe of standby 12mm × 75mm.

3. pipe is placed on magnetic frame 6-8min, in separation process, pipe is not lifted down from magnetic frame.

4. with pipettor, supernatant in pipe is removed (now pipe is placed on magnetic frame), it is to avoid pipettor gun head touches inside pipe wall (because magnetic bead is attached to inside pipe wall).

5. from magnetic frame, take off pipe, add phosphate buffer (the PBS) (pH=of 3ml3% bovine serum albumin (BSA) 7.4), phosphate buffer is allowed to stay along inside pipe wall (at magnetic bead accumulation) and to suspend gently, buffer consumption and bead suspension Equal-volume.

6. repeat to wash once (step 3-5), be subsequently adding the phosphate buffer (PBS) of 3ml3% bovine serum albumin (BSA) (pH=7.4).It is positioned over room temperature standby.

Three, the set-up procedure of Cryptosporidum parvum suspension

1. testing sample is made 1ml10⁸The liquid storage of individual/ml Cryptosporidum parvum suspension, be specially fecal specimens or Water body example add appropriate aquesterilisa mixing make feces suspension and through 80 mesh metallic sieves filter make Cryptosporidum parvum hang Liquid；Then 1ml10 is taken⁸The liquid storage of individual/ml Cryptosporidum parvum suspension, moves in 1.5ml centrifuge tube, 3000r min^-1Centrifugal 10min abandons supernatant.

2. it is centrifuged after repeatedly rinsing with the phosphate buffer (PBS) (pH=7.4) of 3ml3% bovine serum albumin (BSA) and abandons Clearly, precipitation is retained.

3. deposit is diluted resuspended with the phosphate buffer (PBS) (pH=7.4) of 3% bovine serum albumin (BSA), system Standby one-tenth 10³The Cryptosporidum parvum suspension of individual/ml.It is positioned over room temperature standby.

Maybe the water body example room temperature of the 1L gathered is stood after 48h, light and slow take upper strata water sample, to residue about 400ml；Again By remaining 400ml sample, 5000r min^-1Centrifugal 10min, abandons supernatant.

Then, by precipitate phosphate buffer (PBS) (pH=7.4) weight containing 3ml3% bovine serum albumin (BSA) Outstanding, place room temperature standby.

The foundation of embodiment 2:Taqman sonde method fluorescence quantitative PCR detection system

One, material: Cryptosporidum parvum suspension (separating according to the method described in embodiment 1) and escherichia coli are (purchased from U.S. State's Type Culture Collection, preserving number is ATCC8739) Peasy-T1 carrier and Trans1T1 competent cell be purchased from TransGenBiotech company.

Two, toolenzyme: Taqmix is purchased from TaKaRa company.

Three, reagent:

Primer and Taqman sonde method PCR kit for fluorescence quantitative are purchased from TaKaRa company；IPTG, X-gal, DNA marker (marker), genome DNA extracting reagent kit, agarose DNA glue reclaim test kit and the little extraction reagent kit of plasmid purchased from TIANGEN Company.

The preparation of other reagent:

Potassium dihydrogen phosphate (KH₂PO₄): 0.27g；

Disodium hydrogen phosphate (Na₂HPO₄): 1.42g；

Sodium chloride (NaCl): 8g；

Potassium chloride (KCl): 0.2g；

Bovine serum albumin (BSA): 3g

Add deionized water about 800ml to be sufficiently stirred for dissolving, be subsequently adding concentrated hydrochloric acid and adjust pH to 7.4, last constant volume to 1L.High Room temperature preservation after temperature autoclaving.

Four, Cryptosporidum parvum preparation of samples

By in embodiment 1 the 10 of preparation³The small hidden spore suspension of individual/ml and prepared isolated and purified after multigelation After Cryptosporidum parvum suspension (by the operation of TIANGEN company genome DNA extracting reagent kit description) extract small hidden spore The DNA of sub-worm.Be positioned over-20 DEG C standby.

Five, PCR amplifying target genes fragment

1. Cryptosporidum parvum DNA genetic fragment PCR amplification system and amplification condition are as follows:

By the special forward primer P1 of Cryptosporidum parvum, special downstream primer P2, micro-with prepare after isolated and purified The suspension genomic DNA of little Cryptosporidium is template PCR amplifications.

(1) primer sequence is:

Specific upstream primer P1(SEQ ID NO:1)

5'-TTCCGTCAATTCCTTTAAG-3'ˊ

Specific Down Stream primer P2(SEQ ID NO:2)

5'-TACCGTCGTAGTCTTAAC-3'

(2) reaction system is:

(3) reaction condition is: 95 DEG C of 4min, circulates for the first step；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s are second step 30 Circulation；The PCR amplification of 72 DEG C of 10min, the long 144b of amplified fragments, particularly as follows: TTCCCCAGAACCCAAAGACTTTGATTTCTCATAAGGTGCTGAAG GAGTAAGGAACAACCTCCAATCTCTAGTTGGCATAGTTTAT(SEQ ID NO:6), its black underlined part of getting the bid is respectively the reverse complementary sequence of upstream specific primer and downstream primer, mark What black italic was framed part is Taqman fluorescence probe primer.

2.PCR product electrophoresis: 50 μ l amplified productions carry out 1% agarose gel electrophoresis, electrophoresis time 30min.

3.PCR product glue reclaims purification (reclaiming the operation of test kit description by TIANGEN company agarose DNA glue).

Six, the structure of gene clone carrier:

1.Peasy-T1 carrier (TransGenBiotech company) and the connection of PCR primer

Coupled reaction system is as follows:

2.25 DEG C connect 5-10min.Connection product is directly used in conversion Trans1-T1 competent cell and (presses TransGenBiotech company's T rans1-T1Phage Resistant Chemically CompetentCell description is grasped Make).And carry out the blue white macula screening of Cryptosporidum parvum recombiant plasmid.

3. extract plasmid (operating by TIANGEN company plasmid little extraction reagent kit description) by gained plasmid in-20 DEG C of guarantors Deposit standby.

4. the qualification of recombiant plasmid

1) PCR identifies: carry out PCR amplification after the plasmid of extraction is diluted 100 times as stated above as template, and PCR expands Increasing system and amplification condition are the same.

2) order-checking is identified: with Peasy-T1 vector primer (M13R:5'-CAGGAAACAGCTATGACC-3'(SEQ ID NO:8)) as sequencing primer, the Cryptosporidum parvum plasmid of extraction send Hua Da gene technology company limited carry out sequence survey Fixed.Sequencing result is as in figure 2 it is shown, sequencing result shows the Cryptosporidum parvum construction of recombinant plasmid success of positive colony.

Seven, Taqman sonde method fluorescence quantitative PCR detection Cryptosporidum parvum.

1. the determination of standard curve template amount:

OD is measured after the positive Cryptosporidum parvum recombiant plasmid identified is diluted 100 times as standard substance₂₆₀Reading, meter Calculate the copy number in 1 μ l.

1bp=330 dalton's molal weight (MW)=2904bp × 660 1OD₂₆₀=50μg/ml

Mass concentration=OD₂₆₀× 50 μ g/ml × extension rate

Molar concentration=mass concentration ÷ MW

Copy/μ l=molar concentration × 6.02 × 10²³(Avogadro constant number)

2.Taqman sonde method fluorescence quantitative PCR detection:

1) Taqman fluorescence probe primer P3(SEQ ID NO:3)

5'FAM-TCAGCCTTGCGACCATACTCC-TAMRA3'

2) Taqman sonde method quantitative fluorescent PCR reaction system:

3) Taqman sonde method quantitative fluorescent PCR reaction condition: 95 DEG C of 30s, circulates for the first step；95 DEG C of 5s, 60 DEG C 34s, for second step 40 circulation.

3. drafting and the sensitivity of standard curve is verified:

Positive Cryptosporidum parvum recombiant plasmid after identifying carries out 10 times of doubling dilutions, Concentraton gradient as standard substance It is 10⁸-10⁰Copy/μ l Cryptosporidum parvum recombiant plasmid standard substance, are separately added into the micro-of variable concentrations in each reaction tube Little Cryptosporidium recombiant plasmid standard substance 1 μ l uses Agilent MxPro fluorescent quantitation as standard form under optimum reaction condition PCR instrument, uses above-mentioned Taqman sonde method fluorescence quantifying PCR method to detect, and result is as it is shown on figure 3, minimum can detect that Cryptosporidum parvum recombiant plasmid standard substance less than 10 copy/μ l.Reaction terminate after with the logarithm of initial template copy number as x Axle, with 10⁸-10³Copy/μ l Cryptosporidum parvum recombiant plasmid standard substance Ct value draws standard curve for y-axis, and (sample linearly returns Returning with expection concentration coefficient R value is more than 0.92), result is as shown in Figure 4, it is seen that the standard curve that the present invention obtains is correlated with Coefficient is 0.998, and error is little；From the amplification curve of variable concentrations starting template it can be seen that S curve baseline is smooth, exponential region Substantially, slope is relatively big, and platform area is compiled in together substantially, and these all illustrate that the amplification of template under this condition is ideal.

4. Cryptosporidum parvum DNA content and specific detection

10 will extracted³The small hidden spore suspension DNA of individual/ml as testing sample, 10⁴Copy/μ l Cryptosporidum parvum Recombiant plasmid standard substance are as positive template, and escherichia coli (ATCC8739) DNA is as negative template, and sterilized water is right as blank According to, carry out the reaction of Taqman sonde method quantitative fluorescent PCR, record result.Result is as shown in Figure 5, it is seen that in specific test We are respectively with positive template (10⁴Copy/μ l Cryptosporidum parvum recombiant plasmid standard substance), negative sample (escherichia coli) with And blank (sterilized water) carries out the reaction of Taqman sonde method quantitative fluorescent PCR, acquired results fits like a glove with expection, nothing but Specific amplification.Extract the 10 of 1ml³The small hidden spore suspension DNA final volume of individual/ml is 20 μ l.Take 1 μ l to visit as Taqman The template of skill of handling needles quantitative fluorescent PCR, detecting its DNA content is 5.02 × 10²Copy, then 10³Individual Cryptosporidum parvum is corresponding DNA content is 10.4 × 10³Copy, the DNA content that each Cryptosporidum parvum is corresponding is about 10 copies.

Embodiment 3: the detection method optimal detection condition of Cryptosporidum parvum, the checking of Sensitivity and Specificity

One, material: strepavidin magnetic beads (Streptavidin Particles Plus-DM) and magnetic frame (CellSeparation Magnet) is purchased from BD company；Cryptosporidum parvum suspension (separates according to the method described in embodiment 1) With escherichia coli (purchased from American Type Culture Collection center, preserving number is ATCC8739)；Biotinylation Cryptosporidum parvum Cp23 monoclonal antibody (Anti-Immunodominantantigen Cp23) is purchased from Hua Da albumen company.

Two, toolenzyme: 2 × Taqmix is purchased from TaKaRa company.

Three, primer and Taqman sonde method PCR kit for fluorescence quantitative are purchased from TaKaRa company；Agarose, DNA marker (marker), genome DNA extracting reagent kit is purchased from TIANGEN company.

Four, the optimum final concentration checking of the coated strepavidin magnetic beads of biotinylation Cryptosporidum parvum Cp23 monoclonal antibody

Streptavidin MagneSphere is that different kinds of molecules levels operation, affine purification and various biological detection provide one very well Carrier.Acquisition target molecule has direct method or indirect method.In indirect method, in sample, first add biotinylated ligands, its Formation complex is combined with specific target molecule.This complex is hatched jointly with the magnetic bead for capture.In view of biotin and chain The strong affinity of mould Avidin, quickly combining vigor, indirect prize law can be applicable to part-target molecule, and to combine power low or affine In the invention that power is weak, so that non-specific binding minimizes.This method applies also for that ligand concentration is low, part-target molecule combines Need in the invention of the suitableeest space conformation and real liquid kinetic.

1. calculate magnetic bead and biotinylated antibody institute expense.Every mg Streptavidin MagneSphere needs about 5-20 μ g biological Elementization antibody.According to antiserum volume, magnetic bead is combined the impact of monoclonal antibody, then with the phosphorus of 3% bovine serum albumin (BSA) The biotinylation Cryptosporidum parvum Cp23 monoclonal antibody that phthalate buffer (PBS) (pH=7.4) dilutes is coated final concentration of 20 μ g/ml strepavidin magnetic beads, arranging antibody final concentration gradient is 2ng/ml, 5ng/ml, 10ng/ml, 20ng/ml and 50ng/ml, takes The fluidic cell pipe of 12mm × 75mm, each fluidic cell pipe addition is 1ml.

The most above-mentioned phosphate buffer (the PBS) (pH=adding 2ml3% bovine serum albumin (BSA) at each fluidic cell pipe 7.4), ready strepavidin magnetic beads and biotinylated antibody are at room temperature hatched 15min, slowly shakes.

3. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

4. wash magnetic bead 3 times with the phosphate buffer (PBS) (pH=7.4) of 3ml3% bovine serum albumin (BSA), discard Clearly, assist with magnetic frame.

5. it is 10 by concentration prepared by the method as described in embodiment 1 of purification to be separated³The Cryptosporidum parvum of individual/ml Suspension joins in system, and often pipe addition is 1ml.And add the phosphate buffer of 2ml3% bovine serum albumin (BSA) (PBS) (pH=7.4).

6. strepavidin magnetic beads and biotinylated antibody complex are at room temperature hatched with Cryptosporidum parvum sample 15min, slowly shakes.

7. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

8. wash magnetic bead 3 times with the phosphate buffer (PBS) (pH=7.4) of 3ml3% bovine serum albumin (BSA), use magnetic force Frame assists.

9. by the Cryptosporidum parvum suspension 3000r min after isolated and purified^-1Centrifugal 10min, supernatant discarded.

Precipitation is resuspended with 200 μ l aquesterilisa 10., and be transferred in 2ml cryopreservation tube, multigelation (liquid nitrogen 5min, 65 DEG C Water-bath 5min) 3 times.

11. prepared by method as described in embodiment 1 isolated and purified after multigelation after Cryptosporidum parvum suspension (by the genome DNA extracting reagent kit description operation of TIANGEN company) extracts the DNA of Cryptosporidum parvum, is positioned over-20 DEG C Standby.

12. use the Taqman sonde method fluorescence quantifying PCR method in embodiment step 2 detect and compare different final concentration Biotinylation Cryptosporidum parvum Cp23 monoclonal antibody be coated the isolated and purified recovering effect of strepavidin magnetic beads, result such as figure Shown in 6, it was demonstrated that biotinylation Cryptosporidum parvum Cp23 monoclonal antibody is coated the strepavidin magnetic beads of final concentration of 20 μ g/ml The final concentration of 20ng/ml of optimum response, the response rate is 72.14%.

Five, biotinylation Cryptosporidum parvum Cp23 monoclonal antibody Optimal packet is by the checking of time

1. take the fluidic cell pipe of 12mm × 75mm, add the phosphate buffer of 3ml3% bovine serum albumin (BSA) (PBS), after (pH=7.4), biotinylation Cryptosporidum parvum Cp23 monoclonal antibody is added so that it is final concentration of 20ng/ml.

2. in above-mentioned system, add strepavidin magnetic beads, final concentration of 20 μ g/ml, hatch the most respectively 15min, 30min and 60min, slowly shakes.

3. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

4. wash magnetic bead 3 times with the phosphate buffer (PBS) (pH=7.4) of 3ml3% bovine serum albumin (BSA), use magnetic force Frame assists.

5. it is 10 by concentration prepared by the method as described in embodiment 1 of purification to be separated³The Cryptosporidum parvum of individual/ml Suspension joins in system, and often pipe addition is 1ml.

6. magnetic bead and biotinylated antibody complex are at room temperature hatched 15min, slowly with Cryptosporidum parvum suspension Concussion.

7. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

11. by the Cryptosporidum parvum suspension after isolated and purified after step 10 multigelation (by TIANGEN company gene Group DNA extraction kit description operation) extract Cryptosporidum parvum DNA, be positioned over-20 DEG C standby.

When Taqman sonde method fluorescence quantifying PCR method in 12. employing embodiment 2 steps 2 detects more different being coated Between immuno magnetic cell separation purification recovering effect, result is as shown in Figure 7, it was demonstrated that biotinylation Cryptosporidum parvum Cp23 monoclonal anti The Optimal packet of body is 30min by the time, and the response rate is 96.15%；And along with the increase in response time, nonspecific reaction increases, And increase over time the coacervation between magnetic bead and can not ignore, after reaction 1h, have obvious agglomeration.

Six, the checking of immunocapture Cryptosporidum parvum optimal time

2., in above-mentioned system, add strepavidin magnetic beads, final concentration of 20 μ g/ml, at room temperature hatch 30min, slowly Concussion.

3. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

6. magnetic bead and biotinylated antibody complex and Cryptosporidum parvum suspension are hatched the most respectively 15min, 30min and 60min, slowly shakes.

7. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

9. by the Cryptosporidum parvum suspension sample 3000r min after isolated and purified^-1Centrifugal 10min, supernatant discarded.

11. by the Cryptosporidum parvum suspension after isolated and purified after multigelation (by TIANGEN company genomic DNA Extract test kit description operation) extract Cryptosporidum parvum DNA.Be positioned over-20 DEG C standby.

When Taqman sonde method fluorescence quantifying PCR method in 12. employing embodiment steps 2 detects more different capture Between, immuno magnetic cell separation purification recovering effect, as shown in Figure 8, result shows that immunocapture optimal time is 30min to result, returns Yield is 98.14%；And along with the increase in response time, nonspecific reaction increases, and increase over time between magnetic bead Coacervation can not ignore, reaction 1h after, have obvious agglomeration.

Seven, the sensitivity checking of immuno magnetic cell separation purification Cryptosporidum parvum

1. take 1ml10 prepared by the method as described in embodiment 1⁸Individual/ml Cryptosporidum parvum suspension, uses 3% Ox blood serum The phosphate buffer (PBS) (pH=7.4) of albumen (BSA) carries out 10 times of gradient dilutions, and preparing Concentraton gradient is 10^-1-10⁶Individual/ Ml Cryptosporidum parvum suspension and 10^-1-10⁶The fecal specimens of individual/g is testing sample, if detected sample is feces, by feces Sample adds the mixing of appropriate aquesterilisa and makes feces suspension and filter through 80 mesh metallic sieves.

2. by above-mentioned immuno magnetic cell separation method of purification (IMS) isolated and purified after, (by TIANGEN company extracting genome DNA Test kit description operates) extract DNA and use the Taqman sonde method fluorescent quantitative PCR method in embodiment step 2 Detect the Ct value of small hidden spore suspension gradient dilution DNA.Result is as shown in Figure 9, it is seen that under optimum reaction condition, small hidden In sporozoon water sample, the Cryptosporidum parvum less than 10 (is about as much as 10-10²The Cryptosporidum parvum restructuring matter of copy Grain standard substance can be detected.As shown in Figure 10, it is seen that under optimum reaction condition, Cryptosporidum parvum feces is less than 100 Individual Cryptosporidum parvum (is about as much as 10²-10³The Cryptosporidum parvum recombiant plasmid standard substance of copy) can be detected, and Can also be detected less than 10 Cryptosporidum parvums, but testing result repeatability is poor.

Eight, immuno magnetic cell separation purification Cryptosporidum parvum specificity verification

1. the concentration prepared with the method as described in embodiment 1 is for 10³Individual/ml Cryptosporidum parvum suspension and 10³Individual/g is micro- The feces of little Cryptosporidium, 10³CFU/ml escherichia coli suspension is (by identical with preparing Cryptosporidum parvum suspension in embodiment 1 Method prepare) and 10³The colibacillary feces of CFU/g is testing sample, if detected sample is feces, is added by fecal specimens Enter the mixing of appropriate aquesterilisa make feces suspension and filter through 80 mesh metallic sieves, make Cryptosporidum parvum suspension or large intestine Bacillus suspension.

By the isolated and purified detected sample of above-mentioned immuno magnetic cell separation method of purification (IMS).

Carry the most respectively isolated and purified after Cryptosporidum parvum suspension and the genomic DNA of escherichia coli suspension, and extract Testing sample 10³The Cryptosporidum parvum suspension of individual/ml and 10³The genomic DNA of the escherichia coli suspension of CFU/ml is as the positive Control sample, sterilized water is as negative control sample.

3. by the special forward primer P1 of Cryptosporidum parvum, special downstream primer P2, with prepare after isolated and purified The genomic DNA of Cryptosporidum parvum suspension, the positive control sample (PCR of the genetic fragment of the Cryptosporidum parvum of empirical tests Product) and negative control sample (with sterilized water as negative controls) as template PCR amplifications.

(1) primer sequence is:

Specific upstream primer P1(SEQ ID NO:1)

5'-TTCCGTCAATTCCTTTAAG-3'ˊ

Specific Down Stream primer P2(SEQ ID NO:2)

5'-TACCGTCGTAGTCTTAAC-3'

(2) reaction system is:

(3) reaction condition is: 95 DEG C of 4min, circulates for the first step；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s are second step 30 Individual circulation；The PCR amplification of 72 DEG C of 10min.

4. by colibacillary special forward primer P4, special downstream primer P5, with the isolated and purified rear large intestine prepared The suspension genomic DNA of bacillus, positive control sample (empirical tests is crossed, the PCR primer of bacillus coli gene fragment, and sequence is:ACCAGTTTGCCGGAACAGTGGGCAGACCGTTTTCGACTTCGCTTTCGACATAAA TCAGGGCTTCGTCAGCCAGCCAGCCGTTATCTTCCAGTAAATTTATCGTCTCTT (SEQID NO:7), its black underlined part of getting the bid is respectively the reverse of special forward primer P4 and special downstream primer P5 Complementary series) and negative control sample (with sterilized water as negative controls) as template PCR amplifications.

(1) primer sequence is:

Specific upstream primer P4(SEQ ID NO:4)

5'-TTTTCCCGATGTAATG-3'ˊ

Specific Down Stream primer P5(SEQ ID NO:5)

5'-GCCGTGGCTTGTTAG-3'

(2) reaction system is:

(3) reaction condition is: 94 DEG C of 5min, circulates for the first step；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s are second step 30 Individual circulation；The PCR amplification of 72 DEG C of 5min.Pcr amplification product carries out 1% agarose gel electrophoresis, pure to detect immuno magnetic cell separation The specificity of change system (IMS).

Shown in fruit as cementing in Figure 11 nucleic acid, it is seen that 5-6 swimming lane be isolated and purified after Cryptosporidum parvum DNA cloning product For 144bp, consistent with positive control sample, illustrate that immuno magnetic cell separation purification system (IMS) can isolate small hidden spore Worm.Swimming lane 7-8 is separated colibacillary DNA after purification, and without amplified production, its positive control sample band is 139bp, Illustrate that immuno magnetic cell separation purification system (IMS) does not isolates escherichia coli.Swimming lane 1-2 is negative control sample, all without amplification Band.Therefore, acquired results fits like a glove with expection, and this system has specificity to Cryptosporidum parvum.

Embodiment 4: the preparation of Cryptosporidum parvum detection kit and water sample and the detection of fecal specimens

One, material: fecal specimens (50)；Water sample (50)；Magnetic frame (Cell SeparationMagnet) is purchased from BD company.

Two, the preparation of test kit:

Reagent A: strepavidin magnetic beads 5ml.(BD company, the U.S.)

Reagent B: biotinylated Cryptosporidum parvum Cp23 monoclonal antibody 1 μ g/ μ l, 20 μ l.(Hua Da albumen company, Beijing, China)

Reagent C: 10 × immuno magnetic cell separation purification system buffer, the phosphate buffer of 3% bovine serum albumin (BSA) (PBS) prepared by (pH=7.4):

Potassium dihydrogen phosphate (KH₂PO₄): 0.27g

Disodium hydrogen phosphate (Na₂HPO₄): 1.42g

Sodium chloride (NaCl): 8g

Potassium chloride (KCl): 0.2g

Bovine serum albumin (BSA): 3g

Add deionized water about 80ml to be sufficiently stirred for dissolving, be subsequently adding concentrated hydrochloric acid and adjust pH to 7.4, last constant volume to 100ml. 4 DEG C of preservations after autoclave sterilization.(during use, 10 times of dilutions need to be carried out with aquesterilisa)

Reagent D: the Cryptosporidum parvum recombiant plasmid standard substance that embodiment 2 builds: 6 pipes, often pipe 100ul, content is respectively It is: 0 copy/μ l, 10⁴Copy/μ l, 10⁵Copy/μ l, 10⁶Copy/μ l, 10⁷Copy/μ l, 10⁸Copy/μ l.

Reagent E: special for Cryptosporidum parvum forward primer P1 and special downstream primer P2 is mixed in 1:1 ratio, altogether 200ul。

Reagent G: fluorescence quantitative PCR reaction solution, 5ml.By 2 × Premix EX Taq, 50 × ROXReference Dye II and sterilized water in 10:0.4:7 ratio mix.

Often pipe Taqman sonde method quantitative fluorescent PCR reaction system is 20 μ l: need 17.4 μ l reagent G(comprise 2 × Premix EX Taq10μl；50×ROX Reference Dye Ⅱ0.4μl；Sterilized water 7 μ l；), 0.8 μ l reagent E (comprises Trip special primer P10.4 μ l；Downstream special primer P20.4 μ l), 0.8 μ l reagent F and 1 μ l Cryptosporidum parvum DNA profiling.

Other reagent: genome DNA extracting reagent kit is purchased from TIANGEN company.

Three, fecal specimens processes

1. weighing 50 each 2g of fecal specimens, each fecal specimens is divided into 2 parts, every part of 1g, it is mixed in 10ml respectively and goes out In bacterium water.

2. 100 parts of feces are added appropriate aquesterilisa, be prepared as suspension and filter through 80 mesh metallic sieves, 3000r min^-1Centrifugal 10min.Abandon supernatant, retain precipitation (1623 methods that each fecal specimens is formulated with EPA EPA respectively-exempt from Epidemic disease fluorescence analysis method IFA and detection method analysis of the present invention).

3. by 100 parts of precipitate phosphate buffer (PBS) (pH=7.4) containing 3ml3% bovine serum albumin (BSA) Resuspended, place room temperature standby.

Four, water body example processes

1. the water body example room temperature of 50 1L gathered is stood after 48h, light and slow take upper strata water sample, left to residue 400ml Right.

2. remaining 400ml sample is uniformly divided into 2 parts, every part of 200ml, 5000r min^-1Centrifugal 10min, abandons supernatant (1623 methods-immunofluorescence analysis method IFA and of the present invention that each water body example is formulated with EPA EPA respectively Detection method analysis).

Five, the Cryptosporidum parvum in water sample and fecal specimens is isolated and purified

2., in above-mentioned system, add final concentration of 20 μ g/ml strepavidin magnetic beads and at room temperature hatch 30min, slowly shake Swing.

3. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

4. wash magnetic bead 3 times with the phosphate buffer (PBS) (pH=7.4) of 3ml3% bovine serum albumin (BSA), use magnetic force Frame assists, supernatant discarded.

5. night soil-treatment sample and the water body of purification to be separated are processed the i.e. Cryptosporidum parvum suspension of sample and join body In system, often pipe addition is 3ml.

6. magnetic bead and biotinylated antibody complex are at room temperature hatched 30min with Cryptosporidium sample, slowly shake.

7. fluidic cell pipe is placed in magnetic frame 6-8min, supernatant discarded.

8. with the phosphate buffer PBS(pH=7.4 of 3ml3% bovine serum albumin (BSA)) wash magnetic bead 3 times, use magnetic frame Auxiliary.

9. by the Cryptosporidium suspension sample 3000r min after isolated and purified^-1Centrifugal 10min, supernatant discarded, obtain precipitation.

Six, the detection of the Cryptosporidum parvum in water sample and fecal specimens

Above-mentioned precipitation is resuspended with 200 μ l aquesterilisa respectively 1., and be transferred in 2 μ l cryopreservation tubes, multigelation (liquid nitrogen 5min, 65 DEG C of water-bath 5min) 3 times.

2. the Cryptosporidum parvum suspension after isolated and purified after multigelation (is carried by TIANGEN company genomic DNA Take test kit description operation) extract Cryptosporidum parvum DNA, be positioned over-20 DEG C standby.

3. formulate the standard curve of Cryptosporidum parvum recombiant plasmid standard substance；

1) by the special forward primer P1 of Cryptosporidum parvum, special downstream primer P2 and Taqman fluorescent quantitation probe Primer P3, carries out Taqman sonde method fluorescent quantitative PCR with Cryptosporidum parvum recombiant plasmid standard substance for template, reaction System is:

2) reaction condition is: 95 DEG C of 30s, circulates for the first step；95 DEG C of 5s, 60 DEG C of 34s, second step 40 circulation Taqman sonde method fluorescent quantitative PCR.

3) with the logarithm of template copy numbers as X-axis, standard curve is drawn with Ct value for y-axis.

4. carry out Taqman sonde method fluorescent quantitation from Cryptosporidum parvum suspension DNA after purification for template with extract PCR expands.

The result of 5.Taqman sonde method fluorescent quantitative PCR contrasts with Cryptosporidum parvum standard curve, is computed (copy number × extension rate/10) draw Cryptosporidum parvum number contained in testing sample.

Seven, testing result

1623 methods of EPA EPA formulation to the detection method that Cryptosporidium in water is the most authoritative, i.e. immunofluorescence Analysis method (immunofluorescence antibody, IFA), but owing to Cryptosporidium concentration in water may be the lowest, must Must carry out concentrating and enrichment reaches a chroma order and could effectively measure, and need the separation of complexity, extract, reflect Other process.The present invention have detected 50 water samples and 50 fecal specimens, compares with immunofluorescence assay (IFA), compares The present invention carries out specificity and sensitivity Detection (see Tables 1 and 2), and the present invention reaches 95%(21/22 to the specificity of water sample), 100% sensitivity reaches (29/29), and the present invention reaches 91%(20/22 to the specificity of fecal specimens), 100% sensitivity reaches (28/28).

150 water sample testing results of table

250 fecal specimens testing results of table

Result such as Figure 12, uses detection method detection water sample, and minimum can detect that in No. 5 samples contains 4 The Cryptosporidum parvum of left and right, and the number positive using the method for the present invention to detect is 30, and use EPA EPA 1623 method-IFA the methods formulated can't detect in No. 5 samples containing Cryptosporidum parvum, and uses the sun that IFA method detects Property number is 29；Result as shown in figure 13, uses detection method detection fecal specimens, minimum can detect that No. 25 samples In containing the Cryptosporidum parvum of about 95, containing the Cryptosporidum parvum of about 50 in No. 50 samples, and use this The number positive of the method detection of invention is 30, and the 1623 method-IFA methods using EPA EPA to formulate can't detect Containing Cryptosporidum parvum in No. 25 samples and No. 50 samples, and the number positive using IFA method to detect is 28, shows this The Cryptosporidum parvum detection method of invention, its sensitivity has exceeded nearly 100 times than traditional method, considerably beyond tradition Method.It is the sensitiveest that the method for this explanation present invention compares traditional method, and according to traditional technique in measuring likely missing inspection. And use detection method detection drinking water or environmental water sample, can be used to evaluating water quality, detect its pollution level.Also may be used To use the method detection of the present invention to infect Cryptosporidum parvum individuality fecal specimens, can detect whether individuality is felt as early as possible Contaminate Cryptosporidum parvum, and can determine that its infective dose.Testing and appraisal side quickly and accurately is provided for clinical diagnosis and preventing and treating Method.

Claims

1. a detection method for Cryptosporidum parvum, said method comprising the steps of:

2) fluorescence quantitative PCR detection step 1) prepare isolated and purified after Cryptosporidum parvum suspension；

Wherein, described detected sample is selected from water body example and fresh food；Described water body example is by comprising the steps Method obtains: 1L water body example room temperature stood after 48h, light and slow takes upper strata water sample, to remaining 400ml；Again by remaining 400ml Water body example, with 5000r min^-1Rotating speed be centrifuged 10min, abandon supernatant；Then, by precipitate with containing 3ml 3% Ox blood serum The phosphate buffer of albumen is resuspended；

Step 2) described in quantitative fluorescent PCR be Taqman sonde method quantitative fluorescent PCR, wherein Cryptosporidum parvum special on The sequence of trip primer is the nucleotide sequence shown in SEQ ID NO:1；The sequence of the special downstream primer of Cryptosporidum parvum is Nucleotide sequence shown in SEQ ID NO:2；The sequence of Cryptosporidum parvum Taqman fluorescent quantitation probe primer is SEQ ID Nucleotide sequence shown in NO:3, and a reporter fluorescence group of its two ends respectively labelling and a quenching fluorescence group.

The detection method of Cryptosporidum parvum the most according to claim 1, it is characterised in that described step 1) specifically include Following steps:

A1) detected sample is made Cryptosporidum parvum suspension；

B1) reaction system containing the biotinylation Cryptosporidum parvum coated strepavidin magnetic beads of Cp23 monoclonal antibody is prepared；

C1) by step a1) prepared Cryptosporidum parvum suspension adds step b1) in prepared reaction system, in incubated at room；

D1) after hatching sample washing after, resuspended with sterilized water, prepare isolated and purified after Cryptosporidum parvum suspension；Its In, described step 2) specifically include following steps:

A2) extraction step 1) prepare isolated and purified after Cryptosporidum parvum suspension, prepare Cryptosporidum parvum suspension base Because of group DNA；

C2) by the special forward primer of Cryptosporidum parvum and special downstream primer and Taqman fluorescent quantitation probe primer, With step a2) prepared Cryptosporidum parvum DNA is that template carries out fluorescent quantitative PCR；

D2) by step c2) result of fluorescent quantitative PCR contrasts with Cryptosporidum parvum standard curve, draws testing sample Cryptosporidum parvum number contained by.

The detection method of Cryptosporidum parvum the most according to claim 2, it is characterised in that in step c1) in, in room temperature Hatch 15-60min.

The detection method of Cryptosporidum parvum the most according to claim 2, it is characterised in that in step c1) in, in room temperature Hatch 30min.

The detection method of Cryptosporidum parvum the most according to claim 2, it is characterised in that in step b1) in, in reaction In system, the final concentration of 2-50ng/ml of described biotinylation Cryptosporidum parvum Cp23 monoclonal antibody, described strepto-biscuit porcelain The final concentration of 20 μ g/ml of pearl.

The detection method of Cryptosporidum parvum the most according to claim 5, it is characterised in that described biotinylation is small hidden The final concentration of 20-50ng/ml of sporozoon Cp23 monoclonal antibody.

The detection method of Cryptosporidum parvum the most according to claim 5, it is characterised in that described biotinylation is small hidden The final concentration 20ng/ml of sporozoon Cp23 monoclonal antibody.

The detection method of Cryptosporidum parvum the most according to claim 5, it is characterised in that described reaction system is by bag Include to add in fluidic cell pipe biotinylation Cryptosporidum parvum Cp23 monoclonal antibody and strepavidin magnetic beads and hatch 15- The method of 60min prepares.

The detection method of Cryptosporidum parvum the most according to claim 5, it is characterised in that state reaction system by including Biotinylation Cryptosporidum parvum Cp23 monoclonal antibody and strepavidin magnetic beads are added in fluidic cell pipe and hatches 30-60min.

The detection method of Cryptosporidum parvum the most according to claim 5, it is characterised in that state reaction system by bag Include to add in fluidic cell pipe biotinylation Cryptosporidum parvum Cp23 monoclonal antibody and strepavidin magnetic beads and hatch 30min.

The detection method of 11. Cryptosporidum parvums according to claim 2, it is characterised in that described step b2) include with Lower step:

B22) by the special forward primer of Cryptosporidum parvum, special downstream primer and Taqman fluorescent quantitation probe primer, With step b21) prepared Cryptosporidum parvum recombiant plasmid standard substance are that template carries out fluorescent quantitative PCR；

12. according to the detection method of the Cryptosporidum parvum according to any one of claim 1 to 11, it is characterised in that described Water body example is drinking water or sanitary sewage.

13. according to the detection method of the Cryptosporidum parvum according to any one of claim 2 to 11, it is characterised in that described Detection method also includes, at d2) after step, the detection to Cryptosporidum parvum detection method Sensitivity and Specificity, its step Including:

D21) sensitivity Detection of Cryptosporidum parvum detection method；

D22) specific detection of Cryptosporidum parvum detection method.

The detection method of 14. Cryptosporidum parvums according to claim 13, it is characterised in that described step d21) include Following steps:

D211) testing sample being made Concentraton gradient is 10^-1-10⁶The small hidden spore suspension of individual/ml；

D213) by the special forward primer of Cryptosporidum parvum, special downstream primer and Taqman fluorescent quantitation probe primer, With step d212) prepared Cryptosporidum parvum DNA is that template carries out Taqman sonde method fluorescent quantitative PCR.

The detection method of 15. Cryptosporidum parvums according to claim 13, it is characterised in that described step d22) include Following steps:

D221) testing sample being made concentration is 10³The Cryptosporidum parvum suspension of individual/ml, described testing sample also includes 10³The escherichia coli suspension of CFU/ml；

D222) extraction step d221) suspension of prepared Cryptosporidum parvum and the genomic DNA of escherichia coli suspension, and point Take 10 indescribably³The small hidden spore suspension of individual/ml and 10³The genomic DNA of the escherichia coli suspension of CFU/ml is as positive control Sample, sterilized water is as negative control sample；

D223) by the special forward primer of Cryptosporidum parvum, special downstream primer, with step d222) prepared small hidden Sporozoon DNA is that template carries out PCR amplification；

D224) by colibacillary special forward primer, special downstream primer, with step d222) prepared e. coli dna PCR amplification is carried out for template.

The detection kit of 16. 1 kinds of Cryptosporidum parvums, described test kit includes detecting described in any one of claim 1 to 15 The reaction system containing the biotinylation Cryptosporidum parvum coated strepavidin magnetic beads of Cp23 monoclonal antibody in method, small The special forward primer of Cryptosporidium, special downstream primer and Taqman fluorescent quantitation probe primer.

The detection kit of 17. Cryptosporidum parvums according to claim 16, it is characterised in that described test kit also wraps Include Cryptosporidum parvum recombiant plasmid standard substance.

The detection kit of 18. Cryptosporidum parvums according to claim 16, it is characterised in that described small hidden spore The Concentraton gradient of worm recombiant plasmid standard substance is 10⁴-10⁸Copy/μ l.

19. according to the detection kit of the Cryptosporidum parvum according to any one of claim 16～18, it is characterised in that institute The concentration stating biotinylation Cryptosporidum parvum Cp23 monoclonal antibody is 2-50ng/ml, and the end of described strepavidin magnetic beads is dense Degree is 20 μ g/ml.

The detection kit of 20. Cryptosporidum parvums according to claim 19, it is characterised in that described biotinylation is micro- The concentration of little Cryptosporidium Cp23 monoclonal antibody is 20ng/ml.

The detection kit of 21. Cryptosporidum parvums according to claim 19, it is characterised in that described reaction system is also Including immuno magnetic cell separation purification system buffer.

The detection kit of 22. Cryptosporidum parvums according to claim 19, it is characterised in that described test kit also wraps Include fluorescence quantitative PCR reaction solution.