CN110241119A

CN110241119A - Cardiac muscle troponin I specific nucleic acid aptamers and its screening technique and application

Info

Publication number: CN110241119A
Application number: CN201810190653.9A
Authority: CN
Inventors: 罗昭锋; 王进军; 方晓娜; 何磊; 杨伟丽; 何金龙
Original assignee: University of Science and Technology of China USTC
Current assignee: University of Science and Technology of China USTC
Priority date: 2018-03-07
Filing date: 2018-03-07
Publication date: 2019-09-17
Anticipated expiration: 2038-03-07
Also published as: CN110241119B

Abstract

The present invention provides a kind of single stranded DNA nucleic acid aptamers for specifically binding cardiac muscle troponin I (hereinafter referred to as cTnI albumen), and it includes nucleotide sequences shown in any of SEQ ID Nos.1-4.The derivative that aptamer of the invention can also be the higher similar sequence of various homologys or be obtained by sequence of the present invention.For aptamer protein versus antibody of the invention, have many advantages, such as can chemical synthesis, molecular weight it is small, it is stable, be easy to save and mark.The present invention also provides the applications of the single stranded DNA nucleic acid aptamers, they can be used for cTnI protein purification or cTnI Protein Detection either individually or in combination.The present invention also provides a kind of for detecting the kit of cTnI albumen, and it includes single stranded DNA nucleic acid aptamers of the invention.

Description

Cardiac muscle troponin I specific nucleic acid aptamers and its screening technique and application

Technical field

The present invention relates to biological and medical field, in particular to one kind can be used for combining cardiac muscle troponin I (Cardiac Troponin I, cTnI) aptamer and its screening technique and application.

Background technique

Cardiovascular disease is one of the important diseases that today's society influences human health, and the acute heart in cardiovascular disease Flesh infarct is to cause the major reason of death.Myocardial injury markers are the main according to it of diagnosing myocardial infarction extremely One, so there is many diagnostic reagents for being used for early stage myocardial damage blood serum designated object at this stage.Troponin (Troponin, Tn) It is the structural proteins for forming striated muscle filament, subunit I, from the compound of T, C composition is during contraction of muscle and diastole Important function, wherein cardiac muscle troponin I (Cardiac troponin I, cTnI) is a kind of specific proteins of cardiac muscle, There is special clinical value to minor myocardial damage detection, when normal, the cTnI level in circulation is very low, and cardiac muscle cells are damaged After wound, cTnI rapidly enters blood prior to other biochemical indicators, increases in 3-5 hours, with the exacerbation of damage, in blood In concentration constantly increase, peak in 12-36 hours, formed longer time window.A large number of studies show that cTnI is demonstrate,proved It is most special and most sensitive one of the blood serum designated object of myocardial cell injury in fact.Therefore, quick, quick and accurate detection cTnI tool There is important clinical meaning.

CTnI measuring method has enzyme-linked immunization, solid-phase immunity chromatography, radio immunoassay, chemiluminescence point at present Analysis method, colloidal gold method, immunoturbidimetry etc., but there is presently no unified standard determination method, it is different between different manufacturers Methods and results difference is larger, at most can poor decades of times.Many method Shortcomings, such as enzyme-linked immunization, solid-phase immunity chromatography, All there is cumbersome in radio immunoassay, detection time is long, is not suitable for mass detection, as a result poor repeatability, core The problems such as element pollution；And colloidal gold method can only carry out qualitative detection, be unable to quantitative detection.Though it is accurate that chemoluminescence method has, spirit Sensitivity is high, high specificity, the good advantage of precision, but its instrument and reagent price are expensive, at high cost, and it is real to be not suitable for base Room development is tested, while not being suitable for emergency treatment inspection.

Aptamer (aptamer) refers to aglucon phyletic evolution technology (SELEX) the screening separation by index concentration Obtained DNA or RNA molecule, it can be even entire thin with other targets such as protein, metal ion, small molecule, polypeptide Born of the same parents carry out the combination of high-affinity and specificity, therefore in biochemical analysis, environmental monitoring, preclinical medicine, new drug synthesis etc. Show wide prospect.Aptamer molecular weight compared with antibody is small, and stability is more preferable, easily transformation modification, non-immunogenicity, Fabrication cycle is short, it is a series of can to eliminate animal immune, raising, protein extraction and purifying etc. by the advantages such as artificial synthesized Process.There are some researchers to disclose the nucleic acid aptamer sequence for some cTnI albumen that they are had found at present, however, There are some disadvantages for the aptamer of these cTnI albumen, for example, molecular weight is big, for cTnI albumen binding affinity not Too high, specificity is not high, and stability is not high, etc..Therefore, this field is to affine with the higher combination for cTnI albumen There are demands for the aptamer of power.

Summary of the invention

For overcome the deficiencies in the prior art, the problem to be solved in the present invention is to provide one kind to have high degree of specificity, divides The aptamer and its derivative that can combine cTnI albumen that son amount is small, chemical property is stable, is easy to save and mark, also Screening technique and the application of the aptamer are accordingly provided.

In order to solve the above-mentioned technical problem, the present inventor has designed and synthesized random single-stranded DNA banks and corresponding Primer, for screening with high degree of specificity, molecular weight is small, chemical property is stable, be easy to save and what is marked can combine The aptamer of cTnI albumen, thus screening obtains the aptamer of some specific binding cTnI albumen, and has detected The binding ability of they and cTnI albumen.On this basis, the present inventor completes the present invention.

In a first aspect, the present invention provides a kind of method of the aptamer of screening specific binding cTnI albumen, institute State method the following steps are included:

(1) random single-stranded DNA banks and primer shown in following sequence are synthesized:

Random single-stranded DNA banks:

5’-TTCAGCACTCCACGCATAGC-40N-CCTATGCGTGCTACCGTGAA-3’

Wherein, " 40N " indicates the sequence that 40 arbitrary nucleotide bases are formed by connecting.

5 ' end primers: 5 '-FAM-TTCAGCACTCCACGCATAGC

3 ' end primers: 5 '-(20A)-Spacer 18-TTCACGGTAGCACGCATAGG

Wherein, " 20A " indicates that the polyA tail being made of 20 adenylates (A), " Spacer 18 " indicate the six of 18 atoms Arm between ethylene glycol.The structural formula of three kinds " Spacer 18 " is as shown in following formula I-III.

" Spacer 18 " structural formula used in the primer of above-mentioned 3 ' end is shown in formula I.

(2) paramagnetic particle method screens: using EDC (1- (3- dimethylamino-propyl) -3- ethyl-carbodiimide hydrochloride；0.4M water Solution) and NHS (n-hydroxysuccinimide；0.1M aqueous solution) two reagent activated magnetic beads surfaces carboxyl, cTnI albumen is logical The amino coupled on surface is crossed to magnetic bead surfaces；By the magnetic bead for being connected with cTnI albumen and the above-mentioned steps handled through slow refolding strategy (1) it is fished magnetic bead after random nucleic acid library is incubated for 1 hour in magnet, removes supernatant, with screening buffer solution for cleaning magnetic bead 6 times, Abandon supernatant；It is literary as resulting aptamer level-one is screened that the nucleic acid combined on the magnetic bead for being connected with cTnI albumen is heated into separation Library；

(3) it expands: the library that screening obtains in step (2) being subjected to emulsion PCR (emulsion PCR, ePCR) and is expanded Increase, primer using the two kinds of primers referred in step (1), purified with n-butanol by obtained ePCR amplified production；

(4) it prepares the single-stranded library DNA: denaturation buffer (raw work bioengineering is added in product obtained in step (3) (Shanghai) limited liability company: 2x TBE- urea sample buffer, article No.: C506046), denaturation makes DNA unwinding in 10 minutes, complete It is quickly put into mixture of ice and water at rear, ice bath is centrifuged after 1 minute, and all samples are carried out PAGE glue electrophoresis, make lengthening One chain is separated with the chain for having FAM to mark, the chain of gel extraction FAM label, is concentrated after obtaining DNA with super filter tube or n-butanol is dense Contracting purifies to arrive the single-stranded library DNA；

(5) multi-turns screen: the random library in the single-stranded library alternative steps (2) of DNA obtained in step (4) is laid equal stress on The step of multiple above-mentioned (2)~(4)；The DNA detected in multi-round screening process by SPR (surface plasma resonance) method is mono- The enhancing situation in chain library and cTnI protein binding capacity, until the recognition capability satisfaction of cTnI albumen is wanted in the single-stranded library DNA After asking, last wheel is screened into the resulting single-stranded library DNA through cloning and sequencing, obtained sequence DNAMAN RNA structure Software carries out the analysis of secondary structure, is divided into several families according to the similitude of the homology of primary structure and secondary structure, often A family picks out that a free energy is minimum, the most stable of sequence of structure allows Sangon Biotech (Shanghai) Co., Ltd. to close At then detecting every sequence and cTnI protein binding capacity with SPR instrument, using affinity as index, pick out affinity Sequence is the aptamer for specifically binding cTnI albumen.

Wherein, the screening buffer in step (2) is PBS (NaCl:8g/L, KCl:0.2g/L, Na₂HPO₄: 1.15g/L, KH₂PH₄: 0.2g/L, CaCl₂: 0.1g/L, MgCl₂·6H₂O:0.1g/L；PH7.4)

In second aspect, the present invention provides a kind of aptamer for specifically binding cTnI albumen, and it includes SEQ ID Nucleotide sequence shown in any of Nos.1-4, or have with nucleotide sequence shown in any of SEQ ID Nos.1-4 There is high homology and the nucleotide sequence of cTnI albumen can be specifically bound, or by any of SEQ ID Nos.1-4 institute The nucleotide sequence of cTnI albumen can be specifically bound derived from the nucleotide sequence shown.Wherein the high homology can be with Be with nucleotide sequence at least 60% shown in any of SEQ ID Nos.1-4, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% homology.

Preferably, the aptamer of specific binding cTnI albumen of the invention is by any of SEQ ID Nos.1-4 Shown in nucleotide sequence composition.

Wherein nucleotide sequence shown in SEQ ID Nos.1-4 is shown as follows respectively:

SEQ ID No.1 (cTnI-13):

5’-CACGCATAGCTCAGCCGGCAATGAACAACCTCCATTCTAACGCAGTGTTA CCTATGCGT-3’

SEQ ID No.2 (cTnI-13s):

5’-CACGCATAGCTCAGCCGGCAATGAACAACCTCCATTCTAACGCAGTGTTACCTATGCGT-3’

SEQ ID No.3 (cTnI-14):

5’-CACGCATAGCTACGGCGGCTACAATGCAGTGGGGAGGGACTTGTTGTAA CCCTATGCGT-3’

SEQ ID No.4 (cTnI-14s):

5’-CACGCATAGCTACGGCGGCTACAATGCAGTGGGGAGGGACTTGTTGTAACCCTATGCGT-3’

Wherein, in nucleotide sequence shown in above-mentioned SEQ ID Nos.1-4, the sequence that runic is shown indicates that screening obtains The guiding region removed when truncating SEQ ID No.1 and SEQ ID No.3.SEQ ID No.1 clips the sequence that runic is shown and obtains To SEQ ID No.2；SEQ ID No.3 clips the sequence that runic is shown and obtains SEQ ID No.4.

In addition, it should be appreciated by those skilled in the art that can be adapted to above-mentioned nucleic acid as improvement to above-mentioned technical proposal A certain position on the nucleotide sequence of body is modified, for example, phosphorylation, methylation, amination, sulfhydrylation, being replaced with sulphur Oxygen replaces oxygen or connection isotopologue etc. with selenium, and condition is that the nucleic acid aptamer sequence obtained after such modification has in accordance with needing The property wanted, for example, can have combination cTnI albumen equal or higher with the maternal nucleic acids aptamers sequence before modification Affinity, although or affinity be not obviously improved have higher stability.

It should be appreciated by those skilled in the art that as improvement to above-mentioned technical proposal, it can be in above-mentioned aptamer Connect fluorescent material on nucleotide sequence, it is radioactive substance, therapeutic substance, biotin, digoxin, nano luminescent material, small Peptide, siRNA or enzyme label etc., condition are that the nucleic acid aptamer sequence obtained after modifying in this way has desirable property, example Such as, it can have the affinity of combination cTnI albumen equal or higher with the maternal nucleic acids aptamers sequence before modification, though or Right affinity is not obviously improved but has higher stability.

In other words, it is above whether partially replaced or by modification after nucleic acid aptamer sequence, all have protokaryon acid The essentially identical or similar molecular structure of aptamers, physicochemical property and function are all applied to and cTnI protein binding.

As a general technical idea, aptamer of the present invention also may include in following three kinds of sequences Any one:

(1) homology with the nucleotide sequence of aptamer described in aforementioned all technical solutions is 60% or more Nucleotide sequence (such as aforementioned nucleic acid aptamers sequence can be deleted to or be increased the nucleotide of partial complementarity), it is preferable that homologous Property can be 70% or more, 80% or more, 90% or more or 99% or more；It is preferred that any of with SEQ ID Nos.1-4 Shown in nucleotide sequence with 60% or more homology nucleotide sequence, it is preferable that in SEQ ID Nos.1-4 appoint The homology of nucleotide sequence shown in one can be 70% or more, 80% or more, 85% or more, 90% or more, 95% with On or 99% or more；

(2) can hybridize under strict conditions with the nucleotide sequence of aptamer described in aforementioned all technical solutions Nucleotide sequence；Or

(3) RNA sequence of the nucleotide sequence transcription of the aptamer as described in aforementioned all technical solutions；

Wherein, the nucleotide sequence in above-mentioned (1)-(3) can specifically bind cTnI albumen.

In addition, as a general technical idea, the present invention also provides aptamer derivative, the derivative be by The phosphorothioate backbone that the skeleton of the nucleotide sequence of aptamer described in aforementioned all technical solutions derives, or It is the corresponding peptide nucleic acid that aptamer described in aforementioned all technical solutions is transformed into.

The aptamer whether derived above or other derivatives derived all have and are adapted to protokaryon acid The essentially identical or similar molecular structure of body, physicochemical property and function.

In the third aspect, the present invention also provides answering for a kind of aforementioned nucleic acid aptamers or aptamer derivative With.For example, aptamer or derivatives thereof of the invention can be used for cTnI protein purification or detection, the present invention can be used Aptamer or derivatives thereof detect the concentration of cTnI albumen in experimenter's serum, and then whether judge the subject With myocardial cell injury.Preferably, any one or more aptamers shown in SEQ ID Nos.1-4 be can use Carry out cTnI protein purification or detection.It can use any one or more aptamer inspections shown in SEQ ID Nos.1-4 The concentration of cTnI albumen in experimenter's serum is surveyed, and then judges whether the subject has myocardial cell injury.And more into One step, it can diagnose whether the subject suffers from disease relevant to myocardial cell injury based on above- mentioned information, for example, but It is not limited to acute myocardial infarction AMI.

In fourth aspect, the present invention provides a kind of for purifying the kit of cTnI albumen, and the kit includes this hair Aptamer described in bright second aspect.Preferably, the kit includes any one shown in SEQ ID Nos.1-4 Or multiple aptamers or derivatives thereof.It is highly preferred that the kit includes any one shown in SEQ ID Nos.1-4 A or multiple aptamers.

Since aptamer of the invention can specifically bind cTnI albumen, nucleic acid adaptation of the invention can use Body carrys out the cTnI albumen in purification of samples.For example, specific operating procedure can be with are as follows: by SEQ ID when purifying cTnI albumen Any one or more aptamers shown in Nos.1-4 or the sequence after modification are incubated with the sample liquid comprising cTnI albumen It educates, aptamer can specifically bind cTnI albumen, recycle compound, then combining by with high salt or other methods CTnI albumen wash-out is got off, i.e. purifying obtains cTnI albumen；Or first by shown in SEQ ID Nos.1-4 any one or it is more Sequence after a aptamer or modification is fixed on solid-phase matrix, the sample liquid comprising cTnI albumen is slowly flowed through solid Phase matrix, aptamer of the invention can be in conjunction with cTnI protein-specifics without in conjunction with other unrelated proteins, then With buffer solution for cleaning solid-phase matrix, unbonded unrelated protein is removed, then destroys aptamer with high salt or other methods And the combination of cTnI albumen, so that specificity elutes and collects cTnI albumen.Those skilled in the art can be according to actual needs Select purification process appropriate.

At the 5th aspect, the present invention provides a kind of kit for detecting cTnI albumen, and the kit includes the present invention the Aptamer described in two aspects.Preferably, the kit include shown in SEQ ID Nos.1-4 any one or it is more A aptamer or derivatives thereof.It is highly preferred that the kit include SEQ ID Nos.1-4 shown in any one or Multiple aptamers.The kit can be accurately determined the concentration of cTnI albumen in sample.

Further, the present invention provides a kind of kit for detecting cTnI protein concentration in experimenter's serum, the examination Agent box includes aptamer described in second aspect of the present invention.Preferably, the kit includes SEQ ID Nos.1-4 institute Any one or more aptamers shown or derivatives thereof.It is highly preferred that the kit includes SEQ ID Nos.1-4 Shown in any one or more aptamers.The kit can be quick, quick and accurately detects experimenter's serum In cTnI protein concentration can further be judged described tested according to cTnI protein concentration in experimenter's serum detected Whether person has myocardial cell injury.In other words, whether the subject is judged using cTnI protein concentration in experimenter's serum It is a kind of fast and accurately diagnostic method with myocardial cell injury.

The present invention provides a kind of kit for whether having myocardial cell injury for diagnosing subject, the kit packet Include aptamer described in second aspect of the present invention.Preferably, the kit includes and appoints shown in SEQ ID Nos.1-4 One or more of anticipating aptamers or derivatives thereof.It is highly preferred that the kit includes shown in SEQ ID Nos.1-4 Any one or more aptamers.It is highly preferred that the kit includes aptamer shown in SEQ ID No.1. The kit can quickly, it is quick and accurately detect cTnI protein concentration in experimenter's serum, according to it is detected by CTnI protein concentration in examination person's serum can further judge whether the subject has myocardial cell injury.

It will be understood by those skilled in the art that of the invention is used to diagnose the examination whether subject has myocardial cell injury Agent box can be used for diagnosis disease relevant to myocardial cell injury, for example, acute myocardial infarction AMI.

At the 6th aspect, the present invention also provides a kind of method of cTnI protein concentration in detection experimenter's serum, the sides Method is carried out using aptamer described in second aspect of the present invention.Preferably, the method uses SEQ ID Nos.1-4 institute Any one or more aptamers shown or derivatives thereof carry out.It is highly preferred that the method uses SEQ ID Nos.1- Any one or more aptamers shown in 4 carry out.It is highly preferred that the method uses core shown in SEQ ID No.1 Sour aptamers carry out.

It can be used according to this field using cTnI protein concentration in aptamer detection serum of the invention conventional suitable Ligand detects target calibration method and carries out, and detects the acute heart with aptamer of the invention for example, can test by dot blot CTnI protein concentration in the serum of flesh Infarction Patients.

Whether there is the method for myocardial cell injury the present invention also provides diagnosis subject, the method uses the present invention the Aptamer described in two aspects carries out.Preferably, the method using shown in SEQ ID Nos.1-4 any one or Multiple aptamers or derivatives thereof carry out.It is highly preferred that the method use it is any one shown in SEQ ID Nos.1-4 A or multiple aptamers carry out.It is highly preferred that the method is carried out using aptamer shown in SEQ ID No.1.

Compared with the prior art, the advantages of the present invention are as follows:

The aptamer for the specific binding cTnI albumen that the present invention is obtained by screening has conjunction easier than protein antibodies At molecular weight is small, different parts can be modified and be replaced, and is more stable, be easy to the advantages that saving.Using of the invention Aptamer replaces the antibody for combining cTnI albumen, can combine cTnI albumen in serum environment at normal temperature.In addition, with current The aptamer for some cTnI albumen announced is compared, and the aptamer that the present invention obtains is affine to cTnI albumen Li Genggao, dot blot experiment in can identify cTnI albumen, can be used for it is quick, quick and accurately detect cTnI albumen, and And the nucleic acid aptamer sequence that the present invention obtains can be with cTnI protein binding, for example, cTnI-13 (SEQ ID in serum No.1) and cTnI-13s (SEQ ID No.2) can detecte the cTnI albumen in serum in AMI Patients, after being convenient for Phase is applied to related disease diagnosis.

Detailed description of the invention

From detailed description with reference to the accompanying drawing, features described above of the invention and advantage be will be apparent from, in which:

The cTnI-13 (A) and cTnI-14 (B) that Fig. 1 display screening of the embodiment of the present invention 1 obtains are affine with cTnI albumen Power detection data (SPR data).Figure 1A and 1B explanation, cTnI-13 and cTnI-14 detect have with cTnI albumen with SPR instrument In conjunction with KD value is respectively 48nM and 55nM.

Fig. 2 shows that the embodiment of the present invention 1 screens the affinity testing number of obtained four aptamers and cTnI albumen According to (EMSA data).These statistics indicate that, cTnI-13 and cTnI-13s and cTnI albumen all show gel blocking, have bright Aobvious fixation phenomenon；CTnI-14 and cTnI-14s does not have apparent fixation phenomenon, it may be possible to cTnI-13 and cTnI-14 bis- The combination of person and cTnI albumen has certain difference.

Fig. 3 shows the aptamer cTnI-13 and cTnI- that the method detection embodiment of the present invention of dot blot is screened 14 for the application in terms of cTnI Protein Detection.The schematic diagram of dot blot is shown in Fig. 3 A, and cTnI-13 inspection is shown in Fig. 3 B Measuring point hybridizes the experimental result of cTnI albumen, and the experimental result of cTnI-14 detection dot blot cTnI albumen is shown in Fig. 3 C, can To find out, with the raising of cTnI protein concentration, the spot colors of colour developing are deepened, this illustrates that cTnI-13 and cTnI-14 can be with For the detection of film hybridization cTnI albumen, and sensitivity is higher.

Fig. 4 shows that cTnI-13 and cTnI-13s is used for the detection of serum in AMI Patients sample.It uses respectively CTnI albumen is as positive control, and for the serum of normal person as negative control, Fig. 4 A can be seen that the core that present invention screening obtains Sour aptamers cTnI-13 can detecte the cTnI albumen in the serum of patients of acute myocardial infarction；Fig. 4 B can be seen that nucleic acid is suitable Ligand cTnI-13s can detecte the cTnI albumen in the serum of patients of acute myocardial infarction

Fig. 5 show dot blot the method aptamer cTnI-13s that screens of the detection embodiment of the present invention and Application of the cTnI-14s in terms of being used for cTnI Protein Detection after biotin modification.As can be seen that with reference protein and compareing The corresponding spot of nucleic acid sequence compare, experimental group colour developing is obvious, this illustrates the cTnI-13s and cTnI-14s of biotin modification It may be incorporated for the detection of film hybridization cTnI albumen.

Specific embodiment

The present invention is further described referring to specific embodiment, it will be appreciated by those skilled in the art that below Embodiment convenient for better understanding the present invention, the present invention is not limited to these specific embodiments.

Experimental method in following embodiment is conventional method unless otherwise specified.Reality as used in the following examples It tests material unless otherwise specified, is conventional biochemical reagent, can be commercially available by commercial sources.

Embodiment 1: the screening of the ssDNA aptamer of specific binding cTnI albumen

1. synthesizing random single-stranded DNA banks and primer shown in following sequence:

Random single-stranded DNA banks:

Wherein, " 40N " indicates 40 to 5 '-TTCAGCACTCCACGCATAGC-40N-CCTATGCGTGCTACCGTGAA-3 ' The sequence that arbitrary nucleotide base is formed by connecting.

The library is synthesized by Nanjing Genscript Biotechnology Co., Ltd..

5 ' end primers: 5 '-FAM-TTCAGCACTCCACGCATAGC

3 ' end primers: 5 '-(20A)-Spacer 18-TTCACGGTAGCACGCATAGG

Wherein, " 20A " indicates that the polyA tail being made of 20 adenylates (A), " Spacer 18 " indicate the six of 18 atoms Arm between ethylene glycol.

Above-mentioned primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..

Random single-stranded DNA banks and primer are configured to 100uM with PBS buffer solution (Corning) and store -20 DEG C of liquid preservations It is spare.

2. paramagnetic particle method screens

2.1 will be on cTnI albumen coupling to magnetic bead: taking 50ul magnetic bead (Invitrogen, Dynabeads^TM MyOne^TMArticle No.: 65012) Carboxylic Acid washes with water completely, uses EDC (1- (3- dimethylamino-propyl) -3- second Base carbodiimide hydrochloride；0.4M aqueous solution) and NHS (n-hydroxysuccinimide；0.1M aqueous solution) two reagents are isometric 100ul and magnetic bead are incubated for 15 minutes at 25 DEG C after mixing, the carboxyl on activated magnetic beads surface；

It is mixed after the cTnI albumen 10mM Na acetate dilution to final concentration of 50 μ g/mL of pH4.5 with the magnetic bead after activation, It is placed on vertical mixed instrument and is incubated for 45 minutes at 25 DEG C, cTnI albumen passes through the amino coupled of protein surface to magnetic bead surfaces.

Coupling terminates, and pipe is placed on magnetic frame, removes supernatant and the 1M salt of 100ul pH8.5 is added into magnetic bead immediately Sour ethanol amine reacts at room temperature 10 minutes, closes the unreacted activation site of magnetic bead surfaces.It is placed on magnetic frame, removes confining liquid, Magnetic bead PBS (NaCl:8g/L, KCl:0.2g/L, Na₂HPO₄: 1.15g/L, KH₂PH₄: 0.2g/L, CaCl₂: 0.1g/L, MgCl₂·6H₂O:0.1g/L；PH7.4 it) cleans 3 times.

2.2 are incubated for and clean: diluting the above-mentioned random nucleic acid library of dissolution 1OD to 10uM with 130ul PBS, be dispensed into PCR pipe carries out refolding strategy processing.PCR instrument, which sets 95 DEG C and is incubated for, unlocks the chain folded, and ice bath 5 minutes, equilibrium at room temperature 5 Minute.The magnetic bead 50uL for being connected with cTnI albumen that 2.1 obtain is placed in the random dna nucleic acid library handled through refolding strategy vertical It is incubated for 1 hour, is placed on magnetic frame at 25 DEG C on straight mixed instrument, retain magnetic bead and remove supernatant, clean magnetic bead 6 times with PBS, every time Cleaning 1 minute uses 200ul PBS every time.

2.3 separation: supernatant, nucleic acid obtained in supernatant were collected after the magnetic bead that 2.2 obtain was handled with boiling water bath 10 minutes Molecule is for expanding；

2.4PCR expands library: the library obtained using 2.3 is expanded as template with emulsion PCR (ePCR).Mineral oil It is formulated as follows

Template is added in 2mlPCR mix and is expanded.The composition of the PCR mix is as follows:

ddH2O	86.6uL
		10xPfu polymerase buffer	10μL
dNTP(10mM)	2uL
		Forward primer (100 μM)	0.5uL
Reverse primer (100 μM)	0.5μL
		Pfu(5U/μL)	0.4μL
Total system	100ul

Wherein, primer used is as follows:

Forward primer: 5 '-FAM-AGCAGCACAGAGGTCAGATG；

Reverse primer: 5 '-(20A)-Spacer 18-TTCACGGTAGCACGCATAGG.

Wherein arm between six ethylene glycol of 18 atoms of " Spacer 18 " expression.

Above-mentioned primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..

Vortex mixed instrument will be used to shake after the mineral oil of the above-mentioned mixture mixed and 4 times of volumes 2 minutes to generate Emulsion is divided into 100ul/ pipe by emulsion, and amplification condition is as follows: 95 DEG C initial denaturation 3 minutes, 95 DEG C are denaturalized 60 seconds, 60 DEG C Annealing 60 seconds, 72 DEG C extend 60 seconds, totally 25 circulation, 72 DEG C 5 minutes, 4 DEG C preservation.

Amplified production is purified with n-butanol: collecting all ePCR products in 15ml conical centrifuge tube, 2 times of volumes are added N-butanol, on vortex mixer concussion to mix well；Desk centrifuge, 9000rpm (rev/min) are centrifuged 10 in room temperature Minute；It moves and abandons upper phase (n-butanol).

2.5 prepare the single-stranded library DNA: the pcr amplification product being concentrated to get in step 2.4 is added at 1: 1 by volume The urea-denatured buffer of TBE/ is denaturalized DNA in denatured by boiling 15 minutes, subsequent ice bath 1 minute, and all samples are carried out PAGE Gel electrophoresis, electrophoresis to bromophenol blue reaches glue bottom under 400V voltage, separates the chain lengthened with there is the chain of FAM label, 7M Urea-denatured polyacrylamide gel formula is as follows:

Urea	3.78g
		40% polyacrylamide	1.8ml
5*TBE	1.8ml
		ddH2O	2.25ml
10%APS	60ul
		TEMED	15ul

The chain of gel extraction FAM label: gel taking-up is put on the plastic film, Ex (nm): 495, Em (nm): 517 detections The ssDNA with FAM label that we need；Purpose band is directly cut with clean blade and (pays attention to having when cutting glue The ssDNA of polyA avoids switching to the ssDNA with polyA above purpose band), adhesive tape is transferred in 1.5mlEP pipe And smash to pieces, 1ml ddH is added₂SsDNA in glue was transferred in solution in boiling water bath 10 minutes after O, the fragment of centrifugation removal glue, Stay supernatant.Supernatant is purified with n-butanol, and method is the same as 2.4.The single-stranded bag filter dialysed overnight with 3KD of DNA is obtained, can be used as down The library of one wheel screening；

3. counter-selection: carrying out counter-selection choosing with the magnetic bead for being connected with BSA albumen, the method for being coupled BSA albumen is identical as 2.1.Second Each round carries out counter-selection with counter-selection magnetic bead before carrying out using cTnI albumen as the positive screening of target after wheel, collects after counter-selection It is clear to be sieved for positive.

4. multi-turns screen: the random library in the single-stranded library alternative steps 2.2 of the DNA that step 2.5 is obtained repeats to screen 6 wheels, secondary library obtained in once-through operation is initial nucleic acid library before operation every time, is detected in screening process with SPR Variation of the single-stranded library DNA to cTnI albumen recognition capability, when the single-stranded library DNA meets the requirements the recognition capability of cTnI albumen Afterwards, products therefrom is analyzed through cloning and sequencing, finally obtains aptamer.

In the screening technique, screening pressure can be increased by wheel, to promote the enrichment degree of screening aptamer, shortened Screening process.The screening pressure that increases includes the amount of single-stranded DNA banks, the dosage of target proteins and the two for reducing investment Incubation time increases scavenging period, wash number and the dosage for increasing counter-selection magnetic bead.

5. the aptamer that analysis and identification obtain after repeatedly screening, by obtained enriched library product through cloning and sequencing After analysis, selects several sequences and synthesized by the raw work in Shanghai, detect affinity.

In subsequent detection, determines that aptamer shown in SEQ ID Nos.1-4 has and preferably combine cTnI albumen Affinity, they are respectively designated as cTnI-13, cTnI-13s, cTnI-14 and cTnI-14s.

Embodiment 2: the affinity of surface plasma resonance (SPR) detection cTnI aptamer and cTnI albumen

1. by the aptamer cTnI-13 (SEQ ID No.1) and cTnI-14 (SEQ ID of the raw work synthesis in Shanghai No.3), it is diluted to respectively with DPBS: 0,1,5,10,25,50,100,200nM；

2. by cTnI albumen coupling to CM5 chip surface: first cleaning chip, sample introduction 20ul, flow velocity with 50mM NaOH 10ul/min, then with by isometric EDC (1- (3- dimethylamino-propyl) -3- ethyl-carbodiimide hydrochloride；0.4M is water-soluble Liquid) and NHS (n-hydroxysuccinimide；0.1M aqueous solution) sample introduction 50ul activates chip, flow velocity 5ul/ after two reagent mixing min.By sample introduction after the cTnI albumen 10mM Na acetate dilution to final concentration of 50 μ g/mL of pH4.5,15 μ L of sampling volume, stream Fast 5uL/min, cTnI albumen coupling amount are 2000Ru.After the completion of sample introduction, chip, flow velocity 5uL/min, sample introduction are closed into ethanol amine 50uL。

3. detection: setting kinetic measurement parameter using BiacoreT200, dilute the aptamer of good each concentration CTnI-13 and cTnI-14 successively sample introduction.

Affinity detection data is shown in Figure 1A (cTnI-13) and Figure 1B (cTnI-14), these data illustrate cTnI-13 and CTnI-14 detects there is combination with cTnI albumen with SPR instrument, and KD value is respectively 48nM and 55nM.

Embodiment 3: the affinity of cTnI aptamer and cTnI albumen that agarose gel electrophoresis detects

1. preparing 1% Ago-Gel with 1 × TBE.1 × TBE is pre-chilled, it will be shown in SEQ ID Nos.1-4 Aptamer is diluted to 1uM with PBS respectively, and 95 DEG C are denaturalized for 10 minutes, immediately after ice bath 5 minutes, then equilibrium at room temperature 10 divides Clock.

2. cTnI albumen is added separately to carry out incubation 10 in aptamer shown in the SEQ ID Nos.1-4 of step 1 Minute.

Incubation system are as follows:

Aptamer: 1uM, 5uL

Albumen cTnI:0.35mg/ml, 5ul

3. 56 DEG C of inactivation 30min of human serum (being provided by Hefei Bin Hu hospital, subject knows) after equilibrium at room temperature, are added To step 2 cTnI albumen and the library ssDNA mixed liquor in, final concentration of 30% (v/v) of serum, continuation be incubated at room temperature 20 minutes.

4. electrophoresis (voltage is 400V when electrophoresis, to replace electrophoresis liquid in electrophoresis process, prevent electrophoresis liquid temperature excessively high), real It tests result and sees Fig. 2.

5. interpretation of result: as shown in Figure 2, cTnI-13 (SEQ ID No.1) and cTnI-13s (SEQ ID No.2) with CTnI albumen all shows gel blocking effect, there is apparent fixation phenomenon.CTnI-14 (SEQ ID No.3) and cTnI- 14s (SEQ ID No.4) is without apparent fixation phenomenon, it may be possible to which combination has certain difference.

Embodiment 4: cTnI the aptamer cTnI-13 and cTnI-14 of protein site hybrid experiment detection biotin modification With cTnI protein-interacting

1. taking the nitrocellulose filter (purchased from Millipore) of one piece of 10cm × 5cm, use PBS dilute respectively in cTnI albumen It is interpreted into following concentration: 0.3/0.25/0.2/0.15/0.I/0.05mg/ml.On point sample 1ul to nitrocellulose filter, natural wind It is dry.

2. after to be dried, being closed 2 hours with 10%BSA in room temperature, with PBST, (PBS contains 0.3 ‰ after closing Tween20) cleaning is primary, exhaustion.

3. the aptamer cTnI-13 and cTnI-14 of biotin modification are diluted to 500nM respectively, refolding strategy processing: 95 DEG C are denaturalized for 10 minutes, immediately after ice bath 5 minutes, then equilibrium at room temperature 10 minutes.

4. the aptamer after refolding strategy is small with the cTnI albumen shaking table incubation at room temperature 1 on nitrocellulose filter respectively When.

5. being washed three times after being incubated for PBST, when cleaning, is placed on shaking table, 10 minutes every time.

6. the streptavidin (being purchased from the green skies, article No. A0303) that HRP- label is added uses PBST according to 1: 10000 (v/v) are prepared, and room temperature shaker is incubated for 30 minutes.

7.PBST is washed 3 times, and when cleaning is placed on shaking table, and 10 minutes every time.

8. with A liquid: liquid=1 B: developing solution (the special super quick ECL chemiluminescence examination of BeyoECL Star is added in the ratio of 1 (v/v) Agent box, is purchased from the green skies, and article No. P0018A, A liquid and B liquid are that kit carries solution), at color development at room temperature 1 minute.

9. imaging system observation is taken pictures: being the ImageQuant in GE medical treatment life science portion using instrument^TMThe number of LAS 4000 Word imaging system.

As a result as shown in figure 3, Fig. 3 B is shown with cTnI-13 detection dot blot cTnI albumen as a result, Fig. 3 C is shown Be with cTnI-14 detection dot blot cTnI albumen result.The mentioning with cTnI protein concentration it can be seen from Fig. 3 B and 3C The spot colors of height, colour developing deepen, this illustrates that cTnI-13 and cTnI-14 may be incorporated for the detection of film hybridization cTnI albumen, and And sensitivity is higher.

Embodiment 5: acute myocardial infarction AMI is detected with aptamer cTnI-13 and cTnI-13s by dot blot experiment and is suffered from The serum of person

1. take out one piece of 1.5cm × 4cm nitrocellulose filter (being purchased from Millipore), such as Fig. 4, by sample spot on film, Sample has reference protein rhIL12 respectively；CTnI albumen；Normal human serum；Serum in AMI Patients, each point 1u1.

2. after to be dried, being closed 2 hours with 10%BSA, PBS cleaning is primary after closing, exhaustion.

3. by cTnI-13 (500nM) refolding strategy: using 95 DEG C of incubations 10 minutes, then ice bath 10 minutes；Room temperature 1 It is used after hour.

4. cTnI-13 and nitrocellulose filter are incubated for 1 hour in room temperature shaker.PBST (0.03% is used after incubation TWEEN 20) it washes three times, 10 minutes every time.

5. be added HRP- label streptavidin (be purchased from the green skies, article No. A0303,1: 10000v/v, use PBST is prepared), it is incubated for 30 minutes in room temperature shaker.

6.PBST is washed 3 times, and when cleaning is placed on shaking table, and 10 minutes every time.Developing solution, A liquid: liquid=1 B: 1v/v is added (the special super quick ECL chemical luminescence reagent kit of BeyoECL Star carries solution, is purchased from green skies P0018A), develops the color 1 minute.

7. imaging system observation is taken pictures.

As a result as shown in figure 4, Fig. 4 A shows that cTnI-13 can detecte out the cTnI in serum in AMI Patients Albumen.Fig. 4 B shows that cTnI-13s can detecte out the cTnI albumen in serum in AMI Patients.It tests above and is Qualitative experiment, it was demonstrated that cTnI-13 and cTnI-13s can detect the cTnI albumen in serum in AMI Patients, at this Do not have further to measure the sensitivity of detection in experiment, after optimizing detection condition, aptamer of the invention has the Supreme People's Procuratorate It surveys sensitivity (data are not shown).

Embodiment 6: cTnI the aptamer cTnI-13s and cTnI- of protein site hybrid experiment detection biotin modification 14s and cTnI protein-interacting

1. taking the nitrocellulose filter (purchased from Millipore) of one piece of 10cm × 5cm, cTnI albumen is diluted to PBS Concentration 0.1mg/ml.On point sample 1ul to nitrocellulose filter, natural air drying.

2. after to be dried, being closed 2 hours with 10% BSA in room temperature, with PBST, (PBS contains 0.3 ‰ after closing Tween20) cleaning is primary, exhaustion.

3. the aptamer cTnI-13s and cTnI-14s of biotin modification are diluted to 500nM respectively, at refolding strategy Reason: 95 DEG C are denaturalized for 10 minutes, immediately after ice bath 5 minutes, then equilibrium at room temperature 10 minutes.

As a result as shown in figure 5, method detection the aptamer cTnI-13s and cTnI-14s of dot blot are through biotin It still is able to after modification for cTnI Protein Detection, it can be seen that compared with the corresponding spot of the sequence of reference protein and control, Experimental group colour developing is obvious, this illustrates that the cTnI-13s of biotin modification and cTnI-14s may be incorporated for film hybridization cTnI albumen Detection.

It should be understood that although carrying out particularly shown and description to the present invention with reference to its illustrative embodiment, It should be understood by those skilled in the art that without departing substantially from spirit of the invention as defined in appended claims Under conditions of range, any of various embodiments can be carried out in the variation for wherein carrying out various forms and details Combination.

Claims

1. a kind of aptamer for specifically binding cardiac muscle troponin I, wherein the aptamer includes: SEQ ID Nucleotide sequence shown in any of Nos.1-4, or have with nucleotide sequence shown in any of SEQ ID Nos.1-4 There is high homology and the nucleotide sequence of cardiac muscle troponin I can be specifically bound, or by appointing in SEQ ID Nos.1-4 The nucleotide sequence of cardiac muscle troponin I can be specifically bound derived from nucleotide sequence shown in one.

2. aptamer according to claim 1, wherein the nucleotides sequence of the cardiac muscle troponin I aptamer Column are modified, the modification selected from phosphorylation, methylation, amination, sulfhydrylation, with sulphur replace oxygen, replace oxygen or same position with selenium Elementization.

3. aptamer according to claim 1, wherein connecting fluorescence on the nucleotide sequence of the aptamer Marker, radioactive substance, therapeutic substance, biotin, digoxin, nano luminescent material, small peptide, siRNA or enzyme label.

4. aptamer according to claim 1, the nucleotides sequence as shown in any of SEQ ID Nos.1-4 Column composition.

5. a kind of aptamer for specifically binding cardiac muscle troponin I, wherein the aptamer includes following three kinds Any one in sequence:

(1) with nucleotide sequence of the homology of the nucleotide sequence of aptamer described in claim 1 60% or more；

(2) nucleotides sequence that can hybridize under strict conditions with the nucleotide sequence of aptamer described in claim 1 Column；Or

(3) RNA sequence transcribed by the nucleotide sequence of aptamer described in claim 1.

6. a kind of aptamer derivative, wherein the derivative is that the nucleic acid as described in claim any one of 1-5 is fitted The phosphorothioate backbone sequence that the skeleton of the nucleotide sequence of ligand derives, or by any one of claim 1-5 institute The peptide nucleic acid that the aptamer stated is transformed into.

7. aptamer of any of claims 1-5 or aptamer derivative as claimed in claim 6 exist Application in the kit of preparation purifying cardiac muscle troponin I or detection cardiac muscle troponin I.

8. a kind of kit, wherein the kit includes aptamer of any of claims 1-5 and right It is required that one of aptamer derivative or a variety of described in 6.

9. kit according to claim 8, wherein the kit is used to detect the myocardium myo calcium in experimenter's serum Protein I is horizontal.

10. kit according to claim 8, wherein the kit is for diagnosing whether subject has cardiac muscle cell Damage.