CN112415195A

CN112415195A - Kit for detecting novel coronavirus double targets and application thereof

Info

Publication number: CN112415195A
Application number: CN202011477766.0A
Authority: CN
Inventors: 刘为勇; 张祺; 刘芳; 刘映乐; 屈三甫; 梅益
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2020-12-15
Filing date: 2020-12-15
Publication date: 2021-02-26

Abstract

The invention provides a nucleic acid aptamer detection kit aiming at a new coronavirus S protein and a new coronavirus N protein, and also provides a preparation method and application of the kit. The kit has the characteristics of simple operation, rapid reaction, high accuracy and high sensitivity during detection, and can realize accurate detection of two viruses by combining with detection devices such as an enzyme-labeling instrument, a flow cytometer, a fluorescence microscope and the like. The kit has the advantages of high sensitivity, good specificity, wide measurement range, simple operation, capability of detecting two viruses simultaneously and good market prospect.

Description

Kit for detecting novel coronavirus double targets and application thereof

Technical Field

The application relates to in vitro detection of organisms, in particular to a kit for simultaneously detecting double targets of a new coronavirus, a method for preparing the kit and application of the kit in simultaneously detecting a new coronavirus S protein sample and a new coronavirus N protein sample.

Background

The novel coronavirus (2019-nCoV, SARS-CoV-2) is a coronavirus which can infect human. Coronaviruses belong phylogenetically to the order of the nested viruses (Nidovirales) the family of Coronaviridae (Coronaviridae) the genus coronaviruses (Coronavirus). Viruses of the genus coronaviruses are enveloped (envelope) RNA viruses with a linear single-stranded positive strand genome, and are a large group of viruses that are widely found in nature. Interpersonal spread of SARS-CoV-2 occurs primarily through close contact with infected persons, primarily through respiratory droplets and contact with contaminated objects. After people are infected with coronavirus, the common signs of the person are respiratory symptoms, fever, cough, shortness of breath, dyspnea and the like. In more severe cases, the infection can lead to pneumonia, severe acute respiratory syndrome, renal failure, and even death. The existing prevention and control situation of the new coronavirus is still severe, the detection of the new coronavirus mainly adopts virus nucleic acid detection, the antibody detection of a suspected patient can assist diagnosis, and a confirmed case needs a positive result of pathogenic evidence (real-time fluorescence RT-PCR detection of nucleic acid positivity of the new coronavirus, or virus gene sequencing which is highly homologous with the known new coronavirus).

The detection of new coronavirus samples is important in clinical detection and experimental research. In the prior art, the detection of virus infection or virus protein is generally identified by adopting a specific antibody, the preparation is complex, the steps are complex, the cost is high, and certain defects exist in large-scale popularization. The aptamer is a single-stranded nucleic acid (generally about 20-60 bases in size), can form a specific three-dimensional structure through folding, and can be combined with a corresponding target molecule with high affinity and high specificity. The aptamer can be obtained by screening through an artificial screening technology (Systematic Evolution of Ligands by amplified Evolution, SELEX) simulating a natural Evolution process, and is a novel nucleic acid molecule with a recognition function. Nucleic acid aptamers with high affinity for target substances can be screened from a random single-stranded nucleic acid sequence library by using SELEX technology, and the SELEX technology is successfully applied to screening of a plurality of target substances, including metal ions, organic dyes, medicines, proteins, amino acids, various cytokines and the like. The technology has the characteristics of large library capacity, wide application range, high resolution, high affinity, relatively simple, convenient, rapid and economical screening process, high practicability and the like. The characteristics of high specificity and high affinity of the aptamer corresponding to a target substance are similar to the functions of an antibody, but the target range of the aptamer is wider, and the aptamer can be well applied to multiple aspects of medical detection, diagnosis, treatment and the like.

The reason for the specificity and high affinity of aptamers is that single-stranded nucleic acids, when encountering a target molecule, can form unique three-dimensional structures such as pockets, hairpins, G-tetramers, etc., which bind to the target molecule on a principle similar to that of antibodies specifically recognizing corresponding antigenic determinants, such as by hydrogen bonding, hydrophobic structures, ionic bonds, etc. Based on the biological characteristics of aptamers for recognizing pathogenic microorganisms or pathological cells with high specificity, the aptamer can be widely applied to detection technology and construction of biosensors, and can realize accurate diagnosis of pathogens or diseases.

At present, antigen detection kits aiming at the S protein and the N protein of the new coronavirus in the market are single-channel detection, namely, only one antigen can be detected in one reaction, and the detection of two or more virus antigens in the same reaction cannot be realized. And the commercial antigen detection kit is used for detecting the antibody, and the antibody is used as a protein component and has the defects of difficult expression and synthesis, easy degradation, non-specific immunogenicity and the like. Infant diarrhea is only a symptom and manifestation, and the pathogens are sometimes single, but a large proportion of mixed infections, so that rapid diagnosis is important. Currently, no such detection method is available on the market.

Disclosure of Invention

The invention aims to provide a kit for rapidly detecting new coronavirus infection, which can be used for simultaneously detecting whether a new coronavirus S protein and a new coronavirus N protein exist in a sample, and has the advantages of high sensitivity and dual-channel simultaneous rapid detection.

It is a further object of the present invention to provide a method for preparing the kit

The third purpose of the invention is to provide the application of the kit in detecting the new coronavirus S protein and the new coronavirus N protein samples.

The invention discloses a kit for rapidly detecting double targets of a new coronavirus, which comprises the following components: A) a protein coated plate for fixing a sample solution, B) a protein coated liquid, C) a confining liquid, D) a rinsing liquid, E) a sample pretreatment liquid, and F) a aptamer with a fluorescent group label, wherein the aptamer comprises a aptamer of a new coronavirus S protein and a aptamer of a new coronavirus N protein, and the fluorescent groups of the two aptamers are different.

The invention also discloses a nucleotide sequence of the aptamer, the aptamer of the novel coronavirus S protein has the nucleotide sequence shown in SEQ ID NO.1, and the aptamer of the novel coronavirus N protein has the nucleotide sequence shown in SEQ ID NO. 2.

The component A) fixed sample solution protein coated plate in the kit for detecting the new coronavirus double-target spot can be used for coating a primary positive or to-be-detected sample by adopting a common ELISA plate, and the commercially-sold ELISA plate with protein adsorption capacity can be directly used.

The invention further discloses the composition of the kit, wherein the protein coating solution B) is prepared from 35mM NaHCO₃，15mM Na₂CO₃pH 9.3 to pH 9.9, wherein C) the blocking solution is composed of 136mM NaCl,2.6mM KCl,2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, 1% BSA, pH 7.1 to pH 7.7, wherein D) the rinsing solution is composed of 136mM NaCl,2.6mM KCl,2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, pH 7.1-pH 7.7, wherein E) the sample pretreatment solution is composed of 150mM NaCl, 1% Triton X-100,50mM Tris, pH7.8-pH 8.2.

In a preferred embodiment, the invention also discloses A) a protein-coated plate on which the sample solution is immobilized, and B) a protein-coated plate prepared from 35mM NaHCO₃，15mM Na₂CO₃pH 9.6, C) confining liquid is composed of 136mM NaCl,2.6mM KCl,2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, 1% BSA, pH 7.4, D) rinsing solution consisting of 136mM NaCl,2.6mM KCl,2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, pH 7.4, E) the sample pretreatment solution consists of 150mM NaCl, 1% Triton X-100,50mM Tris, pH 8.0.

The nucleic acid aptamer disclosed by the invention is connected with functional groups on the sequence, wherein the functional groups are various biotin markers, luminescent markers and enzyme-labeled markers, the luminescent markers are selected from one of FAM and VIC fluorescent groups, and the fluorescent groups of the two aptamers are different.

The invention also discloses a method for preparing a kit for detecting the new coronavirus double target spots, wherein the aptamer of the new coronavirus S protein is obtained by screening by a SELEX technology, wherein the epitope of the target protein epitope of the new coronavirus S protein has a sequence amino acid shown as SEQ ID No. 3; the aptamer of the new coronavirus N protein has the amino acid sequence shown in SEQ ID No.4 as the antigen epitope of the new coronavirus N protein target protein, and is obtained by SELEX screening; followed by a fluorophore attached, but requires that the two aptamers be attached to a different fluorophore for visualization and identification.

The invention also discloses application of the detection kit in simultaneous detection of the new coronavirus double targets

In order to implement the present invention, the applicant prepared a kit for detecting the new coronavirus double target in the following manner.

1) Determination of target protein epitopes of a test virus

Through reference of literature and bioinformatics analysis, the inventor determines that the amino acid sequence of the epitope of the target protein antigen of the new coronavirus S protein is shown as SEQ ID No.3 and the amino acid sequence of the epitope of the target protein antigen of the new coronavirus N protein is shown as SEQ ID No. 4.

2) Screening for specifically binding aptamer sequences

In vitro synthesis of a single-stranded DNA library containing 39 random sequences; the DNA aptamer sequence with high specificity and high affinity is screened by adopting SELEX technology under the screening condition of the new coronavirus S protein and the new coronavirus N protein target protein, the aptamer of the new coronavirus S protein has a nucleotide sequence shown in SEQ ID NO.1, and the aptamer of the new coronavirus N protein has a nucleotide sequence shown in SEQ ID NO. 2.

3) Synthesis of aptamer with fluorophore labeling

The aptamer sequence obtained by screening is directly synthesized by a conventional biotechnology service company, and a fluorescent group is connected to the 5' end of the aptamer in a covalent bond mode during synthesis. The aptamer for detecting the new coronavirus S protein has a sequence shown as SEQ ID No.1, and a fluorescent group carried by the aptamer is FAM; the aptamer for detecting the N protein of the new coronavirus has a sequence shown as SEQ ID No.2, and a fluorescent group is VIC.

4) Preparation of the kit

The kit comprises the following components: A) a protein coated plate for fixing a sample solution, B) a protein coated liquid, C) a confining liquid, D) a rinsing liquid, E) a sample pretreatment liquid, and F) a aptamer with a fluorescent group label, wherein the aptamer comprises an aptamer of a new coronavirus S protein and an aptamer of a new coronavirus N protein, and the fluorescent groups of the two aptamers are different.

The reagent component formula in the kit is as follows: B) protein coating solution consisting of 35mM NaHCO3, 15mM Na2CO3, pH 9.3-pH 9.9, C) blocking solution consisting of 136mM NaCl,2.6mM KCl,2mM KH2PO4,8mM Na2HPO4, 0.05% Tween-20, 1% BSA, pH 7.1-pH 7.7, D) rinsing solution consisting of 136mM NaCl,2.6mM KCl,2mM KH2PO4,8mM Na2HPO4, 0.05% Tween-20, pH 7.1-pH 7.7, E) sample pretreatment solution consisting of 150mM NaCl, 1% Triton X-100,50mM Tris, pH7.8-pH8.2, F) nucleic acid aptamer was a company's synthetic powder dissolved in TE buffer at a working concentration of 200 nM.

The aptamer aiming at the new coronavirus S protein and the new coronavirus N protein screened by the SELEX technology has higher specificity and affinity to the corresponding target viruses, and has the advantages of no immunogenicity, small molecule, modification, easy synthesis, difficult degradation, no toxicity and the like. The method for detecting the corresponding viruses by using the aptamer screened by the invention has the characteristics of simple operation, quick reaction, high accuracy and high sensitivity, and the accurate detection of the two viruses can be realized by constructing a molecular probe or a detection kit by using the aptamer and combining detection devices such as an enzyme labeling instrument, a flow cytometer, a fluorescence microscope and the like. Meanwhile, the kit has a wider detection range and is convenient for clinical application.

The significance of the invention lies in that: the kit has the advantages of high sensitivity, good specificity, wide measurement range, simple operation, capability of detecting two viruses simultaneously, suitability for large-scale popularization and good market prospect.

The invention has the advantages that

1. In the detection of saliva samples of patients infected by the new coronavirus S protein and the new coronavirus N protein and saliva samples of healthy people, the positive detection rate of the patients infected by the new coronavirus S protein, namely the sensitivity is 96.3%; the positive detection rate of the new coronavirus N protein infected patient, namely the sensitivity is 96.8%; the positive detection rate of healthy people is 0%.

2. The two channels simultaneously detect two fluorescent groups with different emission wave bands on two nucleic acid aptamers, can simultaneously complete the detection of two pathogens in the same reaction system, shortens the reaction time and saves the consumption of reaction reagents and samples to be detected compared with the common immunoassay kit (such as a colloidal gold kit) on the market.

3. The nucleic acid aptamer sequence used by the invention is obtained by screening through a SELEX technology and has complete originality.

The kit adopts the aptamer as a detection object, can effectively overcome the problems, and has the advantages of small molecule, modification, easy synthesis, difficult degradation, no toxicity, no immunogenicity and the like. By labeling different fluorescent groups on different aptamers, two or more than two combined pathogens can be simultaneously detected in the consent reaction.

Drawings

FIG. 1 is a secondary structural diagram of a nucleotide sequence of a novel coronavirus S protein-aptamer in an aptamer according to the present invention;

FIG. 2 is a secondary structural diagram of the nucleotide sequence of the N protein-aptamer of the novel coronavirus in the aptamer of the present invention.

Detailed Description

The invention is further illustrated below with reference to specific examples. It should be understood that these examples are only for illustrating the present invention and are not intended to limit the scope of the present invention.

Example 1 determination of epitopes of the target protein of the S protein of the Neocoronavirus, the N protein of the Neocoronavirus

According to literature reference and bioinformatics analysis, the virus protein to be detected and suitable as the detection target of the aptamer and a specific antigen epitope region on the virus protein are determined.

A) Selecting the full length of the novel coronavirus S protein as an aptamer screening target protein, wherein the sequence is shown as SEQ ID No. 3:

MFVFLVLLPLVSSQCVNLTTRTQLPPAYTNSFTRGVYYPDKVFRSSVLHSTQDLFLPFFSNVTWFHAIHVSGTNGTKRFDNPVLPFNDGVYFASTEKSNIIRGWIFGTTLDSKTQSLLIVNNATNVVIKVCEFQFCNDPFLGVYYHKNNKSWMESEFRVYSSANNCTFEYVSQPFLMDLEGKQGNFKNLREFVFKNIDGYFKIYSKHTPINLVRDLPQGFSALEPLVDLPIGINITRFQTLLALHRSYLTPGDSSSGWTAGAAAYYVGYLQPRTFLLKYNENGTITDAVDCALDPLSETKCTLKSFTVEKGIYQTSNFRVQPTESIVRFPNITNLCPFGEVFNATRFASVYAWNRKRISNCVADYSVLYNSASFSTFKCYGVSPTKLNDLCFTNVYADSFVIRGDEVRQIAPGQTGKIADYNYKLPDDFTGCVIAWNSNNLDSKVGGNYNYLYRLFRKSNLKPFERDISTEIYQAGSTPCNGVEGFNCYFPLQSYGFQPTNGVGYQPYRVVVLSFELLHAPATVCGPKKSTNLVKNKCVNFNFNGLTGTGVLTESNKKFLPFQQFGRDIADTTDAVRDPQTLEILDITPCSFGGVSVITPGTNTSNQVAVLYQDVNCTEVPVAIHADQLTPTWRVYSTGSNVFQTRAGCLIGAEHVNNSYECDIPIGAGICASYQTQTNSPRRARSVASQSIIAYTMSLGAENSVAYSNNSIAIPTNFTISVTTEILPVSMTKTSVDCTMYICGDSTECSNLLLQYGSFCTQLNRALTGIAVEQDKNTQEVFAQVKQIYKTPPIKDFGGFNFSQILPDPSKPSKRSFIEDLLFNKVTLADAGFIKQYGDCLGDIAARDLICAQKFNGLTVLPPLLTDEMIAQYTSALLAGTITSGWTFGAGAALQIPFAMQMAYRFNGIGVTQNVLYENQKLIANQFNSAIGKIQDSLSSTASALGKLQDVVNQNAQALNTLVKQLSSNFGAISSVLNDILSRLDKVEAEVQIDRLITGRLQSLQTYVTQQLIRAAEIRASANLAATKMSECVLGQSKRVDFCGKGYHLMSFPQSAPHGVVFLHVTYVPAQEKNFTTAPAICHDGKAHFPREGVFVSNGTHWFVTQRNFYEPQIITTDNTFVSGNCDVVIGIVNNTVYDPLQPELDSFKEELDKYFKNHTSPDVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQYIKWPWYIWLGFIAGLIAIVMVTIMLCCMTSCCSCLKGCCSCGSCCKFDEDDSEPVLKGVKLHYT(SEQ ID No.3)

B) selecting the full length of the N protein of the novel coronavirus as an aptamer screening target protein, wherein the N protein has a sequence shown as SEQ ID No. 4:

MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTGAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA(SEQ ID No.4)

C) according to the determined amino acid sequence, the nucleotide sequence is directly synthesized and prokaryotic codon optimization is carried out in a company, and the synthesized gene fragment is inserted into a prokaryotic expression vector pET32 a. The target proteins corresponding to the two viruses used for aptamer screening were induced to be expressed.

Example 2 construction of aptamer library and primer design

A) A single-stranded DNA library containing 39 random sequences was synthesized in vitro by the gene synthesis service of conventional Biotechnology services, having the nucleotide sequence shown below

GATGACATTGCACAAGTCAGG-(N39)-GAGTGAATCCTGCTGTTCGA

B) Aiming at the fixed sequence of the aptamer 5' end, a synthesized upstream primer P1 is designed, and has a sequence shown as SEQ ID No. 5:

5’-GATGACATTGCACAAGTCAGG-3’(SEQ ID No.5)

C) aiming at the fixed sequence of the 3 'end of the aptamer, a synthesized downstream primer P2 is designed, which has a sequence shown as SEQ ID No.6, and the 5' end of the primer is connected with a biotin group: 5 '-biotin-TCGAACAGCAGGATTCACTC-3' (SEQ ID No.6)

Example 3 aptamer sequences that efficiently bind viral target proteins were selected from libraries using SELEX screening

A) Dissolving 10nmol of the initial single-stranded DNA random library in 500 μ l of PBS solution, using a constant-temperature water bath kettle at 92 ℃ for 5min, then rapidly inserting the library into ice for 10min, then incubating the treated initial single-stranded DNA random library and corresponding virus target protein on ice for 1h, then adding Ni-NTA Magnetic Agarose Beads, and continuing to incubate for 1 h. After the incubation was complete, the supernatant was removed by adsorption using a magnetic separator and the Beads were washed with 2ml of PBS. Finally, resuspending Beads with 10ml of precooled PBS, fully blowing and uniformly mixing the Beads, then carrying out constant-temperature water bath at 92 ℃ for 10min, centrifuging 13000g, and collecting supernatant, namely the single-stranded DNA library of the specific recognition virus target protein after the first round of screening.

B) The screened single-stranded DNA library is subjected to PCR amplification to prepare a secondary library. The PCR reaction system is as follows: 25. mu.l of Premix Tap Mix, 8. mu.l of the screened single-stranded DNA library, 2.5. mu.l of the upstream primer, 2.5. mu.l of the downstream primer, and 12. mu.l of ddH2O 12, in a total volume of 50. mu.l. PCR cycling amplification was performed according to the following procedure: denaturation at 95 ℃ for 3min, 35 cycles of amplification at 95 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 30s, final extension at 72 ℃ for 10min, and final reaction at 16 ℃ for termination. The library after PCR amplification was recovered on agarose gel to obtain pure library fragments.

C) And further preparing the amplified secondary library. And (3) incubating the amplified double-stranded DNA library and 100 mu l of streptavidin-labeled magnetic beads for 20min at normal temperature, binding the double-stranded DNA library to the surfaces of the magnetic beads by utilizing the affinity action of biotin on the double-stranded DNA library and streptavidin, adsorbing by using a magnetic separator, removing supernatant, and washing the magnetic beads by using 2ml of PBS. Adding a NaOH solution with a final concentration of 200mM, reacting for 10min at normal temperature to denature the double-stranded DNA library into single strands, wherein one strand with a biotin label is bonded to the magnetic beads, and the strand without the biotin label is separated from the supernatant. The supernatant was collected, NaOH was removed by desalting column, and finally 500. mu.l of PBS was added, and the collected solution was the single-stranded DNA library used for the next round of screening.

D) Repeating the positive screening process, the PCR amplification and the preparation process of the secondary single-stranded DNA library for 15 times, wherein the single-stranded DNA library obtained by screening has the strongest identification capability on the virus target protein. After cloning and sequencing the obtained single-stranded DNA library, the aptamer which is screened out by the invention and can be used for detecting the infection of the new coronavirus S protein and the new coronavirus N protein is finally obtained, and the DNA sequences of the aptamer are respectively as follows:

novel coronavirus S protein-aptamer

GATGACATTGCACAAGTCAGGGAGGTAATGGTCGGTCATGTAGGACCGGGACGACAGACGGAGTGAATCCTGCTGTTCGA

Novel coronavirus N protein-aptamer

GATGACATTGCACAAGTCAGGAGACTTGCTTTTTAATACAAGCTCGGCATAAACAGCTCTGAGTGAATCCTGCTGTTCGA

E) In order to simultaneously detect two reaction products in a reaction system, each aptamer is labeled with different fluorescent groups at the 5' end (in a covalent bonding manner, directly synthesized by conventional biotechnology service companies), and the aptamer information in the final kit is as follows:

the novel coronavirus S protein-aptamer has a sequence shown as SEQ ID No. 1:

5’-FAM-

GATGACATTGCACAAGTCAGGGAGGTAATGGTCGGTCATGTAGGACCGGGACGACAGACGGAGTGAATCCTGCTGTTCGA-3’(SEQ ID No.1)

the novel coronavirus N protein-aptamer has a sequence shown as SEQ ID No. 2:

5’-VIC-

GATGACATTGCACAAGTCAGGAGACTTGCTTTTTAATACAAGCTCGGCATAAACAGCTCTGAGTGAATCCTGCTGTTCGA-3’(SEQ ID No.2)

example 4 verification of aptamers

A) The secondary Structure of the aptamer screened out by the analysis and prediction of the RNA Structure Program is analyzed by the Structure prediction software, and the result shows that all the aptamers can form a special stem-loop Structure and a hairpin Structure. The new coronavirus S protein-aptamer can form a secondary structure as shown in figure 1, and the new coronavirus N protein-aptamer can form a secondary structure as shown in figure 2.

B) The binding force of the aptamer to the target protein was measured using a ForteBio Octet RED96 interaction analyzer and the results were as follows:

aptamer	Dissociation constant Kd (nM) to target protein
		Novel coronavirus S protein-aptamer	8.1
New coronavirus N protein-aptamer	8.3
		PBS control	Without bonding

C) Human serum albumin, immune serum globulin, saliva amylase protein and 2 kinds of nucleic acid aptamers are respectively adopted for specificity detection, and combination experiments show that 2 kinds of aptamers are not combined with the proteins. The target proteins of 2 viruses are used for carrying out cross reaction detection on 2 kinds of aptamers, and the experimental result shows that the 2 kinds of aptamers are only combined with the corresponding target proteins.

D) 0.2 mu g of each of the 2 aptamers is respectively placed in normal temperature serum and aqueous solution. After 4 weeks, RT-PCR detection was performed, and the aptamer placed was found to be structurally stable and not degraded.

E) Sensitive host cells were infected with the novel coronavirus, while a negative control group without infection was set. After 36h of infection, the cells were trypsinized, centrifuged to give cell pellets and the supernatant removed and resuspended in PBS. Fixing and permeabilizing the cells, mixing the aptamer corresponding to the novel coronavirus and provided with the fluorescent group label with cell suspension infected with the virus and cell suspension of an uninfected control group for 1h, and analyzing and calculating by a flow cytometer. Different aptamers are marked with different fluorescent groups and can be obviously distinguished in a flow cytometer, and the result shows that the fluorescence value of the aptamer mark corresponding to the cell sample infected with the novel coronavirus is obviously increased, which indicates that the aptamers obtained by screening can be used for detecting virus infection.

Example 5 formulation of kit

The kit comprises the following formula:

1) 96-well protein coated plate for fixing sample solution

2) Protein coating liquid

3) Sealing liquid

4) Rinsing liquid

5) Sample pretreatment liquid

6) Aptamer with fluorescent group label

Example 6 preparation of the kit

The preparation information of all the formulas of the kit is as follows:

1) the 96-well protein coated plate for fixing the sample solution is directly used as a commercial ELISA plate with protein adsorption capacity

2) Protein coating liquid

Belongs to a conventional molecular detection reagent, the formula is 35mM NaHCO3, 15mM Na2CO3, pH 9.3-pH 9.9, and double distilled water is used for preparation.

3) Sealing liquid

Belongs to a conventional molecular detection reagent, and the formula is 136mM NaCl,2.6mM KCl and 2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, 1% BSA, pH 7.1-pH 7.7, formulated using double distilled water.

4) Rinsing liquid

Belongs to a conventional molecular detection reagent, and the formula is 136mM NaCl,2.6mM KCl and 2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, pH 7.1-pH 7.7, prepared using double distilled water.

5) Sample pretreatment liquid

Belongs to a conventional molecular detection reagent, and the formula is 150mM NaCl, 1% Triton X-100,50mM Tris, pH7.8-pH8.2, and double distilled water is used for preparation.

6) Aptamer with fluorescent group label

It was synthesized directly by the gene synthesis service of conventional biotechnology service company, dissolved in TE buffer and set to the working concentration (200 nM).

Example 7 use of the kit

20 samples with positive new coronavirus S protein, 20 samples with positive new coronavirus N protein and 20 control samples with no new coronavirus S protein and no new coronavirus N protein are taken. Because no antigen detection kit for simultaneously detecting the new coronavirus S protein and the new coronavirus N protein exists in the current market, parallel experiments are simultaneously carried out on a certain brand of commercially available new coronavirus S protein antigen detection kit, a certain brand of commercially available new coronavirus N protein antigen detection kit and an aptamer detection kit. The experimental results are as follows:

sequence listing

<110> Wuhan university

<120> kit for detecting novel coronavirus double targets and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 80

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gatgacattg cacaagtcag ggaggtaatg gtcggtcatg taggaccggg acgacagacg 60

gagtgaatcc tgctgttcga 80

<210> 2

<211> 80

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gatgacattg cacaagtcag gagacttgct ttttaataca agctcggcat aaacagctct 60

gagtgaatcc tgctgttcga 80

<210> 3

<211> 1273

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val

1 5 10 15

Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe

20 25 30

Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu

35 40 45

His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp

50 55 60

Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp

65 70 75 80

Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu

85 90 95

Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser

100 105 110

Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile

115 120 125

Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr

130 135 140

Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr

145 150 155 160

Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu

165 170 175

Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe

180 185 190

Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr

195 200 205

Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu

210 215 220

Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr

225 230 235 240

Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser

245 250 255

Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro

260 265 270

Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala

275 280 285

Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys

290 295 300

Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val

305 310 315 320

Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys

325 330 335

Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala

340 345 350

Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu

355 360 365

Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro

370 375 380

Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe

385 390 395 400

Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly

405 410 415

Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys

420 425 430

Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn

435 440 445

Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe

450 455 460

Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys

465 470 475 480

Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly

485 490 495

Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val

500 505 510

Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys

515 520 525

Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn

530 535 540

Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu

545 550 555 560

Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val

565 570 575

Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe

580 585 590

Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val

595 600 605

Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile

610 615 620

His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser

625 630 635 640

Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val

645 650 655

Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala

660 665 670

Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala

675 680 685

Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser

690 695 700

Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile

705 710 715 720

Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val

725 730 735

Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu

740 745 750

Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr

755 760 765

Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln

770 775 780

Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe

785 790 795 800

Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser

805 810 815

Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly

820 825 830

Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp

835 840 845

Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu

850 855 860

Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly

865 870 875 880

Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile

885 890 895

Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr

900 905 910

Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn

915 920 925

Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala

930 935 940

Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn

945 950 955 960

Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val

965 970 975

Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln

980 985 990

Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val

995 1000 1005

Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn Leu

1010 1015 1020

Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys Arg Val

1025 1030 1035 1040

Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro Gln Ser Ala

1045 1050 1055

Pro His Gly Val Val Phe Leu His Val Thr Tyr Val Pro Ala Gln Glu

1060 1065 1070

Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His Asp Gly Lys Ala His

1075 1080 1085

Phe Pro Arg Glu Gly Val Phe Val Ser Asn Gly Thr His Trp Phe Val

1090 1095 1100

Thr Gln Arg Asn Phe Tyr Glu Pro Gln Ile Ile Thr Thr Asp Asn Thr

1105 1110 1115 1120

Phe Val Ser Gly Asn Cys Asp Val Val Ile Gly Ile Val Asn Asn Thr

1125 1130 1135

Val Tyr Asp Pro Leu Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu Leu

1140 1145 1150

Asp Lys Tyr Phe Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly Asp

1155 1160 1165

Ile Ser Gly Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp

1170 1175 1180

Arg Leu Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu

1185 1190 1195 1200

Gln Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro Trp Tyr Ile

1205 1210 1215

Trp Leu Gly Phe Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile

1220 1225 1230

Met Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Lys Gly Cys Cys

1235 1240 1245

Ser Cys Gly Ser Cys Cys Lys Phe Asp Glu Asp Asp Ser Glu Pro Val

1250 1255 1260

Leu Lys Gly Val Lys Leu His Tyr Thr

1265 1270

<210> 4

<211> 419

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Ser Asp Asn Gly Pro Gln Asn Gln Arg Asn Ala Pro Arg Ile Thr

1 5 10 15

Phe Gly Gly Pro Ser Asp Ser Thr Gly Ser Asn Gln Asn Gly Glu Arg

20 25 30

Ser Gly Ala Arg Ser Lys Gln Arg Arg Pro Gln Gly Leu Pro Asn Asn

35 40 45

Thr Ala Ser Trp Phe Thr Ala Leu Thr Gln His Gly Lys Glu Asp Leu

50 55 60

Lys Phe Pro Arg Gly Gln Gly Val Pro Ile Asn Thr Asn Ser Ser Pro

65 70 75 80

Asp Asp Gln Ile Gly Tyr Tyr Arg Arg Ala Thr Arg Arg Ile Arg Gly

85 90 95

Gly Asp Gly Lys Met Lys Asp Leu Ser Pro Arg Trp Tyr Phe Tyr Tyr

100 105 110

Leu Gly Thr Gly Pro Glu Ala Gly Leu Pro Tyr Gly Ala Asn Lys Asp

115 120 125

Gly Ile Ile Trp Val Ala Thr Glu Gly Ala Leu Asn Thr Pro Lys Asp

130 135 140

His Ile Gly Thr Arg Asn Pro Ala Asn Asn Ala Ala Ile Val Leu Gln

145 150 155 160

Leu Pro Gln Gly Thr Thr Leu Pro Lys Gly Phe Tyr Ala Glu Gly Ser

165 170 175

Arg Gly Gly Ser Gln Ala Ser Ser Arg Ser Ser Ser Arg Ser Arg Asn

180 185 190

Ser Ser Arg Asn Ser Thr Pro Gly Ser Ser Arg Gly Thr Ser Pro Ala

195 200 205

Arg Met Ala Gly Asn Gly Gly Asp Ala Ala Leu Ala Leu Leu Leu Leu

210 215 220

Asp Arg Leu Asn Gln Leu Glu Ser Lys Met Ser Gly Lys Gly Gln Gln

225 230 235 240

Gln Gln Gly Gln Thr Val Thr Lys Lys Ser Ala Ala Glu Ala Ser Lys

245 250 255

Lys Pro Arg Gln Lys Arg Thr Ala Thr Lys Ala Tyr Asn Val Thr Gln

260 265 270

Ala Phe Gly Arg Arg Gly Pro Glu Gln Thr Gln Gly Asn Phe Gly Asp

275 280 285

Gln Glu Leu Ile Arg Gln Gly Thr Asp Tyr Lys His Trp Pro Gln Ile

290 295 300

Ala Gln Phe Ala Pro Ser Ala Ser Ala Phe Phe Gly Met Ser Arg Ile

305 310 315 320

Gly Met Glu Val Thr Pro Ser Gly Thr Trp Leu Thr Tyr Thr Gly Ala

325 330 335

Ile Lys Leu Asp Asp Lys Asp Pro Asn Phe Lys Asp Gln Val Ile Leu

340 345 350

Leu Asn Lys His Ile Asp Ala Tyr Lys Thr Phe Pro Pro Thr Glu Pro

355 360 365

Lys Lys Asp Lys Lys Lys Lys Ala Asp Glu Thr Gln Ala Leu Pro Gln

370 375 380

Arg Gln Lys Lys Gln Gln Thr Val Thr Leu Leu Pro Ala Ala Asp Leu

385 390 395 400

Asp Asp Phe Ser Lys Gln Leu Gln Gln Ser Met Ser Ser Ala Asp Ser

405 410 415

Thr Gln Ala

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gatgacattg cacaagtcag g 21

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcgaacagca ggattcactc 20

Claims

1. A kit for rapidly detecting double targets of a new coronavirus comprises the following components: A) a protein coated plate for fixing a sample solution, B) a protein coated liquid, C) a confining liquid, D) a rinsing liquid, E) a sample pretreatment liquid, and F) a aptamer with a fluorescent group label, wherein the aptamer comprises a aptamer of a new coronavirus S protein and a aptamer of a new coronavirus N protein, and the fluorescent groups of the two aptamers are different.

2. The kit for detecting the double targets of the new coronavirus according to claim 1, wherein the aptamer of the S protein of the new coronavirus has a nucleotide sequence shown as SEQ ID No.1, and the aptamer of the N protein of the new coronavirus has a nucleotide sequence shown as SEQ ID No. 2.

3. The kit for detecting the double targets of the new coronavirus according to claim 1, wherein the protein coating solution B) is prepared from 35mM NaHCO₃，15mM Na₂CO₃pH 9.3 to pH 9.9, C) the confining liquid is composed of 136mM NaCl,2.6mM KCl,2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, 1% BSA, pH 7.1 to pH 7.7, D) the rinsing solution is composed of 136mM NaCl,2.6mM KCl,2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, pH 7.1-pH 7.7, E) the sample pretreatment solution is composed of 150mM NaCl, 1% Triton X-100,50mM Tris, pH7.8-pH 8.2.

4. The kit for detecting the double targets of the new coronavirus according to claim 3, wherein the protein coating solution B) is prepared from 35mM NaHCO₃，15mM Na₂CO₃pH 9.6, C) the confining liquid is composed of 136mM NaCl,2.6mM KCl,2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, 1% BSA, pH 7.4, D) rinsing solution consisting of 136mM NaCl,2.6mM KCl,2mM KH₂PO₄,8mM Na₂HPO₄0.05% Tween-20, pH 7.4, E) the sample pretreatment solution consists of 150mM NaCl, 1% Triton X-100,50mM Tris, pH 8.0.

5. The kit for detecting the double targets of the new coronavirus according to claim 1, wherein the aptamer sequence is connected with functional groups, the functional groups are various biotin markers, luminescent markers and enzyme-labeled markers, the luminescent markers are selected from one of FAM and VIC fluorescent groups, and the fluorescent groups of the two aptamers are different. The functional group is covalently linked to the 5' end of the aptamer.

6. A kit for preparing the double targets of detecting the new coronavirus S protein in the claim 1 is characterized in that the aptamer of the new coronavirus S protein has amino acid sequence shown in SEQ ID No.3 as the epitope of the target protein antigen of the new coronavirus S protein, and the aptamer is obtained by screening through SELEX technology; the aptamer of the new coronavirus N protein has the amino acid sequence shown in SEQ ID No.4 as the antigen epitope of the new coronavirus N protein target protein, and is obtained by SELEX screening; then, the fluorescent group is connected to the 5' end of the aptamer in a covalent bond mode.

7. Use of the test kit according to claim 1 for the simultaneous detection of a new coronavirus double target.