CN110241119B

CN110241119B - Cardiac troponin I specific aptamer, and screening method and application thereof

Info

Publication number: CN110241119B
Application number: CN201810190653.9A
Authority: CN
Inventors: 罗昭锋; 王进军; 方晓娜; 何磊; 杨伟丽; 何金龙
Original assignee: University of Science and Technology of China USTC
Current assignee: University of Science and Technology of China USTC
Priority date: 2018-03-07
Filing date: 2018-03-07
Publication date: 2022-07-15
Anticipated expiration: 2038-03-07
Also published as: CN110241119A

Abstract

The invention provides a single-stranded DNA aptamer specifically binding cardiac troponin I (cTnI protein for short), which comprises a nucleotide sequence shown in any one of SEQ ID Nos. 1-4. The nucleic acid aptamers of the present invention may also be various analogous sequences having higher homology or derivatives derived from the sequences of the present invention. Compared with protein antibodies, the nucleic acid aptamer of the invention has the advantages of chemical synthesis, small molecular weight, stability, easy storage and labeling and the like. The invention also provides applications of the single-stranded DNA aptamers, which can be used for cTnI protein purification or cTnI protein detection singly or in combination. The present invention also provides a kit for detecting a cTnI protein, which comprises the single-stranded DNA nucleic acid aptamer of the present invention.

Description

Cardiac troponin I specific aptamer, and screening method and application thereof

Technical Field

The invention relates to the fields of biology and medicine, in particular to a nucleic acid aptamer capable of being used for binding Cardiac troponin I (cTnI), and a screening method and application thereof.

Background

Cardiovascular diseases are one of the important diseases affecting human health in today's society, and acute myocardial infarction is a significant cause of death of patients among cardiovascular diseases. Since the abnormality of the myocardial damage marker is one of the main criteria for diagnosing myocardial infarction, many diagnostic reagents for early-stage myocardial damage serum markers exist at the present stage. Troponin (Tn) is a structural protein forming striated muscle filaments, and a compound formed by subunits I, T and C plays an important role in the processes of muscle contraction and relaxation, wherein Cardiac Troponin I (Cardiac Troponin I, cTnI) is a specific protein of Cardiac muscle, has special clinical value for detecting tiny myocardial injury, normally, the level of cTnI in circulation is low, when Cardiac muscle cells are injured, cTnI rapidly enters blood before other biochemical indexes, rises within 3-5 hours, and the concentration of the cTnI in the blood continuously rises along with the aggravation of the injury, reaches a peak within 12-36 hours, and forms a longer time window. Numerous studies have shown that cTnI has proven to be one of the most specific and most sensitive serum markers of myocardial cell injury. Therefore, the rapid, agile and accurate detection of cTnI has important clinical significance.

The current cTnI determination methods comprise an enzyme-linked immunosorbent assay, a solid-phase immunochromatography, a radioimmunoassay, a chemiluminescence assay, a colloidal gold method, an immunoturbidimetry and the like, but no unified standard determination method exists at present, and results of different methods are greatly different among different manufacturers by tens of times at most. Many methods have disadvantages, such as enzyme-linked immunosorbent assay, solid-phase immunochromatography and radioimmunoassay, and have the problems of complicated operation, long detection time, unsuitability for large-scale detection, poor result repeatability, nuclide pollution and the like; the colloidal gold method can only carry out qualitative detection, but cannot carry out quantitative detection. Although the chemiluminescence method has the advantages of accuracy, high sensitivity, strong specificity and good precision, the used instruments and reagents are expensive and high in cost, and are not suitable for development in basic laboratories and are also not suitable for emergency examination.

The aptamer (aptamer) refers to a DNA or RNA molecule obtained by screening and separating by an exponential enrichment ligand system evolution technology (SELEX), and can be combined with other targets such as proteins, metal ions, small molecules, polypeptides and even whole cells with high affinity and specificity, so that the aptamer has a wide prospect in the aspects of biochemical analysis, environmental monitoring, basic medicine, new drug synthesis and the like. Compared with an antibody, the aptamer has the advantages of small molecular weight, better stability, easy modification, no immunogenicity, short preparation period, artificial synthesis and the like, and a series of processes such as animal immunization, feeding, protein extraction and purification and the like are omitted. Some researchers have published some aptamer sequences of cTnI proteins they have discovered, however, these aptamers for cTnI proteins have some disadvantages, e.g., large molecular weight, not very high binding affinity for cTnI proteins, not high specificity, not high stability, etc. Accordingly, there is a need in the art for nucleic acid aptamers with higher binding affinity for cTnI proteins.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide a nucleic acid aptamer and a derivative thereof which have high specificity, small molecular weight, stable chemical properties, easy storage and labeling and can be combined with cTnI protein, and a screening method and application of the nucleic acid aptamer correspondingly.

In order to solve the above technical problems, the present inventors designed and synthesized a random single-stranded DNA library and corresponding primers for screening aptamers capable of binding to cTnI protein with high specificity, small molecular weight, stable chemical properties, easy storage and labeling, thereby screening several aptamers specifically binding to cTnI protein and examining their binding ability to cTnI protein. On the basis of this, the present inventors have completed the present invention.

In a first aspect, the present invention provides a method of screening for an aptamer that specifically binds to a cTnI protein, the method comprising the steps of:

(1) a random single-stranded DNA library and primers shown by the following sequences were synthesized:

random single-stranded DNA library:

5’-TTCAGCACTCCACGCATAGC-40N-CCTATGCGTGCTACCGTGAA-3’

wherein "40N" represents a sequence in which 40 arbitrary nucleotide bases are linked.

5' end primer: 5' -FAM-TTCAGCACTCCACGCATAGC

3' end primer: 5' - (20A) -Spacer 18-TTCACGGTAGCACGCATAGG

Wherein "20A" represents a polyA tail consisting of 20 adenylates (A) and "Spacer 18" represents an 18 atom hexaethylene glycol Spacer. The structural formulas of the three types of 'Spacer 18' are shown as the following formulas I-III.

The structural formula of the ' Spacer 18 ' used in the 3 ' end primer is shown as a formula I.

(2) Screening by a magnetic bead method: activating carboxyl on the surface of the magnetic bead by using two reagents of EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution), and coupling the cTnI protein to the surface of the magnetic bead through amino on the surface; incubating the magnetic beads connected with the cTnI protein with the random nucleic acid library subjected to slow renaturation treatment in the step (1) for 1 hour, fishing the magnetic beads by using a magnet, removing a supernatant, washing the magnetic beads for 6 times by using a screening buffer solution, and removing the supernatant; heating and separating nucleic acid combined on the magnetic beads connected with the cTnI protein to obtain a nucleic acid aptamer primary library obtained by screening;

(3) amplification: carrying out emulsion PCR (emulsion PCR, ePCR) amplification on the library obtained by screening in the step (2), wherein the primers adopt two primers mentioned in the step (1), and an obtained ePCR amplification product is purified by using n-butyl alcohol;

(4) Preparing a DNA single-strand library: adding the product obtained in the step (3) into a denaturation buffer solution (2 x TBE-urea sample buffer solution, product number C506046) of biological engineering (Shanghai) limited company), denaturing for 10 minutes to melt DNA, quickly putting the DNA into an ice-water mixture after the denaturation is finished, carrying out ice bath for 1 minute, centrifuging, carrying out PAGE (gel electrophoresis) on all samples to separate a lengthened chain from a chain marked with FAM (fatty acid amide) and cutting the gel to recover the chain marked with FAM, and concentrating or concentrating and purifying n-butyl alcohol by using an ultrafiltration tube after the DNA is obtained to obtain a DNA single-chain library;

(5) and (3) multi-round screening: replacing the random library of step (2) with the single-stranded DNA library obtained in step (4), and repeating the steps (2) to (4); the method comprises the steps of detecting the enhancement condition of the binding capacity of a DNA single-chain library and cTnI protein through an SPR (surface plasmon resonance) method in multiple rounds of screening processes until the recognition capacity of the DNA single-chain library on the cTnI protein meets the requirement, carrying out clone sequencing on the DNA single-chain library obtained in the last round of screening, analyzing the secondary structure of the obtained sequence by using DNAMAN or RNA structure software, dividing the obtained sequence into several families according to the homology of the primary structure and the similarity of the secondary structure, selecting a sequence with the lowest free energy and the most stable structure from each family for synthesis by the Ministry of biological engineering (Shanghai) corporation, detecting the binding capacity of each sequence and the cTnI protein by using an SPR instrument, and selecting a sequence with affinity as an index, wherein the sequence with the affinity is a nucleic acid aptamer specifically binding the cTnI protein.

Wherein the screening buffer solution in step (2) is PBS (NaCl: 8g/L, KCl: 0.2g/L, Na₂HPO₄：1.15g/L，KH₂PH₄：0.2g/L，CaCl₂：0.1g/L，MgCl₂·6H₂O：0.1g/L；PH7.4)

In a second aspect, the present invention provides an aptamer that specifically binds to a cTnI protein, comprising the nucleotide sequence set forth in any one of SEQ ID nos.1 to 4, or a nucleotide sequence having high homology to the nucleotide sequence set forth in any one of SEQ ID nos.1 to 4 and capable of specifically binding to the cTnI protein, or a nucleotide sequence derived from the nucleotide sequence set forth in any one of SEQ ID nos.1 to 4 and capable of specifically binding to the cTnI protein. Wherein said high homology may be at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% homology to the nucleotide sequence as set forth in any of SEQ ID Nos.1 to 4.

Preferably, the nucleic acid aptamer of the invention that specifically binds to a cTnI protein consists of the nucleotide sequence shown in any one of SEQ ID nos.1 to 4.

Wherein the nucleotide sequences shown in SEQ ID Nos.1-4 are respectively shown as follows:

SEQ ID No.1(cTnI-13)：

5’-

CACGCATAGCTCAGCCGGCAATGAACAACCTCCATTCTAACGCAGTGTTACCTATGCGT

-3’

SEQ ID No.2(cTnI-13s)：

5’-CACGCATAGCTCAGCCGGCAATGAACAACCTCCATTCTAACGCAGTGTTACCTATGCGT-3’

SEQ ID No.3(cTnI-14)：

5’-

CACGCATAGCTACGGCGGCTACAATGCAGTGGGGAGGGACTTGTTGTAACCCTATGCGT

-3’

SEQ ID No.4(cTnI-14s)：

5’-CACGCATAGCTACGGCGGCTACAATGCAGTGGGGAGGGACTTGTTGTAACCCTATGCGT-3’

among the nucleotide sequences shown in SEQ ID Nos.1 to 4, the sequences shown in bold represent primer regions removed when the screened SEQ ID Nos.1 and 3 are truncated. The sequence shown in bold is cut off from SEQ ID No.1 to obtain SEQ ID No. 2; SEQ ID No.3 the sequence shown in bold is truncated to give SEQ ID No. 4.

In addition, it will be appreciated by those skilled in the art that modifications may be made to the aptamers described above at a position in their nucleotide sequences, for example, phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium, or linking isotopologue, provided that the aptamer sequences so modified have desirable properties, for example, may have an affinity for binding cTnI protein equal to or greater than the parent aptamer sequence prior to modification, or may have greater stability, although not significantly increased.

It will be appreciated by those skilled in the art that, as an improvement to the above technical solution, a fluorescent substance, a radioactive substance, a therapeutic substance, biotin, digoxigenin, a nano-luminescent material, a small peptide, siRNA or an enzyme label, etc. may be linked to the nucleotide sequence of the above aptamer, provided that the aptamer sequence thus modified has desirable properties, e.g., may have an affinity for binding cTnI protein equal to or higher than that of the parent aptamer sequence before modification, or may have higher stability although the affinity is not significantly increased.

In other words, the partially substituted or modified aptamer sequences have substantially the same or similar molecular structure, physicochemical properties and functions as those of the original aptamer, and can be used for binding to cTnI protein.

As a general technical concept, the nucleic acid aptamer according to the present invention may also comprise any one of the following three sequences:

(1) a nucleotide sequence having a homology of 60% or more with the nucleotide sequence of the aptamer in all the above embodiments (for example, a part of complementary nucleotides may be deleted or added to the aptamer sequence), preferably, the homology may be 70% or more, 80% or more, 90% or more, or 99% or more; preferably a nucleotide sequence having a homology of 60% or more with the nucleotide sequence set forth in any one of SEQ ID Nos.1 to 4, preferably, the homology with the nucleotide sequence set forth in any one of SEQ ID Nos.1 to 4 may be 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more;

(2) a nucleotide sequence capable of hybridizing with the nucleotide sequence of the aptamer under stringent conditions in all the aforementioned technical schemes; or

(3) An RNA sequence transcribed from the nucleotide sequence of the aptamer according to all the preceding embodiments;

wherein, the nucleotide sequences in (1) to (3) can be specifically combined with cTnI protein.

Furthermore, as a general technical concept, the present invention also provides an aptamer derivative, which is a phosphorothioate backbone derived from the backbone of the nucleotide sequence of the aptamer in all the aforementioned technical means, or a corresponding peptide nucleic acid modified from the aptamer in all the aforementioned technical means.

The above aptamers, whether derived or derived from other derivatives, have substantially the same or similar molecular structure, physicochemical properties and functions as the original aptamers.

In a third aspect, the invention also provides a use of the aptamer or the aptamer derivative. For example, the aptamer of the present invention or a derivative thereof can be used for purification or detection of cTnI protein, and the aptamer of the present invention or a derivative thereof can be used to detect the concentration of cTnI protein in the serum of a subject and determine whether the subject has myocardial cell damage. Preferably, the cTnI protein purification or detection can be performed using any one or more of the aptamers shown in SEQ ID Nos. 1-4. The concentration of cTnI protein in the serum of a subject can be detected by using any one or more aptamers shown in SEQ ID Nos.1-4, and then whether the subject has myocardial cell damage can be judged. And further, whether the subject has a disease associated with myocardial cell injury, such as, but not limited to, acute myocardial infarction, may be diagnosed based on the above information.

In a fourth aspect, the present invention provides a kit for purifying a cTnI protein, the kit comprising an aptamer according to the second aspect of the present invention. Preferably, the kit comprises any one or more of the aptamers shown in SEQ ID nos.1 to 4 or derivatives thereof. More preferably, the kit comprises any one or more of the aptamers shown in SEQ ID nos.1 to 4.

Since the aptamers of the present invention are capable of specifically binding to cTnI protein, the cTnI protein in a sample can be purified using the aptamers of the present invention. For example, when purifying cTnI protein, the specific procedures may be: incubating any one or more aptamer(s) shown in SEQ ID Nos.1-4 or the modified sequence with a sample solution containing cTnI protein, specifically binding the aptamer to the cTnI protein, recovering a compound, eluting the bound cTnI protein by high salt or other methods, and purifying to obtain the cTnI protein; or any one or more aptamers or modified sequences shown in SEQ ID Nos.1 to 4 are firstly fixed on a solid phase matrix, sample liquid containing the cTnI protein is slowly flowed through the solid phase matrix, the aptamer can be specifically combined with the cTnI protein but not with other unrelated proteins, then the solid phase matrix is washed by buffer solution, the unbound unrelated proteins are removed, and the combination of the aptamer and the cTnI protein is destroyed by high salt or other methods, so that the cTnI protein is specifically eluted and collected. The person skilled in the art will be able to select the appropriate purification method depending on the actual requirements.

In a fifth aspect, the present invention provides a kit for detecting a cTnI protein, the kit comprising an aptamer according to the second aspect of the present invention. Preferably, the kit comprises any one or more of the aptamers shown in SEQ ID nos.1 to 4 or derivatives thereof. More preferably, the kit comprises any one or more of the aptamers shown in SEQ ID nos.1 to 4. The kit can accurately determine the concentration of cTnI protein in a sample.

Still further, the present invention provides a kit for detecting the concentration of cTnI protein in serum of a subject, the kit comprising an aptamer according to the second aspect of the present invention. Preferably, the kit comprises any one or more of the aptamers shown in SEQ ID nos.1 to 4 or derivatives thereof. More preferably, the kit comprises any one or more of the aptamers shown in SEQ ID Nos.1 to 4. The kit can quickly, agilely and accurately detect the concentration of the cTnI protein in the serum of a subject, and can further judge whether the subject has myocardial cell damage according to the detected concentration of the cTnI protein in the serum of the subject. In other words, using the concentration of cTnI protein in the serum of a subject to determine whether the subject has myocardial cell damage is a rapid and accurate diagnostic method.

The present invention provides a kit for diagnosing whether a subject has myocardial cell injury, the kit comprising an aptamer according to the second aspect of the present invention. Preferably, the kit comprises any one or more of the aptamers shown in SEQ ID nos.1 to 4 or derivatives thereof. More preferably, the kit comprises any one or more of the aptamers shown in SEQ ID Nos.1 to 4. More preferably, the kit comprises an aptamer represented by SEQ ID No. 1. The kit can quickly, agilely and accurately detect the concentration of the cTnI protein in the serum of a subject, and can further judge whether the subject has myocardial cell damage according to the detected concentration of the cTnI protein in the serum of the subject.

It will be understood by those skilled in the art that the kit for diagnosing whether a subject has myocardial cell injury of the present invention may also be used for diagnosing a disease associated with myocardial cell injury, for example, acute myocardial infarction.

In a sixth aspect, the present invention also provides a method of detecting the concentration of a cTnI protein in serum of a subject, the method being performed using the nucleic acid aptamer according to the second aspect of the present invention. Preferably, the method is performed using any one or more of the aptamers shown in SEQ ID Nos.1 to 4 or derivatives thereof. More preferably, the method is performed using any one or more of the aptamers shown in SEQ ID Nos.1 to 4. More preferably, the method is performed using an aptamer represented by SEQ ID No. 1.

The detection of the concentration of cTnI protein in serum using the aptamer of the present invention can be performed according to a method in the art using a conventional aptamer for detection of a target, for example, the concentration of cTnI protein in serum of a patient with acute myocardial infarction can be detected using the aptamer of the present invention by a dot blot assay.

The present invention also provides a method of diagnosing whether a subject has myocardial cell damage, the method being performed using the aptamer according to the second aspect of the invention. Preferably, the method is performed using any one or more of the aptamers shown in SEQ ID Nos.1 to 4 or derivatives thereof. More preferably, the method is performed using any one or more of the aptamers shown in SEQ ID Nos.1 to 4. More preferably, the method is performed using an aptamer represented by SEQ ID No. 1.

Compared with the prior art, the invention has the advantages that:

the aptamer specifically binding with the cTnI protein, which is obtained by screening, has the advantages of being easier to synthesize than a protein antibody, small in molecular weight, capable of modifying and replacing different parts, more stable, easy to store and the like. The aptamer provided by the invention is adopted to replace an antibody combined with cTnI protein, and the cTnI protein can be combined in a serum environment at normal temperature. In addition, compared with some aptamers of cTnI protein which are published at present, the aptamer obtained by the invention has higher affinity to the cTnI protein, the cTnI protein can be identified in a dot hybridization experiment and can be used for quickly, quickly and accurately detecting the cTnI protein, and the aptamer sequence obtained by the invention can be combined with the cTnI protein in serum, for example, the cTnI-13(SEQ ID No.1) and the cTnI-13s (SEQ ID No.2) can detect the cTnI protein in the serum of patients with acute myocardial infarction, so that the aptamer can be conveniently applied to diagnosis of related diseases at later stage.

Drawings

The above features and advantages of the present invention will become more apparent from the following detailed description when taken in conjunction with the accompanying drawings in which:

FIG. 1 shows data of affinity detection (SPR data) of cTnI-13(A) and cTnI-14(B) with cTnI protein screened in example 1 of the present invention. FIGS. 1A and 1B show that both cTnI-13 and cTnI-14 detected binding to the cTnI protein using SPR instruments with KD values of 48nM and 55nM, respectively.

Fig. 2 shows the data of the affinity detection of four aptamers to cTnI protein (EMSA data) screened in example 1 of the present invention. These data indicate that both cTnI-13 and cTnI-13s exhibit gel blocking with significant binding to the cTnI protein; there was no apparent binding of cTnI-14 and cTnI-14s, and it is likely that there was some difference in the way in which both cTnI-13 and cTnI-14 bind to cTnI protein.

FIG. 3 shows the application of the aptamer cTnI-13 and cTnI-14 obtained by screening in the embodiment of the invention in the detection of cTnI protein by dot hybridization. Fig. 3A shows a schematic diagram of dot hybridization, fig. 3B shows an experimental result of dot hybridization of cTnI protein at a cTnI-13 dot, and fig. 3C shows an experimental result of dot hybridization of cTnI protein at a cTnI-14 dot, which shows that as the concentration of the cTnI protein increases, the color of the developed dot becomes darker, which indicates that both cTnI-13 and cTnI-14 can be used for detection of membrane hybridization of cTnI protein, and the sensitivity is higher.

FIG. 4 shows the use of cTnI-13 and cTnI-13s for the detection of serum samples from patients with acute myocardial infarction. The cTnI protein is respectively used as a positive control, the serum of a normal person is used as a negative control, and figure 4A shows that the aptamer cTnI-13 obtained by screening can detect the cTnI protein in the serum of a patient with acute myocardial infarction; FIG. 4B shows that the aptamer cTnI-13s can detect cTnI protein in serum of patients with acute myocardial infarction

FIG. 5 shows the application of the dot blot method to detection of cTnI-13s and cTnI-14s of aptamers obtained by screening in the embodiment of the invention in cTnI protein detection after modification with biotin. It can be seen that the color development of the experimental group is obvious compared with the spots corresponding to the nucleic acid sequences of the control protein and the control, which indicates that both the biotin-modified cTnI-13s and cTnI-14s can be used for the detection of the membrane-hybridized cTnI protein.

Detailed Description

The present invention is further described below with reference to specific examples, but it will be understood by those skilled in the art that the following examples facilitate a better understanding of the present invention, and the present invention is not limited to these specific examples.

The experimental procedures in the following examples are all conventional ones unless otherwise specified. The test materials used in the following examples are all conventional biochemical reagents, and are commercially available, unless otherwise specified.

Example 1: screening of ssDNA aptamers that specifically bind to cTnI protein

1. A random single-stranded DNA library and primers shown by the following sequences were synthesized:

random single-stranded DNA library:

5 '-TTCAGCACTCCACGCATAGC-40N-CCTATGCGTGCTACCGTGAA-3', wherein "40N" represents a sequence of 40 arbitrary nucleotide bases connected together.

The library was synthesized by Nanjing Kinsley Biotechnology Ltd.

5' end primer: 5' -FAM-TTCAGCACTCCACGCATAGC

3' end primer: 5' - (20A) -Spacer 18-TTCACGGTAGCACGCATAGG

Wherein "20A" represents a polyA tail consisting of 20 adenylates (A) and "Spacer 18" represents an 18 atom hexaethylene glycol Spacer.

The above primers were synthesized by Biotechnology engineering (Shanghai) Ltd.

Random single-stranded DNA library and primers were prepared into 100uM stock solution with PBS buffer (Corning) and stored at-20 ℃ for further use.

2. Screening by magnetic bead method

2.1 coupling of cTnI protein to magnetic beads: 50ul of magnetic beads (Invitrogen, Dynabeads) were taken^TMMyOne^TMCarboxylic Acid, cat # number: 65012) Washed clean with water and EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and 100ul of the mixed reagents are incubated with the magnetic beads for 15 minutes at 25 ℃ to activate the carboxyl on the surfaces of the magnetic beads;

The cTnI protein is diluted to a final concentration of 50. mu.g/mL with 10mM sodium acetate pH4.5, mixed with the activated magnetic beads, and incubated at 25 ℃ for 45 minutes on a vertical mixer, and the cTnI protein is coupled to the surfaces of the magnetic beads through amino groups on the protein surface.

After the coupling is finished, the tube is placed on a magnetic frame, the supernatant is removed, 100ul of 1M ethanolamine hydrochloride with pH8.5 is immediately added into the magnetic beads, the reaction is carried out for 10 minutes at room temperature, and the unreacted activated sites on the surfaces of the magnetic beads are blocked. Placing on a magnetic frame, removing the blocking solution, and using PBS (NaCl: 8g/L, KCl: 0.2g/L, Na) for magnetic beads₂HPO₄：1.15g/L，KH₂PH₄：0.2g/L，CaCl₂：0.1g/L，MgCl₂·6H₂O: 0.1 g/L; pH7.4) 3 washes.

2.2 incubation and washing: 1OD of the random nucleic acid library was dissolved in 130ul of PBS by dilution to 10uM, and dispensed into PCR tubes for renaturation. The PCR instrument was set to incubate at 95 ℃ for 10 minutes to unfold the folded strands, ice-bathe for 5 minutes, and equilibrate for 5 minutes at room temperature. And (3) placing 50uL of the magnetic beads connected with the cTnI protein obtained in the step (2) and the random DNA nucleic acid library subjected to renaturation treatment on a vertical mixer, incubating for 1 hour at 25 ℃, placing on a magnetic frame, keeping the magnetic beads, removing supernatant, washing the magnetic beads for 6 times by PBS (phosphate buffer solution), washing for 1 minute each time, and using 200uL PBS each time.

2.3, separation: treating the magnetic beads obtained in the step 2.2 with a boiling water bath for 10 minutes, collecting supernatant, and using nucleic acid molecules obtained in the supernatant for amplification;

2.4PCR amplification of the library: amplification was performed by emulsion PCR (ePCR) using the library obtained in 2.3 as a template. The mineral oil has the following formula

The template was amplified by adding 2ml of PCR mix. The composition of the PCR mix is as follows:

ddH2O	86.6uL
		10xPfu polymerase buffer	10μL
dNTP(10mM)	2uL
		Forward primer (100. mu.M)	0.5uL
Reverse primer (100. mu.M)	0.5μL
		Pfu(5U/μL)	0.4μL
General System	100ul

Wherein, the primers used are as follows:

a forward primer: 5' -FAM-AGCAGCACAGAGGTCAGATG;

reverse primer: 5' - (20A) -Spacer 18-TTCACGGTAGCACGCATAGG.

Wherein "Spacer 18" represents an 18 atom hexaethyleneglycol Spacer.

The above primers were synthesized by Biotechnology engineering (Shanghai) Ltd.

Mixing the mixed mixture with 4 times of mineral oil, shaking for 2 minutes by using a vortex mixer to generate emulsion, and dividing the emulsion into 100 ul/tube, wherein the amplification conditions are as follows: pre-denaturation at 95 ℃ for 3 min, denaturation at 95 ℃ for 60 sec, annealing at 60 ℃ for 60 sec, extension at 72 ℃ for 60 sec for 25 cycles, storage at 72 ℃ for 5 min, and storage at 4 ℃.

The amplification product was purified with n-butanol: collecting all ePCR products in a 15ml pointed-bottom centrifuge tube, adding n-butanol with 2 times of volume, and oscillating on a vortex mixer to fully mix uniformly; a bench centrifuge, centrifuging at 9000rpm (revolutions per minute) for 10 minutes at room temperature; the upper phase (n-butanol) was removed.

2.5 preparation of DNA Single-Strand library: adding the PCR amplification product obtained by concentration in the step 2.4 into a TBE/urea denaturation buffer solution according to the volume ratio of 1: 1, boiling for denaturation for 15 minutes to denature DNA, then carrying out ice bath for 1 minute, carrying out PAGE gel electrophoresis on all samples, carrying out electrophoresis at 400V until bromophenol blue reaches the bottom of gel, and separating a lengthened chain from a chain marked with FAM, wherein the formula of the 7M urea denaturation polyacrylamide gel is as follows:

urea	3.78g
		40% polyacrylamide	1.8ml
5*TBE	1.8ml
		ddH2O	2.25ml
10％APS	60ul
		TEMED	15ul

Gel cutting to recover FAM labeled chains: the gel was removed and placed on a plastic film, ex (nm): 495, em (nm): 517 detecting the required SSDNA with FAM label; the target band was cut off directly with a clean blade (taking care that the ssDNA with polyA was above the target band when cutting the gel, avoiding cutting the ssDNA with polyA), the gel strip was transferred to a 1.5ml EP tube and triturated, 1ml ddH was added₂After O, the ssDNA in the gel was transferred to the solution in a boiling water bath for 10 minutes, and the gel was centrifuged to remove debris, leaving the supernatant. The supernatant was purified with n-butanol in the same manner as 2.4. The obtained DNA single strand is dialyzed overnight by a dialysis bag with 3KD, and then the DNA single strand can be used as a library for the next round of screening;

3. reverse screening: magnetic beads with BSA protein attached were used for counter-screening, and the coupling method of BSA protein was the same as 2.1. After the second round, each round was subjected to reverse sieving with magnetic reverse sieving beads before performing forward sieving targeting with the cTnI protein, and the supernatant was collected for forward sieving after reverse sieving.

4. And (3) multi-round screening: and (3) replacing the random library in the step 2.2 with the DNA single-stranded library obtained in the step 2.5, repeatedly screening for 6 rounds, taking a secondary library obtained in the previous operation as an initial nucleic acid library in each operation, detecting the change of the recognition capacity of the DNA single-stranded library on the cTnI protein by using SPR in the screening process, and after the recognition capacity of the DNA single-stranded library on the cTnI protein meets the requirement, carrying out clone sequencing analysis on the obtained product to finally obtain the nucleic acid aptamer.

In the screening method, the screening pressure can be increased by turns so as to improve the enrichment degree of the screened aptamer and shorten the screening process. The increase of the screening pressure comprises the reduction of the amount of the single-stranded DNA library, the amount of the target protein and the incubation time of the single-stranded DNA library and the target protein, the increase of the washing time and the washing frequency and the increase of the amount of the magnetic reverse screening beads.

5. Analyzing and identifying the aptamer obtained after multiple screening, carrying out clone sequencing analysis on the obtained enrichment library product, selecting a plurality of sequences to be synthesized from Shanghai, and detecting the affinity.

In subsequent assays, aptamers represented by SEQ ID Nos.1-4 were determined to have an ideal affinity for binding to cTnI protein, and they were named cTnI-13, cTnI-13s, cTnI-14, and cTnI-14s, respectively.

Example 2: surface Plasmon Resonance (SPR) detection of affinity of cTnI aptamers and cTnI proteins

1. The aptamers cTnI-13(SEQ ID No.1) and cTnI-14(SEQ ID No.3) synthesized in Shanghai were diluted with DPBS to: 0.1, 5, 10, 25, 50, 100, 200 nM;

2. coupling cTnI protein to CM5 chip surface: the chip was washed with 50mM NaOH and injected at a flow rate of 10ul/min for 20ul, then 50ul of activated chip was injected after mixing equal volumes of two reagents, EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution), at a flow rate of 5 ul/min. The cTnI protein is diluted by 10mM sodium acetate with pH4.5 to the final concentration of 50 mu g/mL, then the sample is injected, the injection volume is 15 mu L, the flow rate is 5uL/min, and the coupling amount of the cTnI protein is 2000 Ru. After the sample injection is finished, ethanolamine is added to seal the chip, the flow rate is 5uL/min, and the sample injection is 50 uL.

3. And (3) detection: and (3) setting kinetic detection parameters by using Biacore T200, and sequentially injecting the diluted aptamers cTnI-13 and cTnI-14 at various concentrations.

The affinity assay data are shown in FIG. 1A (cTnI-13) and FIG. 1B (cTnI-14), which indicate that both cTnI-13 and cTnI-14 detected binding to the cTnI protein using an SPR instrument with KD values of 48nM and 55nM, respectively.

Example 3: detecting the affinity of the cTnI aptamer and the cTnI protein obtained by agarose gel electrophoresis

1. A1% agarose gel was prepared with 1 XTBE. 1 XTBE was precooled, the aptamers shown in SEQ ID Nos.1-4 were diluted to 1uM with PBS, denatured at 95 ℃ for 10 minutes, immediately ice-cooled for 5 minutes, and equilibrated at room temperature for 10 minutes.

2. The cTnI protein is added to the aptamers shown in SEQ ID Nos.1-4 of step 1 respectively for incubation for 10 minutes.

The incubation system is as follows:

an aptamer: 1uM, 5uL

Protein cTnI: 0.35mg/ml, 5ul

3. Human serum (supplied by Heifengnan Hospital, informed by the subjects) was inactivated at 56 ℃ for 30min, equilibrated at room temperature, added to the mixture of cTnI protein and ssDNA library of step 2 at a final serum concentration of 30% (v/v), and incubated at room temperature for a further 20 min.

4. Electrophoresis (voltage is 400V during electrophoresis, and electrophoresis liquid needs to be replaced in the electrophoresis process to prevent the electrophoresis liquid from being overhigh), and the experimental result is shown in figure 2.

5. And (4) analyzing results: as can be seen from FIG. 2, both cTnI-13(SEQ ID No.1) and cTnI-13s (SEQ ID No.2) and cTnI protein showed gel blocking effect and significant binding phenomenon. cTnI-14(SEQ ID No.3) and cTnI-14s (SEQ ID No.4) do not bind to each other significantly, and may have a difference in binding mode.

Example 4: protein dot hybridization experiment for detecting interaction of biotin-modified cTnI aptamer cTnI-13 and cTnI-14 and cTnI protein

1. A10 cm by 5cm piece of nitrocellulose membrane (from Millipore) was taken and the cTnI protein was diluted with PBS to the following concentrations, respectively: 0.3/0.25/0.2/0.15/0.I/0.05 mg/ml. Spotting 1ul of the solution on a nitrocellulose membrane, and naturally drying.

2. After drying, blocking was carried out with 10% BSA at room temperature for 2 hours, and after blocking, washing once with PBST (PBS containing 0.3% tween20) and blotting.

3. Biotin-modified aptamers cTnI-13 and cTnI-14 were diluted to 500nM, respectively, and renatured: denaturation at 95 ℃ for 10 min, followed by immediate ice-cooling for 5 min and equilibration at room temperature for 10 min.

4. The renatured aptamers were incubated with the cTnI protein on the nitrocellulose membrane in a shaker at room temperature for 1 hour.

5. After incubation, the cells were washed three times with PBST and while washing, they were placed on a shaker for 10 minutes each.

6. HRP-labeled streptavidin (purchased from Biyun Tian, cat # A0303) was added in a 1: 10000(v/v) formulation with PBST and incubated for 30 minutes at room temperature on a shaker.

PBST was washed 3 times, while on a shaker for 10 minutes each.

8. A color developing solution (BeyoECL Star super-type ECL chemiluminescence kit from Biyun, Cat. No. P0018A, with liquid A and liquid B as kit-carrying solutions) was added at a ratio of liquid A to liquid B of 1: 1(v/v) and developed at room temperature for 1 minute.

9. The imaging system observes and takes a picture: ImageQuant with instrumentation as department of GE medical Living sciences^TMLAS 4000 digital imaging system.

The results are shown in FIG. 3, with FIG. 3B showing the results of dot hybridization of the cTnI protein using cTnI-13, and FIG. 3C showing the results of dot hybridization of the cTnI protein using cTnI-14. As can be seen from FIGS. 3B and 3C, the color of the developed spots becomes darker as the concentration of cTnI protein increases, which indicates that both cTnI-13 and cTnI-14 can be used for detection of membrane-hybridized cTnI protein, and the sensitivity is higher.

Example 5: detection of serum from patients with acute myocardial infarction by dot blot assay with aptamers cTnI-13 and cTnI-13s

1. A piece of 1.5cm by 4cm nitrocellulose membrane (from Millipore) was removed, and the samples were spotted on the membrane as shown in FIG. 4, with the control protein rhIL12 in each sample; a cTnI protein; normal human serum; acute myocardial infarction patient serum, each point 1u 1.

2. After drying, blocking with 10% BSA for 2 hours, washing with PBS once after blocking, and blotting.

3. Renaturing cTnI-13(500 nM): incubate for 10 minutes at 95 ℃ and then ice-wash for 10 minutes; the mixture was left to stand at room temperature for 1 hour.

4. The cTnI-13 and nitrocellulose membrane were incubated at room temperature for 1 hour with shaking. After incubation, the cells were washed three times with PBST (0.03% TWEEN 20) for 10 minutes each.

5. HRP-labeled streptavidin (purchased from Biyun, cat # A0303, 1: 10000v/v, in PBST) was added and incubated for 30 minutes at room temperature on a shaker.

PBST was washed 3 times, while being kept on a shaker for 10 minutes each. Adding color development solution, wherein the solution A and the solution B are 1: 1v/v (BeyoECL Star hypersensitive ECL chemiluminescence kit self-carrying solution from Biyun day P0018A), and developing for 1 minute.

7. The imaging system observes the photograph.

The results are shown in fig. 4, and fig. 4A shows that cTnI-13 can detect cTnI protein in serum of patients with acute myocardial infarction. Fig. 4B shows that cTnI-13s can detect cTnI protein in serum of patients with acute myocardial infarction. The above experiments are qualitative experiments, which prove that both cTnI-13 and cTnI-13s can detect cTnI protein in the serum of patients with acute myocardial infarction, the detection sensitivity is not further determined in the experiment, and after the detection conditions are optimized, the aptamer disclosed by the invention has high detection sensitivity (data not shown).

Example 6: protein dot hybridization experiment for detecting interaction of biotin-modified cTnI aptamer cTnI-13s and cTnI-14s and cTnI protein

1. A10 cm X5 cm piece of nitrocellulose membrane (from Millipore) was taken and the cTnI protein was diluted with PBS to a concentration of 0.1 mg/ml. Spotting 1ul of the solution on a nitrocellulose membrane, and naturally drying.

3. Biotin-modified aptamers cTnI-13s and cTnI-14s were diluted to 500nM, respectively, and renatured: denaturation at 95 ℃ for 10 min, followed by immediate ice-cooling for 5 min and equilibration at room temperature for 10 min.

PBST was washed 3 times, while being kept on a shaker for 10 minutes each.

8. The solution A and the solution B are added with a color developing solution (BeyoECL Star hypersensitive ECL chemiluminescence kit, purchased from Biyun, product number P0018A, solution A and solution B are self-contained solutions of the kit) according to the ratio of 1: 1(v/v) to the solution A and the solution B, and the color developing solution is developed for 1 minute at room temperature.

The results are shown in FIG. 5, the aptamer cTnI-13s and cTnI-14s detected by the dot hybridization method can still be used for detecting cTnI protein after being modified by biotin, and it can be seen that the color of the experimental group is obvious compared with the spots corresponding to the control protein and the sequence of the control, which indicates that both the biotin-modified cTnI-13s and the cTnI-14s can be used for detecting the membrane hybridization cTnI protein.

It should be understood that while the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein, and any combination of the various embodiments may be made without departing from the spirit and scope of the present invention as defined by the following claims.

Claims

1. An aptamer that specifically binds to cardiac troponin I, wherein the aptamer consists of the nucleotide sequence set forth in any one of SEQ ID nos.1 to 4.

2. The aptamer of claim 1, wherein the nucleotide sequence of the cardiac troponin I aptamer is modified, the modification being selected from phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, or isotopolization.

3. The nucleic acid aptamer according to claim 1, wherein a fluorescent label, a radioactive substance, a therapeutic substance, biotin, digoxigenin, a nano-luminescent material, a small peptide, siRNA, or an enzyme label is attached to the nucleotide sequence of the nucleic acid aptamer.

4. A nucleic acid aptamer that specifically binds cardiac troponin I, wherein the nucleic acid aptamer consists of: an RNA sequence transcribed from the nucleotide sequence of the aptamer according to claim 1.

5. A nucleic acid aptamer derivative, wherein the derivative is a phosphorothioate backbone sequence derived from the backbone of the nucleotide sequence of the nucleic acid aptamer according to any one of claims 1 to 4, or a peptide nucleic acid modified from the nucleic acid aptamer according to any one of claims 1 to 4.

6. Use of the aptamer according to any one of claims 1 to 4 or the aptamer derivative according to claim 5 for the preparation of a kit for purifying cardiac troponin I or for detecting cardiac troponin I.

7. A kit, wherein the kit comprises one or more of the aptamer of any one of claims 1 to 4 and the aptamer derivative of claim 5.

8. The kit of claim 7, wherein the kit is for detecting cardiac troponin I levels in serum of a subject.

9. The kit of claim 7, wherein the kit is for diagnosing whether a subject has myocardial cell injury.